A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.
Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.
Studying how macromolecules fold and interact with each other is the key to understanding gene regulation in the cell. While much effort has been focused in the past decade on understanding how DNA and proteins contribute to gene regulation, relatively less is known about post-transcriptional regulation of gene expression. RNA carries information in both its linear sequence and in its secondary and tertiary structure1. Its ability to base pair with itself and with others is important for its function in vivo. Recent advances in high throughput RNA secondary structure probing has provided valuable insights into the locations of double and single stranded regions in the transcriptome2,3,4,5,6,7,8, however information on the pairing interaction partners is still largely missing. To determine which RNA sequence is interacting with another RNA region in the transcriptome, we need global pair-wise information.
Mapping pair-wise RNA interactions in a global, unbiased manner has traditionally been a major challenge. While previous approaches, such as CLASH9, hiCLIP10 and RAP11, are used to identify RNA interactions in a large scale manner, these techniques typically map RNA base pairing for a subset of RNAs that either interact with a particular protein or RNA species. Recent developments in studying global RNA interactions include the method RPL12, which does not stabilize RNA interactions in vivo and hence may only capture a subset of in vivo interactions. To overcome these challenges, we and others developed genome-wide, unbiased strategies to map RNA interactomes in vivo, using modified versions of the crosslinker psoralen13,14,15. In this protocol, we describe the details for performing Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which utilizes biotinylated psoralen to crosslink base pairing RNAs in vivo, followed by proximity ligation and high throughput sequencing to identify RNA base-pairing partners genome-wide (Figure 1)15.
In this manuscript, we describe the steps to perform SPLASH using cultured adherent cells, in this case HeLa cells. The same protocol can be easily adapted to suspension mammalian cells and to yeast and bacteria cells. Briefly, HeLa cells are treated with biotinylated psoralen and irradiated at 365 nm to crosslink interacting RNA base pairs in vivo. The RNAs are then extracted from the cells, fragmented and enriched for crosslinking regions using streptavidin beads. Interacting RNA fragments are then ligated together using proximity ligation and made into a cDNA library for deep sequencing. Upon sequencing, the chimeric RNAs are mapped onto the transcriptome/genome to identify the RNA interacting regions that are paired to each other. We have successfully utilized SPLASH to identify thousands of RNA interactions in vivo in yeast and different human cells, including intramolecular and intermolecular RNA base pairing in diverse classes of RNAs, such as snoRNAs, lncRNAs and mRNAs, to glimpse into the structural organization and interaction patterns of RNAs in the cell.
Access restricted. Please log in or start a trial to view this content.
1. Treatment of HeLa Cells with Biotinylated Psoralen and RNA Extraction
2. RNA Fragmentation
3. RNA Size Selection and Elution
4. Enrichment of RNA Crosslinking Regions
5. Proximity Ligation
6. Reverse Crosslinking of Biotinylated Psoralen
7. Reverse Transcription and cDNA Circularization
8. PCR Amplification (Small Scale PCR)
9. PCR Amplification (Large Scale PCR) and Purification
Access restricted. Please log in or start a trial to view this content.
Figure 1 depicts the schematic of the SPLASH workflow. Upon the addition of biotinylated psoralen in the presence of 0.01% digitonin, and UV crosslinking, total RNA is extracted from the cells and a dot blot is performed to ensure that crosslinking of biotinylated to the RNA has happened efficiently (Figure 2). We use biotinylated 20 base oligos as positive controls to titrate the amount of biotinylated psoralen to be added to th...
Access restricted. Please log in or start a trial to view this content.
Here, we describe in detail the experimental and computational workflow for SPLASH, a method that allows us to identify pair-wise RNA interactions in a genome-wide manner. We have successfully utilized SPLASH in bacterial, yeast and human cultures and anticipate that the strategy can be widely applied to diverse organisms under different cellular states. One of the critical steps in the protocol is to start with at least 20 µg of crosslinked RNA to have adequate material for downstream processes. The RNA is then fra...
Access restricted. Please log in or start a trial to view this content.
The authors do not have competing financial interests.
We thank members of the Wan lab and the Nagarajan lab for informative discussions. N.Nagarajan is supported by funding from A*STAR. Y.Wan is supported by funding from A*STAR and Society in Science-Branco Weiss Fellowship.
Access restricted. Please log in or start a trial to view this content.
Name | Company | Catalog Number | Comments |
1 kb Plus DNA Ladder | Life Technologies Holdings Pte Ltd | 10787026 | DNA ladder |
10 bp DNA ladder | Life Technologies Holdings Pte Ltd | 10821-015 | DNA ladder |
20% SDS solution | First BASE | BUF-2052-1L | |
20x SSC | First BASE | BUF-3050-20X1L | |
3.0 M Sodium Acetate Solution | First BASE | BUF-1151-1L-pH5.2 | Required for nucleic acid precipitation |
40% Acrylamide/Bis Solution, 19:1 | Bio-Rad | 1610145 | TBE Urea gel component |
Ambion Buffer Kit | Life Technologies Holdings Pte Ltd | AM9010 | |
Ammonium Persulfate, Molecular Grade | Promega | V3131 | TBE Urea gel component |
Bromophenol Blue | Sigma-Aldrich | B0126-25G | |
Chloroform | Merck | 1.02445.1000 | RNA extraction |
Single strand DNA ligase | Epicentre | CL9025K | CircLigase II ssDNA Ligase |
Centrifuge tube filters | Sigma-Aldrich | CLS8160-96EA | Costar Spin-X centrifuge tube filters |
D5628-1G DIGITONIN CRYSTALLINE | Sigma-Aldrich | D5628-1G | For cell treatment |
Dark Reader Transilluminator | Clare Chemical Research | Dark Reader DR89X Transilluminator | Blue light transilluminator |
DNA Gel Loading Dye (6x) | Life Technologies Holdings Pte Ltd | R0611 | Required for agarose gel electroporation |
Dulbecco's Modified Eagle Medium | Pan BioTech | P04-03500 | For Hela cell culture |
Streptavidin magnetic beads | Life Technologies Holdings Pte Ltd | 65002 | Dynabeads MyOne Streptavidin C1 |
Magnetic stand for 15 mL tubes | Life Technologies Holdings Pte Ltd | 12301D | DynaMag-15 |
Magnetic stand for 15 mL tubes | Life Technologies Holdings Pte Ltd | 12321D | DynaMag-2 |
ThermoMixer | Eppendorf | 5382 000.015 | Eppendorf ThermoMixer C |
Biotinylated psoralen | Life Technologies Holdings Pte Ltd | 29986 | EZ-Link Psoralen-PEG3-Biotin |
F8T5/BL | Hitachi | F8T5/BL | 365 nm UV bulb |
Fetal Bovine Serum | Life Technologies Holdings Pte Ltd | 10270106 | Components of Hela medium |
Formamide | Promega | H5052 | Component in hybridization buffer |
G8T5 | Sankyo-Denki | G8T5 | 254 nm UV bulb |
Glycogen | Life Technologies Holdings Pte Ltd | 10814010 | Required for nucleic acid precipitation |
Nanodrop | Life Technologies Holdings Pte Ltd | Nanodrop 2000 | Spectrophotometer for nucleic acidquantification |
Nuclease free water | First BASE | BUF-1180-500ml | |
Penicillin Streptomycin | Life Technologies Holdings Pte Ltd | 15140122 | Components of Hela medium |
High-Fidelity DNA polymerase (2x) | Life Technologies Holdings Pte Ltd | F531L | Phusion High-Fidelity PCR Master Mix with HF Buffer (2x) |
Primers Set 1 | New England Biolabs | E7335L | PCR primers |
DNA Gel Extraction Kit | QIAgen | 28106 | QIAquick Gel Extraction Kit |
Fluorometric Quantification kit | Life Technologies Holdings Pte Ltd | Q32854 | Qubit dsDNA HS Assay Kit |
RNA clean up kit | Qiagen | 74106 | RNeasy Mini Kit Silica-membrane column |
Rnase Inhibitor | Life Technologies Holdings Pte Ltd | AM2696 | SUPERase In |
Reverse transcriptase | Life Technologies Holdings Pte Ltd | 18080400 | SuperScript III First-Strand Synthesis SuperMix |
Nucleic Acid Gel Stain | Life Technologies Holdings Pte Ltd | S11494 | SYBR GOLD NUCLEIC ACID 500 UL |
T4 Polynucleotide Kinase | New England Biolabs | M0201L | End repair enzyme |
T4 RNA Ligase 1 | New England Biolabs | M0204L | Enzyme for proximity ligation |
T4 RNA Ligase 2, truncated KQ | New England Biolabs | M0373L | Enzyme for adaptor ligation |
Temed | Bio-Rad | 1610801 | TBE Urea gel component |
Guanidinium thiocyanate-phenol-chloroform | Life Technologies Holdings Pte Ltd | 15596018 | TRIzol® Reagent for RNA extraction |
Urea | First BASE | BIO-2070-5kg | |
UV crosslinker | Stratagene | 400072 | UV Stratalinker 1800 |
UV Transilluminator | UVP | 95-0417-01 | For visualizing of bands |
Xylene Cyanol FF | Sigma-Aldrich | X4126-10G | |
DNA cleanup it | Zymo Research | D4004 | Zymo DNA concentrator-5 |
List of software required | |||
FastQC software | 0.11.4 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | |
SeqPrep software | 1.0.7 | https://github.com/jstjohn/SeqPrep | |
BWA software | 0.7.12 | http://bio-bwa.sourceforge.net/ | |
SAMTOOLS software | 1.2.1 | http://www.htslib.org/ | |
PULLSEQ software | 1.0.2 | https://github.com/bcthomas/pullseq | |
STAR software | 2.5.0c | https://github.com/alexdobin/STAR | |
rem_dups.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
find_chimeras.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
pickJunctionReads.awk AWK script | AWK GNU 4.1.2 | https://github.com/CSB5/splash/tree/master/src | |
Buffer composition | |||
Elution buffer | |||
0.3 M sodium acetate | |||
Lysis Buffer | |||
50 mM Tris-Cl pH 7.0 | |||
10 mM EDTA | |||
1% SDS | |||
Always add Superase-in fresh before use except when washing beads | |||
Proteinase K Buffer | |||
100 mM NaCl | |||
10 mM Tris-Cl pH 7.0 | |||
1 mM EDTA | |||
0.5% SDS | |||
Hybridization Buffer | |||
750 mM NaCl | |||
1% SDS | |||
50 mM Tris-Cl pH 7.0 | |||
1 mM EDTA | |||
15% formamide (store in the dark at 4 °C) | |||
Always add Superase-in fresh before use | |||
2x SSC Wash Buffer | |||
2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock) | |||
0.5% SDS | |||
2x RNA fragmentation buffer | |||
18 mM MgCl2 | |||
450 mM KCl | |||
300 mM Tris-Cl pH 8.3 | |||
2x RNA loading Dye | |||
95% Formamide | |||
0.02% SDS | |||
0.02% bromophenol blue | |||
0.01% Xylene Cyanol | |||
1 mM EDTA | |||
3' RNA adapter sequence: 5rAppCTGTAGGCACCATCAAT/3ddC | |||
RT primer sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved