A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
We aimed to develop a reproducible protocol for isolating and maintaining long-term cultures of human fungiform taste papillae cells. Cells from human fungiform papillae obtained by biopsy were successfully maintained in culture for more than eight passages (12 months) without loss of viability.
Taste cells are highly specialized, with unique histological, molecular and physiological characteristics that permit detection of a wide range of simple stimuli and complex chemical molecules contained in foods. In human, individual fungiform papillae contain from zero to as many as 20 taste buds. There is no established protocol for culturing human taste cells, although the ability to maintain taste papillae cells in culture for multiple cell cycles would be of considerable utility for characterizing the molecular, regenerative, and functional properties of these unique sensory cells. Earlier studies of taste cells have been done using freshly isolated cells in primary culture, explant cultures from rodents, or semi-intact taste buds in tissue slices1,2,3,4. Although each of these preparations has advantages, the development of long-term cultures would have provided significant benefits, particularly for studies of taste cell proliferation and differentiation. Several groups, including ours, have been interested in the development and establishment of taste cell culture models. Most attempts to culture taste cells have reported limited viability, with cells typically not lasting beyond 3-5 d5,6,7,8. We recently reported on a successful method for the extended culture of rodent taste cells9. We here report for the first time the establishment of an in vitro culture system for isolated human fungiform taste papillae cells. Cells from human fungiform papillae obtained by biopsy were successfully maintained in culture for more than eight passages (12 months) without loss of viability. Cells displayed many molecular and physiological features characteristic of mature taste cells. Gustducin and phospholipase C β2, (PLC-β2) mRNA were detected in many cells by reverse transcriptase-polymerase chain reaction and confirmed by sequencing. Immunocytochemistry analysis demonstrated the presence of gustducin and PLC-β2 expression in cultured taste cells. Cultured human fungiform cells also exhibited increases in intracellular calcium in response to appropriate concentrations of several taste stimuli indicating that taste receptors and at least some of the signalling pathways were present. These results sufficient indicate that taste cells from adult humans can be generated and maintained for at least eight passages. Many of the cells retain physiological and biochemical characteristics of acutely isolated cells from the adult taste epithelium to support their use as a model taste system. This system will enable further studies of the processes involved in proliferation, differentiation and function of mammalian taste receptor cells in an in vitro preparation.
Human fungiform taste papillae used for establishing human fungiform cell culture were donated for research following proper informed consent under research protocols that were reviewed and approved by the IRB committee. The protocol (#0934) was approved by Schulman Associates Institutional Review Board Inc., Cincinnati, OH. Written protocol below is based on published parameters reported by Ozdener et al. 201110.
1. Obtaining Human Fungiform Taste Papillae
2. Human Fungiform Taste Papillae Digestion
Human fungiform taste cell papillae can be dissociated using two different enzymatic digestion protocols with slight differences.
3. Culturing of Human Fungiform Taste Papillae Cells
4. Propagation of Human Fungiform Taste Papillae Cells
5. Freezing and Thawing Cultured Human Fungiform Taste Papillae Cells
6. Representative Results
Attempts to grow taste biopsies in culture were successful 90% of the time. A few days after biopsy and dissociation, cells typically began to grow and migrate outwards from the pieces of dissected fungiform tissue that remained after the dissociation procedure. Although individual cells were visible 24-48 hr after plating (Figure 1A), cells grew for up to 2-3 weeks under attached cell clusters, occasionally generating daughter cells (Figure 1B). From biopsying 4-8 human fungiform papillae, initial isolates of primary human fungiform taste papillae cells reach approximately 2000 - 8000 cells in 4 weeks in culture. Expansion in T25 cell culture flasks (passage 0) for additional 3-4 weeks will result in having human fungiform taste papillae cells in culture adapted (Figure 1C). Primary human fungiform taste papillae cells can be further expanded in culture to yield upwards of at least a million cells by passage-1 in 3-4 weeks (Figure 1D). Primary taste cells will continue to grow for more than 8 passages.
The morphology of the cultured human fungiform taste papillae cells in culture was similar to cultured chemosensory cells described previously11,12.. Most cultured human fungiform taste papillae cells maintained their original compact appearance of cell bodies with or without one or more processes up to 15-30 days. After they reached confluence most of the cultured cells had a polarized-elongated appearance. Mature taste cells consist of several different histological subtypes and exhibit taste cell specific features. Here we show that cells within these cultures display many molecular and physiological features characteristic of mature taste cells. Gustducin and phospholipase C - β2, (PLC-β2) mRNA were detected by reverse transcriptase-polymerase chain reaction and products confirmed by sequencing (Figure 2). Expression of gustducin and PLC-β2 was detected immunocytochemically indicating the presence of type II-like cells (Figure 3 B and D respectively). The prevalence and relative expression patterns of gustducin and PLC-β2 reflecting cell signaling pathways and cell types does not precisely reflect that seen in vivo. The factors governing the relative distribution of different cell types within a taste bud are unknown, and may not be replicated in the culture conditions. Therefore, both the similarities and differences between the cultured cells and their in vivo counterparts provide an opportunity to examine the regulation of these characteristics at a molecular level, under conditions which can be manipulated and monitored.
An important criterion for a model system is the presence of relevant functional properties. Cultured cells also exhibited robust increases in intracellular calcium in response to appropriate concentrations of several taste stimuli (Figure 4). In these studies, sweet and bitter stimuli elicit an increase in intracellular calcium that may correspond to a depolarization. These taste cell-like properties of the cultured cells lend support to the assertion that the model system we describe here will be a valuable asset for further studies of the transduction pathways and regenerative capacity of human taste cells.
Figure 1. Attachment and morphology of cultured human fungiform taste papillae cells. Primary human fungiform taste papillae cell cultures grown on collagen type-1 coated plates were imaged after 2 days (A). Human fungiform taste papillae cells grew for up to 4 weeks under attached cell clusters, which seemed to give rise to daughter cells. The cells typically grew to confluence within four weeks (B), and (C and D) represents day 2 and 4 weeks after harvesting and reseeding respectively. Cultured cells continued to grow for at least 8 months. Scale bars = 50 nm. Part of Figure 1 was also presented in Ozdener et. al.10.
Figure 2. RT-PCR results demonstrated the presence of specific taste cell biomarker mRNAs (gustducin and PLC-β2,). Total RNA from cultured human fungiform cells was reverse transcribed using the Superscript First Strand Synthesis System for RT-PCR (Invitrogen) and used for PCR by amplifying with specific primers designed for detection of gustducin and PLC-β2. Primers (Table 1) were chosen to span one or more introns. Each mRNA was detected in cultured human fungiform taste papillae cells from passage 4 or 5 with amplification products of the expected size, confirmed by sequencing. Specific mRNA was not detected in control experiments without reverse transcriptase indicating no genomic DNA contamination. PCR products were separated on 2% agarose gels and the amplified products on the gel were excised with a razor. DNA was extracted from the gel using QIAquick Gel Extraction Kit (Qiagen). PCR products were sequenced at the University of Pennsylvania Sequencing facilities. C-PCR and C-RT are control experiments for PCR and Reverse Transcriptase, respectively. Part of Figure 2 was also presented in Ozdener et. al.10.
Figure 3. Immunostaining of cultured human fungiform taste papillae cells passage 4 or 5 showed presence of taste cell biomarkers. Cultured human fungiform taste papillae cells (5 days old) were fixed with 4% paraformaldehyde, and incubated with primary antibodies (Table 2) overnight at 4 °C. Images were acquired with a Leica TCS-SP2 confocal laser scanning microscope. Approximately, 60% of cultured fungiform taste papillae cells were labeled with gustducin (B) and 20-30 % with PLC-β2 (D). Transmission images of corresponding cells are shown (A and C). For controls, immunostaining with antibody specific immunoglobulin demonstrated the absence of nonspecific immuno reactivity (data not shown). Scale bars = 50 nm. Part of Figure 3 was also presented in Ozdener et. al.10.
Figure 4. Cultured human fungiform taste papillae cells from passage 4 or 5 respond to different stimuli. Cultured human fungiform taste papillae cells (4-5 days old) were loaded with 1mM Fura-2 AM (Molecular Probes) and 10 mg/ml Pluronic F127 (Molecular Probes). Changes in intracellular calcium levels ([Ca2+]i) in cultured human fungiform taste papillae cells were measured using standard manual imaging techniques. The cells were visualized using an inverted fluorescence microscope at excitation wavelengths of 340 nm and 380 nm and an emission wavelength set by a band pass filter centered at 510 nm. Stimuli were dissolved in Bath solution and then pH and osmolarity readjusted if needed. Cultured human fungiform taste papillae cells responded to sweet and bitter stimuli. Graphs illustrate representative responses of [Ca+2]i levels in individual cells during exposure to (A) Denatonium (2 mM), (B) Sucralose (1 mM). Each trace represents single individual cells.
Gene | Sequence | PCR condition | Expected size (bp) | Reference | |
β-Actin | GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG | 7 min 45 sec 45 sec 45 sec 7 min | 95 94 53 72 72 | 234 | NM_001101.3 |
Gustducin | TCTGGGTATGTGCCAAATGA GGCCCAGTGTATTCTGGAAA | 7 min 45 sec 45 sec 45 sec 7 min | 95 94 53 72 72 | 386 | NM_001102386 |
PLC-β2 | GTCACCTGAAGGCATGGTCT TTAAAGGCGCTTTCTGCAAT | 3 min 30 sec 30 sec 60 sec 7 min | 95 94 53 72 72 | 333 | NM_004573 |
Table 1. Primers and conditions used for detecting taste specific molecules.
Primary Antibody | Source | Host | Dilution | Secondary Antibody | Source | Host | Dilution |
Gustducin | SantaCruz | Rabbit | 1:500 | Anti-rabbit IgG Alexa 633 | Molecular Probes | Goat | 1:500 |
PLC-β2 | SantaCruz | Rabbit | 1:500 | Anti-rabbit IgG Alexa 633 | Molecular Probes | Goat | 1:500 |
Table 2. Antibodies used for detecting expression of specific molecules.
We have maintained cells obtained from human fungiform taste papillae for over 8 passages, spanning a period of 12 months. These cultures generate new cells, many of which mature in vitro to the stage where they express several markers of mature taste bud cell types, in addition to key molecular and physiological properties of taste receptor cells. The presence of gustducin- and PLC-β2 immunoreactivity in subsets of cultured cells is consistent with this conclusion. Most importantly, some cells responded to...
No conflicts of interest declared.
We thank Aimee Myers and Esi Quayson for technical skills and help. This work was supported in part by NSF 0216310 and Givaudan Inc grant (NER).
Name | Company | Catalog Number | Comments |
Name of the reagent | Company | ||
MCDB 123 | Sigma-Aldrich | ||
Iscove's DMEM Medium | MediaTech | ||
Elastase | Sigma-Aldrich | ||
Pronase E | Sigma-Aldrich | ||
Elastase | Worthington | ||
Soy bean trypsin inhibitor | Worthington | ||
Collagenase type 1 | Worthington | ||
Rat tail collagen type 1 | BD Sciences | ||
Fura-2 AM | Molecular Probes | ||
Superscript First Strand Synthesis System for RT-PCR | Invitrogen | ||
Leica TCS SP2 Spectral Confocal Microscope | Leica Microsystems Inc. | ||
Discovery-1 imaging station and Metamorph software | Molecular Devices | ||
Small fine-tip forceps and extra fine spring scissors | Fine Science Tools |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved