JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Biology

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Published: January 23rd, 2019

DOI:

10.3791/58298

1RNA Biology Laboratory, RIKEN, 2RNA Systems Biochemistry Laboratory, RIKEN Cluster for Pioneering Research, 3Laboratory for Phyloinformatics, RIKEN Center for Biosystems Dynamics Research, 4RNA Biology Laboratory, Faculty of Pharmaceutical Sciences, Hokkaido University, 5Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, University of Tokyo

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.

To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is e....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.

1. Tissue dissection

  1. Dissect the tissues of interest into small pieces (approximately <3 mm2) using fine spring scissors.
    Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.
  2. Add the dissected tissue fragmen.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.

A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects "Cellular Evolution" and all RIKEN project "Disease and Epigenome" from RIKEN (to S.N. and S.I.).

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Protein LoBind tube, 2 mL Eppendorf No. 0030108132 For cell lysis
Protein LoBind tube, 1.5 mL Eppendorf No. 0030108116 For ChIP and library preparation
DNA LoBind tube, 1.5 mL Eppendorf No. 0030108051 For ChIP and library preparation
8-strip PCR tube BIO-BIK 3247-00 For ChIP and library preparation
SK Mill TOKKEN SK-200 Handy cryogenic grinder to make cell powder for fixation
Metal bullet TOKKEN SK-100-DLC10 Accessory of SK Mill
2 mL stainless steel tube TOKKEN TK-AM5-SUS An option for cell lysis
2 mL stainless steel tube holder TOKKEN SK-100-TL An option for cell lysis
16% formaldehyde (w/v), methanol-free Pierce 28906 To fix cells. Prepare 1% solution before use.
Glycine Nacalai Tesque 17109-35 Prepare 2.5 M stock
D-PBS (-)(1x) Nacalai Tesque 14249-24 For washing lysate and purified DNA
HEPES Nacalai Tesque 02443-05 For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.
5 M NaCl, molecular biology grade Nacalai Tesque 06900-14 For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
0.5 M EDTA, molecular biology grade Wako Pure Chemical Industries, Ltd. 311-90075 For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer
Glycerol Wako Pure Chemical Industries, Ltd. 072-04945 For lysis buffer 1
NP-40 Nacalai Tesque 25223-75 For lysis buffer 1
Triton X-100, molecular biology grade Nacalai Tesque 12967-32 For Lysis buffer 1
Tris Nacalai Tesque 35406-91 For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.
0.1 M EGTA pH neutral Nacalai Tesque 08947-35 For Lysis Buffer 2
Protease inhibitor cocktail (100x) Nacalai Tesque 25955-24 To block degradation of protein
RIPA buffer Thermo Fisher Scientific 89900 For cell lysis and washing
milliTUBE 1 mL AFA Fiber Covaris 520130 Sonicator tube. Accessory of Focused-ultrasonicator
Focused-ultrasonicator Covaris S220 or E220 To digest DNA into adequate size for ChIP-Seq
UltraPure 10% SDS Thermo Fisher Scientific 15553-027 For ChIP Elution Buffer
RNase A Nacalai Tesque 30141-14 To purify DNA from lysate
Proteinase K, recombinant, PCR Grade Sigma-Aldrich 3115887001 To purify DNA from lysate
Ethanol Wako Pure Chemical Industries, Ltd. 054-07225 Make 70% solution
Monoclonal anti-FLAG M2 antibody produced in mouse Sigma-Aldrich F1804 To purify chromatin expressed in cells of interest
Dynabead M-280 Sheep Anti-Mouse IgG Thermo Fisher Scientific 11201D This can be used for anti-FLAG IP and anti-H3K4me3 IP
Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody Wako Pure Chemical Industries, Ltd. 301-34811 Any other antibody that works for ChIP analysis will work
10x Blocking Reagent Sigma-Aldrich 11096176001 For blocking during affinity purification
Denhardt’s solution Nacalai Tesque 10727-74 For blocking during affinity purification
Glycogen (5 mg/ml) Thermo Fisher Scientific AM9510 To purify DNA from lysate
Qubit 2.0 Fluorometer Thermo Fisher Scientific Q32866 For quantification of isolated DNA
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32851 For quantification of isolated DNA
0.5 mL tube Axygen 10011-830 For quantification by Qubit
Phenol/chloroform/isoamyl alcohol (25:24:1) Nacalai Tesque 25970-56 To purify DNA from lysate
AMPure XP beads Beckman Coulter A63881 SPRI magnetic beads for library preparation
Metal ice rack Funakoshi IR-1 To keep the cell lysate frozen
Sample Cooler New England Biolabs T7771S Helps fix cells with minimal damage
2100 Bioanalyzer Agilent Technologies G2939BA To check the quality of isolated DNA fragments. Another fragment analyzer can be used.
Bioanalyzer 2100 Expert Software Agilent Technologies G2946CA Supplied with the Bioanalyzer
High Sensitivity DNA Kit Agilent Technologies 5067-4626 To check the quality of the isolated DNA fragments
KAPA LTP Library Preparation Kit Roche 07961898001 Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution
NEXTflex DNA Barcodes BIOO Scientific NOVA-514101 Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.
KAPA Real-Time Library Amplification Kit Roche 07959028001 Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards
2x KAPA HiFi HotStart ReadyMix Roche KM2602 For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit
Buffer EB Qiagen 19086 10 mM Tris-Cl, pH 8.5 for elution of DNA
386-well qPCR plate Thermo Fisher Scientific 4309849 For real-time PCR
QuantStudio 7 Flex Real-Time PCR System Thermo Fisher Scientific 4485701 To quantify DNA
MicroAmp Optical Adhesive Film Thermo Fisher Scientific 4311971 For real-time PCR
MicroAmp Clear Adhesive Film Thermo Fisher Scientific 4306311 For plate sealing
End-repair master mix Combine 1.4 µL of 10x KAPA End Repair Buffer, 1 µL of KAPA End Repair Enzyme Mix, and 1.6 µL of H2O
A-taling master mix Combine 1 µL of KAPA A-Tailing Buffer, 0.6 µL of KAPA A-Tailing Enzyme, and 8.4 µL of H2O
Ligation buffer mix Combine 2 µL of KAPA ligation buffer and 6 µL of H2O
Real-time PCR master mix Combine 5 µL of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 µL of PCR Primer Mix (10 µM each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 µL of H2O
PCR master mix Combine 10 µL of 2x KAPA HiFi Ready Mix, 0.9 µL of PCR Primer Mix, and 0.6 µL of H2O
Integrative Genomics Viewer Broad Institute IGV_2.3.88 Genome browser to visualize sequencing data
DNA olgionucleotide: 5′-GCCTACGCAGGTCTTGCTGAC-3′ Eurofins Genomics A primer to amplify the promoter region of GAPDH
DNA olgionucleotide: 5′-CGAGCGCTGACCTTGAGGTC-3′ Eurofins Genomics A primer to amplify the promoter region of GAPDH
SYBR Premix Ex Taq Takara RR420L To quantify the DNA corresponding to the GADPH promoter region
Thermal Cycler Dice Takara TP870 To quantify the DNA corresponding to the GADPH promoter region

  1. Mito, M., et al. Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing. Scientific Reports. 8 (1), 1143 (2018).
  2. Kadota, M., et al. CTCF binding landscape in jawless fish with reference to Hox cluster evolution. Scientific Reports. 7 (1), 4957 (2017).
  3. Jung, Y. L., et al. Impact of sequencing depth in ChIP-seq experiments. Nucleic Acids Research. 42 (9), (2014).
  4. Becker, P. B., Workman, J. L. Nucleosome remodeling and epigenetics. Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).
  5. Kidder, B. L., Zhao, K. Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells. Methods in Molecular Biology. , 3-20 (2014).
  6. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  7. Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nature Methods. 12 (10), 963-965 (2015).
  8. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34 (36), 11929-11947 (2014).
  9. Hornstein, N., et al. Ligation-free ribosome profiling of cell type-specific translation in the brain. Genome Biology. 17 (1), 149 (2016).
  10. Zhao, Y., Garcia, B. A. Comprehensive catalog of currently documented histone modifications. Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).
  11. Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. Formaldehyde crosslinking: a tool for the study of chromatin complexes. The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved