Biz situ hibridizasyon ve mRNA microinjections içinde için plazmidlerin hediyeler için Monte Westerfield, Makoto Kobayashi ve Jacek Topczewski teşekkür etmek istiyorum. Biz Video görünmesi için Steph Erhard minnettarız. Ayrıca videoda gösterilen konfokal mikroskobu ile William Goossens yardımından dolayı teşekkür etmek istiyoruz. Tyler Schwend videoda kullanılan görüntüler sağlanır ve Rodney Dale video için hazırlık yaptılar. Ayrıca, Zebra balığı ile hayvancılık çalışmaları için CMRC hayvan bakım personelini tanımak. Bu çalışma SCA NIH hibe R21 AA13596 tarafından finanse edildi.

1. Embriyoların Etanol tedavisi <ol><li> Vahşi tip çiftleşmelerin türetilen zebrafish embriyosu 28 yetiştirilen edildi embriyo 5 ml kadar su içinde ° C. (Milli-Q 60 mg / L Instant Ocean ile su). Vahşi tip embriyoların farklı suşları maruz 9 etanol biraz farklı toleranslar var. </li><li> Etanol maruz kalmak kadar 24 saatlik bir nabız, zaman istenilen uzunluğu kubbe kademeli (~ 4.3 saat sonra döllenme, hpf) başlanmıştır. Bu, başlangıç ​​aşamasında gastrulasyon hemen önce memeli embriyolarının, implantasyonu aşamasına eşdeğerdir. Etanol konsantrasyonu 0.2 &#39;den% -2.5%, hacim / hacim aralığı kullanılır. Testler su içinde çözelti 25-50 arasında% gelişen embriyonun 10, 11 kadar biter olduğunu göstermiştir. Embriyolar zaman istenen uzunluğu için 28 ° C&#39;da muhafaza edilmiştir. Etanol maruz kalma süresini istenen sonra, etanol-su çözeltisi çıkarıldı ve yerine düzenli zebrafish su ile yıkama ve üç fo korunurzaman r istenilen uzunluğa. Kusurun spesifisite başlangıç, doz, ve etanol puls uzunluğu zamanına bağlıdır. </li></ol> 2. In situ Hibridizasyon, Antikor ve Kıkırdak Boyanma RNA embriyolar toplanması, <ol><li> QPCR için mRNA toplamak için, yaş uyumlu embriyoların eppendorf tüpleri toplanır. Zebrafish su uzaklaştırıldıktan sonra, TCEP lizis tamponu ile birlikte ilave edilir. Bir motorlu pulvarizatür fiziksel lizis çözelti içinde embriyo ayırmak için kullanılır. Bu, daha sonra herhangi bir ayrışmamış büyük parçalar kaldıran bir preclear sütun içinden geçirilir. Meydana gelen çözelti, lizis proses tarafından yayınlanan her makromoleküller içerir. RNA sonra yıkama ve DNAz tedavisi takiben, bir kolon üzerinde, bu çözüm çalıştırarak ekstrakte edilir. Elüsyon, daha sonra su ya da imalatçı (5&#39;-Prime) tarafından sağlanan bir elüsyon çözeltisi kullanılarak gerçekleştirilir. RNA mikro qPCR için standart teknikler kullanılarak cDNA ya dönüştürülür kullanılabilmektedirdizi analizi. </li><li> In situ hibridizasyon ve antikor boyama, 6 ile 24 embriyolarında için hpf 4 ° C&#39;de gece boyunca% 4 paraformaldehit tespit edildi Bu PBS içinde 3 yıkar +% 0.1 Tween (PBT), birbirine yapışmasını embriyo tutmak için takip eder. Embriyolar daha sonra 3 metanol bir dizi transfer edilir: PBT da -20 ° C&#39;de saklanabilir ve bu noktada,% 100 metanol içine yıkayan Bu embriyo situ hibridizasyon veya antikor boyama için kullanılabilir. Bazı antikorlar metanol tedavi sonrasında, bu nedenle bu uyarı dikkate alınır ve spesifik antikor o metanol tedaviden sonra çalışacak olmadığını belirlemek için test gerekir çalışmaz. </li><li> Kıkırdak boyama için, embriyolar 5 veya 6 gün sonra döllenme (dpf) yükseltilmiş gerekir. Bunlar daha sonra 4 &#39;de bir gece 4% paraformaldehit giderilen ° C, PBT 3 yıkama izledi. </li></ol> 3. Değerlendirme Etanol bağlı Gen Değişiklikleri ve Gelişim Sonuçları <ol><li&gt; Gen ekspresyonu seviyesinde değişiklik olduğunu saptamak için, hedef genler hem qPCR tarafından ve in situ hibridizasyon incelenir. qPCR sonra 3 ayrı biyolojik örnekler kullanılarak valide Integrated DNA Technologies (IDT) yazılımı ile tasarlanmış primerler kullanılarak elde edilir. Bir kez primerler onaylanmıştır, qPCR toplanan RNA örnekleri oluşturulan cDNA yapılmaktadır. Her numune üç nüsha halinde çalıştırılır. PCR reaksiyonlar çok renkli algılama sistemi ile Chroma-4 PCR makinesi (BioRad) veya benzer PCR makinede Platinum SYBR Green qPCR Super mix (Invitrogen) çalıştırılır. Sorgulamasının genler ek olarak, bu primerler ile ayarlanmış bir kontrol cDNA ya da RNA hazırlanmasında küçük bir farklılık dengelemek için kullanılır olması kritik bir durumdur. Bizim zebrabalıkları embriyolar için, GAPDH kullanın: 5&#39;GAAGGTGGGAAACTGGTCAT3 &#39;ve 5&#39;TTGCACCACCCTTAATGTGA3&#39;. Analiz edilen genleri daha sonra gen ifadesi bir miktarının nispi 2 üzerine Pfaffl yöntemi varyasyonu kullanılarak hesaplanır GAPDH seviyeleri göre normalize edilir <sup&gt; - Ct, vahşi tip 12, deneysel göreli kat fark olarak veri görüntüleme. Normal hesaplama tüm genlerin Her devir için iki kez DNA çoğaltmak olduğunu varsayar ve böylece, tam sayı &quot;2&quot; üzerinde güç hesapları olarak ifade, referans gen değişimi üzerine deneysel geninde değişim oranı olarak ifade veri Mükemmel bir PCR reaksiyonu görülen döngüsü başına DNA iki katına verim budur. Pfaffl yöntemi tercih PCR primerleri için de geçerlidir verimliliği elde deneyi ile genel &quot;2&quot; yerini alır. Bu PCR reaksiyonlarında fark daha doğru bir yansıma yansıtır. Tam formül şöyledir: <table border="0"><tbody><tr><td> (Deneysel gen Verimlilik) (tedavi edilen numune kontrolü Ct örnek-Ct) </td></tr><tr><td> -------------------------------------------------- ----------------------------------- </td></tr><tr><td> (Referans gen Etkinliği) (Ctkontrol örneği - tedavi örnek Ct) </td></tr></tbody></table></li><li> In situ hibridizasyon için digoxigenin (kaz) etiketli riboprobes ilgi gen bölümlerini içeren plasmidlerden inşa edilir. Yaştaki embriyolar standart koşullarda 13 ile riboprobes maruz kalan ve bir renk reaksiyonu (NBT / BCIP) kullanarak etiketli riboprobes yerini sağlar Alkalin fosfataz birleştiğinde anti-dig antikorları ile tespit edilir. Embriyolar daha sonra bir Leica mikroskop (Şekil 1B-G) kullanılarak görselleştirilebilir. </li><li> Morfojenik gelişimini değerlendirmek için, embriyolar istenilen zamanda toplanır ve mikroskop altında incelenir. Hücre gruplarının şekli için, canlı embriyoları 14 görüntülenmesi işlemidir. Oküler arası mesafe ve vücut uzunluğu için, embriyo PFA giderilmiştir. Her durumda, istenilen bölgenin görüntülerini Adobe Photoshop softwar kullanılarak alınan sabit bir büyütme ve ölçümler bir mikroskop yakalanıre 10,14. </li><li> Larva zebrabalıkları gelişen kıkırdak yapılar üzerinde tedavi etkilerini araştırmak için, Alcian Blue boyaması kullanın. Birkaç saat veya bir gece boyunca% 20 asetik asit (asidi alkolü): Sabit zebrafish larvaları% 80 etanol içinde çözülmüş Alcian mavi çözeltisi ile muamele edilmiştir. Larvalar% 1&#39;lik bir KOH transfer edilmeden önce asidi alkolü birkaç yıkama in destained edilir: pigment hücrelerin daha da temizlenmesi için% 3 hidrojen peroksit çözeltisi. Zebra balığı kıkırdağı yapıları göstermek için eski en az 4 gün olmak gerekir, ve bu iyi 5 veya 6 gün geçmiş balık tanımlanır. </li><li> Canlı embriyo hücre ölümünü Akridin Orange (AO) kullanılarak incelenmiştir. AO canlı hücreler geçirgen hücre değildir, ve apoptoz ve nekroz geçiren olanlar dahil olmak üzere tehlikeye membran ile hücrelerde DNA bağlanır. Yaşayan embriyosu PBS içinde 3 yıkama izledi, 1 saat süreyle PBS içinde 5 mg / ml AO ile inkübe edilir. Embriyolar sonra konfokal mikroskobu kullanılarak görüntülenmiştir edilir. Dijital Z-serler görüntüler kompozit oluşturmak için birleştirilir. </li></ol> 4. Zebra balığı Embriyo kurgulama <ol><li> Etanol maruz azalmıştır genlerinin tanımlanması sonra, eksik geni değiştirmek üzere tasarlanmıştır mRNA enjeksiyon kullanarak bunları değiştirmeye çalışın mümkündür. Kapaklı mRNA üretici talimatlarına (mMessage Makinesi, Applied Biosystems) göre, in vitro transkripsiyon kitleri, RNA polimeraz kullanarak doğrusallaştırılmış DNA plasmidlerden transkripsiyonu. 25-200 arasındaki RNA&#39;nın pg / nl 0.1 M KCl bir çözelti içinde, 1-2 hücre aşaması zebrafish yumurta içine enjekte edilir. Embriyolar sonra (Şekil 5) Yukarıda tarif edildiği gibi etanol ile muamele edilmeden önce kurtarmak için izin verilir. </li><li> Etanol maruz artarak herhangi bir gen transkript için, onlar &quot;knocked-down&quot; bir antisens morfolino teknolojisi kullanılarak azaltılabilir veya edilebilir. Antisens morpholinos (Amos) şirketi Gen Araçlar tarafından tasarlanan ve protein içine RNA çeviri engelleyebilir veya blo edilirDeneysel ihtiyaca göre RNA ck olgunlaşması ve yapıştırma,. Morpholinos bu işlem hedef geni, bunların mevcut olmadığını anitibodies kullanılarak ölçülebilir bir açık için aktif bir proteini miktarını sınırlamak. RNA bağlama morpholinos etkinliğinin raptedilmektedir ve unspliced ​​transkriptlerin göreceli miktarları tespit etmek için RT-PCR kullanılarak ölçülebilir. Morfolino ile titre doz-bağımlı aktivitesi 15 ile sonuçlanabilir. AMOS Danieau çözeltisi çalışan konsantrasyonları (ng konsantrasyonuna pg titre) (58 mM NaCI, 0.7 mM KCI, 0.4 mM MgSO 4, 0,6 mM Ca (NO 3) 2, 5 mM HEPES, pH 7.6) ile seyreltilir. Enjeksiyon embriyosu yukarıdaki gibi muamele etanol tabi tutulmadan önce geliştirmek için izin verilir, daha sonra 1-2-hücre aşamada yer alır. </li></ol> 5.. Temsilcisi Sonuçlar Ile ilgilidir gelişim ve genetik kusurları bir dizi etanol sonuçlarına zebrafish embriyo maruzfenotipleri diğer omurgalıların bulundu. Biz Notokordun (14 veri gösterilmemiştir) dahil olmak üzere, eksenel dokuların anormal gelişim belgelenmiştir. Etanol tarafından üretilen gelişim gecikmesi görünüşte kısaltılmış ve bazen de bozulur Notokordun (veri gösterilmemiştir 14) götüren, uygun Notokordun uzama bozulmasına yol açar. Bu erken gecikme ve Notokordun defekti büyük olasılıkla tedavi edilmemiş kontrol görüldüğü gibi güçlü zikzak şeklini kaybetmiş Somitlerin içinde daha sonra anormallikler (Şekil 2), kısmen de yol açar, ve görülen fenotipleri karakteristik u şeklindeki Somitlerin yakınız sonik sinyalleşme 14 azalır. Somitlerin açı standart yazılım ve 92.1 ± 4.6 ° den tedavi edilmemiş kontrol 122.6 ile ± 6.6 ° etanol tedavi edilen embriyolar (p &lt;0,001) açısı arttığında kullanılarak ölçülebilir. Downstrea olabilir etanol maruz bir başka sonucuErken gelişme geriliği ve daha sonra Notokordun kusurları m embriyo kısaltılmış uzunluğu (Şekil 3). Hatta embriyo dikkate etanol maruz tarafından üretilen eğrilik almak, ölçme, etanol pozlama (3E 14 Şekil) embriyo maruz kaldı etanol dozu bağlıdır kısaltılmış bir gövde yol açar. Bu bulgu zebrabalıkları modeli insan doğum defekti anlayış ilgili olduğunu düşündüren, geliştirme 16, 17 sırasında etanol maruz kalan çocuklarda bulundu prepubertal boy kısalığı ve kalıcılığı benzer. FEF klasik özelliklerinden biri düşük çeneli, küçük göz açma ve pürüzsüz bir filtrum dahil olmak üzere klasik bir fasiyesi vardır. Kadar bu özelliklerin orta hat dokular bir azalma ile ilgilidir. Ciddi etanol maruziyet synopthalmia ve siklops dahil olmak üzere daha belirgin fenotipleri, neden olduğu hayvan modellerinde gösterilmiştir. Zaman expoetanol artan dozlarda zebrabalıkları embriyolar şarkı, göz içi mesafe (IOD) insan doğum kusuru niteliği ile tutarlı (Şekil 4) doza bağımlı olarak azalır. Siklops sadece çok yüksek dozlarda bulunur, ancak düşük dozlarda bu hayvan modelinde, orta hat yüz gelişimi 10 benzer bir kusuru var düşündüren, IOD (Şekil 4) önemli bir azalma ve üretim yok. Etanol maruz tarafından üretilen vücut ve yüz hem de kusurları altında yatan mekanizma anlamak için, biz gelişimin erken döneminde ortaya çıkar ve bu makul sonraki gelişim kusurları katkıda beklenebilir gen ekspresyon değişiklikleri düzen kurmaktı. Biz iki şekilde bunu, embriyolardan mRNA çıkarma denetimleri (Şekil 1A) ile karşılaştırıldığında etanol tedavi embriyolarda gen ekspresyonu düzeylerinin kantitatif bir değerlendirme sağlar. Buna ek olarak, in situ olarak gerçekleştirebilirhibridizasyon bakılmaksızın sinyal (Şekil 1B-G 18) azalmış olup olmadığını, genlerin şekline bakmak. Bu örnekte, ifade olan etanol maruz kaldıktan sonra azalır iki gen, gli1 ve six3b gösterilmiştir. Biz six3b için yerinde desen incelendiğinde, biz etanol maruz kalan embriyolar bu genin ifade mekansal ölçüde (Şekil 1 EG) bir azalma buldunuz. Benzer bir azalma gen gsc (Şekil BD) tespit edildi. Six3b ve gsc Hem kraniyofasiyal orta hatta dokulara katkıda bulunmak için mukadder dokularda ifade edilir. Yani 8 hpf azından bu genlerin redüksiyon daha sonra Şekil 4&#39;de gösterildiği bulundu IOD azalma ile tutarlıdır. Etanol etkilenen genler belirlendikten sonra, bunların ifade artırılabilir veya azaltılabilir hangi mekanizmalar vardır. Bu, özellikle de example, biz qPCR azalmıştır 2 genleri (gli1 ve six3b) göstermiştir. Biz bu gen değişiklikleri geri sonuçları artırabilir olmadığını belirlemek için mRNA enjekte etmek için seçti. Bu deneme için, yerine gli1 enjekte biz şşş, gli1 düzeylerini artırır bir ligand enjekte seçti. Six3b için, six3b kendisine enjekte başardık. Biz six3b (veriler gösterilmemiştir) enjekte fakat temelde ilave şşş enjeksiyonları (Şekil 5) Zebra balığı embriyolarının brüt kusurları kurtarmak için başardık hiçbir değişiklik bulundu. <img alt="Şekil 1" src="/files/ftp_upload/3704/3704fig1.jpg" /> Şekil 1. Etanol maruz kalma erken desen ve seçilen gelişimsel genlerin gen ekspresyon düzeyleri değişir. 8hpf az embriyo A) qPCR sonuçları. Iki gen için sonuçlar yayınlanmaktadır: six3b ve gli1. Sonuçlar, üç ayrı deney ortalaması olarak gösterilmiştirve gösterilen etanol dozda% 2.5 &#39;tir. Her iki genin kontrolü (t-testi, p &lt;0.05) anlamlı bir şekilde azalmaktadır. 8 hpf Zebra balığı embriyolarının in situ hibridizasyon yılında BG). Gsc ve six3b desenleri Hem kontrollere göre bu zaman noktasında değiştirilir. (Loucks ve ark. 2007&#39;den itibaren izniyle Modifiye). <img alt="Şekil 2" src="/files/ftp_upload/3704/3704fig2.jpg" /> Şekil 2. Hücre gruplarının gelişimi ile tedavi edilen embriyoların değiştirilir. Hücre gruplarının yapısı ve açıları 48 hpf muayene edilir. Kontrolü embriyolar (A), Somitlerin bir zikzak şekli ve keskin bir açı var. Etanol maruz zebrafish daha I-ya da U-şekilli hücre grubu, ve daha az keskin açılan sahiptir. (Loucks ve Ahlgren 2009 izniyle Modifiye). <img alt="Şekil 3" src="/files/ftp_upload/3704/3704fig3.jpg" /> Şekil 3. Etanol tedavisi önemli ölçüde zebrabalıkları vücut uzunluğu azalır.Tedavi edilmeyen ve etanol maruz kalan embriyoların uzunluğu 5 gün postfertilization ölçüldü. Uzunluğunda anlamlı bir azalma (ANOVA, p &lt;0,001) tedavi edilen tüm embriyoların görüldü. BD. Daha büyük bir azalma% 2.0 ve% 2.5 etanol ile dozlanmış embriyo görüldü ise% 1.0 ve% 1.5 etanol ile tedavi edilen embriyoların toplam uzunluğu hafif fakat anlamlı bir azalma vardı. Her kavrama büyüklük farklılıkları kontrol etmek E., her bir deney için kontrol embriyoların 100 normalize ve kardeş tedavi edilen embriyoların 100 bir yüzdesi olarak ifade edildi. (Loucks ve Ahlgren 2009 izniyle Modifiye). <img alt="Şekil 4" src="/files/ftp_upload/3704/3704fig4.jpg" /> Şekil 4. Zebra balığı embriyolarının içi mesafe (IOD) bir azalmaya Etanol pozlama sonuçları. A) embriyoların frontal kez normal ve erimiş göz fenotipleri göstermektedir. B) etanol farklı olarak doz gastrulasyon res içinde 3 saat için uygulananBalık 24 saat sonra incelendiğinde in ults IOD azalmıştır. Sigortalı gözleri ve siklops sadece (% 2.4) test edilen en yüksek dozda görülür. * Kontroller ile karşılaştırıldığında IOD önemli bir azalma gösterir. (Ahlgren, 2004 izni ile değiştirilmiş). <img alt="Şekil 5," src="/files/ftp_upload/3704/3704fig5.jpg" /> Şekil 5. Sus-N mRNA enjeksiyon zebrabalıkları etanol maruz tarafından üretilen brüt kusurları kurtarır. Bir-iki hücreli embriyo 100 pg / nl şşş-N mRNA ve enjekte edilen embriyoların yarısı 4,3-24 hpf gelen standart etanol dozlarda maruz kalan enjekte edildi. Embriyolar 5 dpf&#39;e analiz edildi. % 2.0 etanol ile tedavi edilen embriyolar dorsale kısa kuyrukları, ben şekilli Somitlerin ve siklops gibi göz kusurları eğri sergilemektedir. Bu fenotip kurtuluşu, enjekte embriyosu (% 93) 71/76 görülmektedir. Bu embriyolar, vücut düz, Somitlerin baklava biçimindeki vardır, ve gözleri tamamen ayrılır.

<ol>
	<li>Streissguth, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+syndrome+in+adolescents+and+adults.">Fetal alcohol syndrome in adolescents and adults.</a> Jama. 265 (15), 1961-1967 (1991).</li><li>Floyd, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Observations+from+the+CDC.+Preventing+alcohol-exposed+pregnancies+among+women+of+childbearing+age:+the+necessity+of+a+preconceptional+approach.">Observations from the CDC. Preventing alcohol-exposed pregnancies among women of childbearing age: the necessity of a preconceptional approach.</a> J. Womens Health Gend. Based Med. 8 (6), 733-736 (1999).</li><li>Ali, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+analysis+of+acute+ethanol+exposure+in+zebrafish+development:+a+critical+time+window+and+resilience.">Large-scale analysis of acute ethanol exposure in zebrafish development: a critical time window and resilience.</a> PLoS One. 6 (5), e20037-e20037 (2011).</li><li>Dlugos, C. A., Rabin, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+functional+effects+of+developmental+exposure+to+ethanol+on+the+zebrafish+heart.">Structural and functional effects of developmental exposure to ethanol on the zebrafish heart.</a> Alcohol Clin. Exp. Res. 34 (6), 1013-1021 (2010).</li><li>Fernandes, Y., Gerlai, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+behavioral+changes+in+response+to+early+developmental+exposure+to+ethanol+in+zebrafish.">Long-term behavioral changes in response to early developmental exposure to ethanol in zebrafish.</a> Alcohol Clin. Exp. Res. 33 (4), 601-609 (2009).</li><li>Bilotta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+embryonic+exposure+to+ethanol+on+zebrafish+visual+function.">Effects of embryonic exposure to ethanol on zebrafish visual function.</a> Neurotoxicol. Teratol. 24 (6), 759-766 (2002).</li><li>Tanguay, R. L., Reimers, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+ethanol+developmental+toxicity+in+zebrafish.">Analysis of ethanol developmental toxicity in zebrafish.</a> Methods Mol. Biol. 447, 63-74 (2008).</li><li>Blader, P., Strahle, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol+impairs+migration+of+the+prechordal+plate+in+the+zebrafish+embryo.">Ethanol impairs migration of the prechordal plate in the zebrafish embryo.</a> Dev. Biol. 201 (2), 185-201 (1998).</li><li>Loucks, E., Carvan, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3rd,+Strain-dependent+effects+of+developmental+ethanol+exposure+in+zebrafish.">3rd, Strain-dependent effects of developmental ethanol exposure in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 745-755 (2004).</li><li>Ahlgren, S. C., Preedy, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Mechanisms+of+Fetal+Alcohol+Syndrome:+Shh-signaling.">Molecular Mechanisms of Fetal Alcohol Syndrome: Shh-signaling.</a> Comprehensive Handbook of Alcohol Related Pathology. , (2004).</li><li>Reimers, M. J., Flockton, A. R., Tanguay, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ethanol-+and+acetaldehyde-mediated+developmental+toxicity+in+zebrafish.">Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish.</a> Neurotoxicol. Teratol. 26 (6), 769-781 (2004).</li><li>Pfaffl, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+mathematical+model+for+relative+quantification+in+real-time+RT-PCR.">A new mathematical model for relative quantification in real-time RT-PCR.</a> Nucleic Acids Res. 29 (9), 45-45 (2001).</li><li>Jowett, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Tissue in situ hybridization: methods in animal development. , 128-128 (1997).</li><li>Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+the+role+of+Shh+signaling+in+axial+defects+produced+by+ethanol+exposure.">Deciphering the role of Shh signaling in axial defects produced by ethanol exposure.</a> Birth Defects Res. A. Clin. Mol. Teratol. 86, 556-567 (2009).</li><li>Schwend, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+of+Npc1+and+availability+of+cholesterol+for+early+embryonic+cell+movements+in+zebrafish.">Requirement of Npc1 and availability of cholesterol for early embryonic cell movements in zebrafish.</a> J. Lipid Res. 52 (7), 1328-1344 (2011).</li><li>Spohr, H. L., Willms, J., Steinhausen, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fetal+alcohol+spectrum+disorders+in+young+adulthood.">Fetal alcohol spectrum disorders in young adulthood.</a> J. Pediatr. 150 (2), 175-179 (2007).</li><li>Strauss, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+the+intrauterine+environment+on+childhood+growth.">Effects of the intrauterine environment on childhood growth.</a> Br. Med. Bull. 53 (1), 81-95 (1997).</li><li>Loucks, E. J., Schwend, T., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+changes+associated+with+teratogen-induced+cyclopia.">Molecular changes associated with teratogen-induced cyclopia.</a> Birth Defects Res. A. Clin. Mol. Teratol. 79 (9), 642-651 (2007).</li><li>Schwend, T., Loucks, E. J., Ahlgren, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+Gli+activity+in+craniofacial+tissues+of+hedgehog-pathway+reporter+transgenic+zebrafish.">Visualization of Gli activity in craniofacial tissues of hedgehog-pathway reporter transgenic zebrafish.</a> PLoS One. 5 (9), 14396-14396 (2011).</li><li>Chrisman, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gestational+ethanol+exposure+disrupts+the+expression+of+FGF8+and+Sonic+hedgehog+during+limb+patterning.">Gestational ethanol exposure disrupts the expression of FGF8 and Sonic hedgehog during limb patterning.</a> Birth Defects Res. A. Clin. Mol. Teratol. 70 (4), 163-171 (2004).</li></ol>

Biz ifşa hiçbir şey yok.

Yöntemleri burada açıklanan ve gösterilen sonuçlar zebrafish gelişim kusurları sorgulamak için nasıl kullanılabileceğini sadece ucu göstermektedir. Çünkü embriyo erişilebilirlik, her kavrama ve sonuçların yüksek tekrarlanabilirlik için bıraktıkları yumurta sayısı yüksek, bu omurgalı teratojenik çalışmalar için idealdir. Balık aynı zamanda belirli bir gen veya faiz 19 yol için görsel bir muhabir olarak kullanmak için floresan moleküller içeren manipüle edilebilir. Etanol çalışmalarda kullanılan dozlar, memeli kan alkol seviyeleri ile karşılaştırıldığında oldukça yüksek görünür. Bununla birlikte, bu düzeyde suda mevcut olanı yansıtmaktadır ve tüm etanol embriyo teslim edilir. Birlikte ele alındığında, açıklanan ve yukarıda ayrıntıları yöntemleri zebrabalıkları embriyoların etanol maruz kalmasıyla ilgili insan doğum kusurları modellenmesi son derece yararlı olduğunu göstermektedir. Dahası, zebrafish bulunan gen ifadesi değişiklikler diğerleri tarafından teyit edilmiştiretanol gelişimsel etkileri omurgalılar arasında korunur düşündüren memeli model sistemler 20, içinde. Yukarıda gösterildiği teknikleri çok çabuk ve kolay potansiyeli teratojenler algılamak ve belirli bir madde teratogenez katkı yatan mekanizmaları belirlemek için başka çevresel veya farmasötik hakaretler ile birlikte kullanılabilir.

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Doku RNA kiti: 5-Başbakan PerfectPure </td><td> Fisher Scientific </td><td> FP2302410 </td></tr><tr><td> Platin SYBR yeşil qPCR SuperMix-UDG </td><td> Invitrogen </td><td> 11733038 </td></tr><tr><td> mMessage mMachine yüksek verim RNA transkripsiyonu kiti capped </td><td> Applied Biosystems </td><td> Sizin plazmide RNA polimeraz bağlıdır </td></tr></tbody></table>

assessing teratogenic changes in a zebrafish model of fetal alcohol exposure

Fetal alkol sendromu (FEF) etanol embriyonik maruz kalma ciddi bir tezahürüdür. Özellikle yüz ve düzensiz ve hasarlı beyin gelişimi nedeniyle zeka geriliği de dahil olmak üzere organlara karakteristik kusurları ile sunuyor. Fetal alkol spektrum bozukluğu (FASD) anne alkol tüketimi nedeniyle meydana doğum kusurları bir süreklilik karşılamak için kullanılan bir terimdir ve Amerika Birleşik Devletleri&#39;nde doğan çocukların yaklaşık% 4&#39;ünde görülür. Doğurganlık çağındaki kadınların% 50 alkol tüketimi, raporlama ve tüm gebeliklerin yarısı plansız olmak, kasıtsız maruz devam eden bir sorun 2&#39;dir. Iyi etanol tarafından üretilen hasar anlamak, artı potansiyel müdahalelerin test etmek ile bir model üretmek için, biz zebrabalıkları embriyo kullanarak gelişimsel etanol maruz kalma bir model geliştirmiştir. Zebra balığı teratojen çalışmanın 3-8 bu tür için idealdir. Her bir çifti daha sonra yetişkin zarar vermeden alınabilir yüzlerce yumurta, bırakırbalık. Zebra balığı embriyo şeffaf ve lekeleri kolayca herhangi bir sayı ile görüntülenebilir. Bu embriyoların Analizi etanol üretilen brüt gelişimsel kusurlar insan doğum defekti ile uyumlu olduğunu süresi ve uygulama şovlarının farklı doz ve zamanlarda etanol maruz kaldıktan sonra. Zebra balığı FEF modelini incelemek ve işlemek için kullanılan temel teknikleri burada nitelendirdi.

Watch this Scientific Journal Video about Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure at JoVE.com

Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

Etanol bağlı gelişimsel hasar moleküler mekanizmalarını anlayabilmek için, biz etanol maruz kalma zebrabalıkları modeli geliştirdik ve etanol maruz kaldıktan sonra meydana gelen fiziksel, hücresel ve genetik değişimler keşfediyoruz<sup&gt; 1</sup&gt;. Daha sonra olası müdahaleleri bulmak ve hızla bu hayvan modelinde, bunları test etmek için arıyorlar.

Fetal Alkol Pozlama bir Zebra balığı Modelinde teratojenik değişiklikler değerlendirilmesi

Fetal alcohol syndrome (FAS) is a severe manifestation of embryonic exposure to ethanol. It presents with characteristic defects to the face and organs, ...

assessing-teratogenic-changes-zebrafish-model-fetal-alcohol

Research

JoVE Journal

Medicine

26.1K Görüntüleme.  Children's Memorial Research Center. Etanol bağlı gelişimsel hasar moleküler mekanizmalarını anlayabilmek için, biz etanol maruz kalma zebrabalıkları modeli geliştirdik ve etanol maruz kaldıktan sonra meydana gelen fiziksel, hücresel ve genetik değişimler keşfediyoruz 1. Daha sonra olası müdahaleleri bulmak ve hızla bu hayvan modelinde, bunları test etmek için arıyorlar.

Video: Assessing Teratogenic Changes in a Zebrafish Model of Fetal Alcohol Exposure

The Polyvinyl Alcohol Sponge Model Implantation

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing studies are most comprehensive when carried out in vivo. There are many in vivo models available to study acute wound healing, including incisional, excisional, dead space, and burns. Dead space models are artificial, porous implants which are used to study tissue formation and the effects of substances on the wound. Some of the commonly used dead space models include polyvinyl alcohol (PVA) sponges, steel wire mesh cylinders, expanded polytetrafluoroethylene (ePTFE) material, and the Cellstick1,2.
Each dead space model has its own limitations based on its material's composition and implantation methods. The steel wire mesh cylinder model has a lag phase of infiltration after implantation and requires a long amount of time before granulation tissue formation begins1. Later stages of wound healing are best analyzed using the ePTFE model1,4. The Cellstick is a cellulose sponge inside a silicon tube model which is typically used for studying human surgery wounds and wound fluid2. The PVA sponge is limited to acute studies because with time it begins to provoke a foreign body response which causes a giant cell reaction in the animal5. Unlike other materials, PVA sponges are easy to insert and remove, made of inert and non-biodegradable materials and yet are soft enough to be sectioned for histological analysis2,5.
In wound healing the PVA sponge is very useful for analyzing granulation tissue formation, collagen deposition, wound fluid composition, and the effects of substances on the healing process1,2,5. In addition to its use in studying a wide array of attributes of wound healing, the PVA sponge has also been used in many other types of studies. It has been utilized to investigate tumor angiogenesis, drug delivery and stem cell survival and engraftment1,2,6,7. With its great alterability, prior extensive use, and reproducible results, the PVA sponge is an ideal model for many studies1,2.
Here, we will describe the preparation, implantation and retrieval of PVA sponge disks (Figure 1) in a mouse model of wound healing.

A useful tool to analyze the effects of drugs, growth factors, and/or manipulated cells in an animal model of wound repair is described. This technique utilizes the properties of a polyvinyl alcohol (PVA) sponge to deliver and contain the desired treatment and also provide a platform to be excised and analyzed.

Polivinil Alkol Sünger Model İmplantasyonu

Wound healing is a complicated, multistep process involving many cell types, growth factors and compounds1-3. Because of this complexity, wound healing ...

Tıp

A Novel Surgical Approach for Intratracheal Administration of Bioactive Agents in a Fetal Mouse Model

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and acquired diseases. Apart from congenital or inherited abnormalities with the requirement for long-term expression of the delivered gene, several non-inherited perinatal conditions, where short-term gene expression or pharmacological intervention is sufficient to achieve therapeutic effects, are considered as potential future indications for this kind of approach. Candidate diseases for the application of short-term prenatal therapy could be the transient neonatal deficiency of surfactant protein B causing neonatal respiratory distress syndrome1,2 or hyperoxic injuries of the neonatal lung3. Candidate diseases for permanent therapeutic correction are Cystic Fibrosis (CF)4, genetic variants of surfactant deficiencies5 and &alpha;1-antitrypsin deficiency6.
Generally, an important advantage of prenatal gene therapy is the ability to start therapeutic intervention early in development, at or even prior to clinical manifestations in the patient, thus preventing irreparable damage to the individual. In addition, fetal organs have an increased cell proliferation rate as compared to adult organs, which could allow a more efficient gene or stem cell transfer into the fetus. Furthermore, in utero gene delivery is performed when the individual's immune system is not completely mature. Therefore, transplantation of heterologous cells or supplementation of a non-functional or absent protein with a correct version should not cause immune sensitization to the cell, vector or transgene product, which has recently been proven to be the case with both cellular and genetic therapies7.
In the present study, we investigated the potential to directly target the fetal trachea in a mouse model. This procedure is in use in larger animal models such as rabbits and sheep8, and even in a clinical setting9, but has to date not been performed before in a mouse model. When studying the potential of fetal gene therapy for genetic diseases such as CF, the mouse model is very useful as a first proof-of-concept because of the wide availability of different transgenic mouse strains, the well documented embryogenesis and fetal development, less stringent ethical regulations, short gestation and the large litter size.
Different access routes have been described to target the fetal rodent lung, including intra-amniotic injection10-12, (ultrasound-guided) intrapulmonary injection13,14 and intravenous administration into the yolk sac vessels15,16 or umbilical vein17. Our novel surgical procedure enables researchers to inject the agent of choice directly into the fetal mouse trachea which allows for a more efficient delivery to the airways than existing techniques18.

We developed a novel surgical approach for intratracheal administration of bioactive agents into the mouse fetus. The delivery route is more efficient in targeting the fetal mouse lungs than the commonly used intra-amniotic injection. This procedure has to date not been described in a mouse model.

Bir Fetal Fare Modelinde Biyoaktif Ajan intratrakeal Yönetimi İçin Yeni Bir Cerrahi Yaklaşım

Prenatal pulmonary delivery of cells, genes or pharmacologic agents could provide the basis for new therapeutic strategies for a variety of genetic and ...

Screening for Melanoma Modifiers using a Zebrafish Autochthonous Tumor Model

Genomic studies of human cancers have yielded a wealth of information about genes that are altered in tumors1,2,3. A challenge arising from these studies is that many genes are altered, and it can be difficult to distinguish genetic alterations that drove tumorigenesis from that those arose incidentally during transformation. To draw this distinction it is beneficial to have an assay that can quantitatively measure the effect of an altered gene on tumor initiation and other processes that enable tumors to persist and disseminate. Here we present a rapid means to screen large numbers of candidate melanoma modifiers in zebrafish using an autochthonous tumor model4 that encompasses steps required for melanoma initiation and maintenance. A key reagent in this assay is the miniCoopR vector, which couples a wild-type copy of the mitfa melanocyte specification factor to a Gateway recombination cassette into which candidate melanoma genes can be recombined5. The miniCoopR vector has a mitfa rescuing minigene which contains the promoter, open reading frame and 3'-untranslated region of the wild-type mitfa gene. It allows us to make constructs using full-length open reading frames of candidate melanoma modifiers. These individual clones can then be injected into single cell Tg(mitfa:BRAFV600E);p53(lf);mitfa(lf)zebrafish embryos. The miniCoopR vector gets integrated by Tol2-mediated transgenesis6 and rescues melanocytes. Because they are physically coupled to the mitfa rescuing minigene, candidate genes are expressed in rescued melanocytes, some of which will transform and develop into tumors. The effect of a candidate gene on melanoma initiation and melanoma cell properties can be measured using melanoma-free survival curves, invasion assays, antibody staining and transplantation assays.

A rapid way to screen for melanoma modifiers using a zebrafish autochthonous tumor model is presented. It takes advantage of the miniCoopR vector which allows for expression of candidate melanoma genes in melanocytes. A method to obtain melanoma-free survival curves, an invasion assay, a protocol for antibody staining of scale melanocytes and a melanoma transplantation assay are described.

Bir Zebra balığı Otokton Tümör Modeli kullanılarak Melanom Değiştiricileri için Tarama

Genomic studies of  human cancers have yielded a wealth of information about genes that are altered  in tumors1,2,3. A challenge arising from these ...

Fetal Echocardiography and Pulsed-wave Doppler Ultrasound in a Rabbit Model of Intrauterine Growth Restriction

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ultrasound and fetal echocardiography. Increasingly, these imaging modalities are being employed clinically to examine cardiac function and assess wellbeing in utero, thereby guiding timing of birth decisions. Here, we used a rabbit model of IUGR that allows analysis of cardiac function in a clinically relevant way. Using isoflurane induced anesthesia, IUGR is surgically created at gestational age day 25 by performing a laparotomy, exposing the bicornuate uterus and then ligating 40-50% of uteroplacental vessels supplying each gestational sac in a single uterine horn. The other horn in the rabbit bicornuate uterus serves as internal control fetuses. Then, after recovery at gestational age day 30 (full term), the same rabbit undergoes examination of fetal cardiac function. Anesthesia is induced with ketamine and xylazine intramuscularly, then maintained by a continuous intravenous infusion of ketamine and xylazine to minimize iatrogenic effects on fetal cardiac function. A repeat laparotomy is performed to expose each gestational sac and a microultrasound examination (VisualSonics VEVO 2100) of fetal cardiac function is performed. Placental insufficiency is evident by a raised pulsatility index or an absent or reversed end diastolic flow of the umbilical artery Doppler waveform. The ductus venosus and middle cerebral artery Doppler is then examined. Fetal echocardiography is performed by recording B mode, M mode and flow velocity waveforms in lateral and apical views. Offline calculations determine standard M-mode cardiac variables, tricuspid and mitral annular plane systolic excursion, speckle tracking and strain analysis, modified myocardial performance index and vascular flow velocity waveforms of interest. This small animal model of IUGR therefore affords examination of in utero cardiac function that is consistent with current clinical practice and is therefore useful in a translational research setting.

We describe examination of fetal cardiac function with contemporary functional fetal echocardiography and fetoplacental Doppler ultrasound using the VisualSonics VEVO 2100 microultrasound in a surgically induced model of intrauterine fetal growth restriction in a rabbit.

Rahim içi Büyüme Kısıtlama bir Tavşan Modelinde Fetal Ekokardiyografi ve Pulsed-wave Doppler Ultrason

Fetal intrauterine growth restriction (IUGR) results in abnormal cardiac function that is apparent antenatally due to advances in fetoplacental Doppler ...

Assessing Changes in Volatile General Anesthetic Sensitivity of Mice after Local or Systemic Pharmacological Intervention

One desirable endpoint of general anesthesia is the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is less straightforward than it is in human patients. A widely used behavioral surrogate for hypnosis in rodents is the loss of righting reflex (LORR), or the point at which the animal no longer responds to their innate instinct to avoid the vulnerability of dorsal recumbency. We have developed a system to assess LORR in 24 mice simultaneously while carefully controlling for potential confounds, including temperature fluctuations and varying gas flows. These chambers permit reliable assessment of anesthetic sensitivity as measured by latency to return of the righting reflex (RORR) following a fixed anesthetic exposure. Alternatively, using stepwise increases (or decreases) in anesthetic concentration, the chambers also enable determination of a population's sensitivity to induction (or emergence) as measured by EC50 and Hill slope. Finally, the controlled environmental chambers described here can be adapted for a variety of alternative uses, including inhaled delivery of other drugs, toxicology studies, and simultaneous real-time monitoring of vital signs.

Loss of the righting reflex has long served as a standard behavioral surrogate for unconsciousness, also called hypnosis, in laboratory animals. Alterations in volatile anesthetic sensitivity caused by pharmacological interventions can be detected with a carefully controlled high-throughput assessment system, which may be adapted for delivery of any inhaled therapeutic.

Yerel ya da Sistemik Farmakolojik Müdahale sonrası Farelerin Uçucu Genel Anestezik Hassasiyet Değişiklikleri değerlendirilmesi

One desirable endpoint of general anesthesia is  the state of unconsciousness, also known as hypnosis. Defining the hypnotic state in animals is  less ...

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The molecular mechanisms leading to cyst formation in PKD remain somewhat unclear, but many genes are thought to be involved. Wnt5a is a non-canonical glycoprotein that regulates a wide range of developmental processes. Wnt5a works through the planar cell polarity (PCP) pathway that regulates oriented cell division during renal tubular cell elongation. Defects of the PCP pathway have been found to cause kidney cyst formation. Our paper describes a method for developing a zebrafish cystic kidney disease model by knockdown of the wnt5a gene with wnt5a antisense morpholino (MO) oligonucleotides. Tg(wt1b:GFP) transgenic zebrafish were used to visualize kidney structure and kidney cysts following wnt5a knockdown. Two distinct antisense MOs (AUG - and splice-site) were used and both resulted in curly tail down phenotype and cyst formation after wnt5a knockdown. Injection of mouse Wnt5a mRNA, resistant to the MOs due to a difference in primary base pair structure, rescued the abnormal phenotype, demonstrating that the phenotype was not due to &#8220;off-target&#8221; effects of the morpholino. This work supports the validity of using a zebrafish model to study wnt5a function in the kidney.

A Possible Zebrafish Model of Polycystic Kidney Disease: Knockdown of wnt5a Causes Cysts in Zebrafish Kidneys

We describe a method of generating a possible zebrafish model of polycystic kidney disease. We used Tg(wt1b:GFP) fish to visualize kidney structure. Knockdown of wnt5a was by morpholino injection. Pronephric cyst formation after wnt5a knockdown was observed in this GFP transgenic zebrafish.

Polikistik Böbrek Hastalığı Olası Zebra balığı Modeli: demonte<em&gt; Wnt5a</em&gt; Zebra balığı Böbrekler Kistler Nedenler

Polycystic kidney disease (PKD) is one of the most common causes of end-stage kidney disease, a devastating disease for which there is no cure. The ...

A Mouse Fetal Skin Model of Scarless Wound Repair

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs across species but is age dependent. The transition from a scarless to scarring phenotype occurs in the third trimester of pregnancy in humans and around embryonic day 18 (E18) in mice. However, this varies with the size of the wound with larger defects generating a scar at an earlier gestational age. The emergence of lineage tracing and other genetic tools in the mouse has opened promising new avenues for investigation of fetal scarless wound healing. However, given the inherently high rates of morbidity and premature uterine contraction associated with fetal surgery, investigations of fetal scarless wound healing in vivo require a precise and reproducible surgical model. Here we detail a reliable model of fetal scarless wound healing in the dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

During mammalian development, early gestational skin wounds heal without a scar. Here we detail a reliable and reproducible model of fetal scarless wound healing in the cutaneous dorsum of E16.5 (scarless) and E18.5 (scarring) mouse embryos.

Scarless Yara Repair Fare Fetal Cilt Modeli

Early in utero, but not in postnatal life, cutaneous wounds undergo regeneration and heal without formation of a scar. Scarless fetal wound healing occurs ...

Generation of a Chronic Obstructive Pulmonary Disease Model in Mice by Repeated Ozone Exposure

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high incidence in aging populations. The current conventional therapies for COPD focus mainly on symptom-modifying drugs; thus, the development of new therapies is urgently needed. Qualified animal models of COPD could help to characterize the underlying mechanisms and can be used for new drug screening. Current COPD models, such as lipopolysaccharide (LPS) or the porcine pancreatic elastase (PPE)-induced emphysema model, generate COPD-like lesions in the lungs and airways but do not otherwise resemble the pathogenesis of human COPD. A cigarette smoke (CS)-induced model remains one of the most popular because it not only simulates COPD-like lesions in the respiratory system, but it is also based on one of the main hazardous materials that causes COPD in humans. However, the time-consuming and labor-intensive aspects of the CS-induced model dramatically limit its application in new drug screening. In this study, we successfully generated a new COPD model by exposing mice to high levels of ozone. This model demonstrated the following: 1) decreased forced expiratory volume 25, 50, and 75/forced vital capacity (FEV25/FVC, FEV50/FVC, and FEV75/FVC), indicating the deterioration of lung function; 2) enlarged lung alveoli, with lung parenchymal destruction; 3) reduced fatigue time and distance; and 4) increased inflammation. Taken together, these data demonstrate that the ozone exposure (OE) model is a reliable animal model that is similar to humans because ozone overexposure is one of the etiological factors of COPD. Additionally, it only took 6 - 8 weeks, based on our previous work, to create an OE model, whereas it requires 3 - 12 months to induce the cigarette smoke model, indicating that the OE model might be a good choice for COPD research.

This study describes the successful generation of a new chronic obstructive pulmonary disease (COPD) animal model by repeatedly exposing mice to high concentrations of ozone.

Kronik obstrüktif akciğer hastalığı manken tekrarlanan ozon maruz farelerde nesil

Chronic obstructive pulmonary disease (COPD) is characterized by persistent airflow limitation and lung parenchymal destruction. It has a very high ...

Model Surgical Training: Skills Acquisition in Fetoscopic Laser Photocoagulation of Monochorionic Diamniotic Twin Placenta Using Realistic Simulators

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome (TTTS), but is technically challenging and can lead to significant complications. Acquiring and maintaining the necessary surgical skills require consistent practice, a critical caseload, and time. Training on realistic surgical simulators can potentially shorten this steep learning curve and enables several proceduralists to acquire procedure-specific skills simultaneously. Here we describe realistic simulators designed to allow the user familiarity with the equipment and specific steps required in the surgical treatment of TTTS, including fetoscopic handling, approaches to anterior and posterior placenta, recognition of anastomoses, and efficient coagulation of vessels. We describe the skills that are especially important in conducting placental laser coagulation that the surgeon can practice on the model and apply in a clinical case. These models can be adapted easily depending on the availability of materials and require standard fetoscopy equipment. Such training systems are complementary to traditional surgical apprenticeships and can be useful aids for fetal medicine units that provide this clinical service.

Practicing the specific skills required for fetoscopic laser coagulation of monochorionic placental anastomoses on realistic models can aid less experienced surgeons in overcoming the steep learning curve associated with this procedure that is now regarded as the standard of care for twin-twin transfusion syndrome.

Modeli cerrahi eğitim: Fetoscopic Laser Photocoagulation, Monochorionic Diamniotic Tek Kişilik plasenta gerçekçi simülatörleri kullanarak becerileri edinme

Fetoscopic laser coagulation of arterio-venous anastomoses (AVA) in a monochorionic placenta is the standard of care for twin-twin transfusion syndrome ...

A Doxorubicin-induced Cardiomyopathy Model in Adult Zebrafish

The genetically accessible adult zebrafish (Danio rerio) has been increasingly used as a vertebrate model for understanding human diseases such as cardiomyopathy. Because of its convenience and amenability to high throughput genetic manipulations, the generation of acquired cardiomyopathy models, such as the doxorubicin-induced cardiomyopathy (DIC) model in adult zebrafish, is opening the doors to new research avenues, including discovering cardiomyopathy modifiers via forward genetic screening. Different from the embryonic zebrafish DIC model, both initial acute and later chronic phases of cardiomyopathy can be determined in the adult zebrafish DIC model, enabling the study of stage-dependent signaling mechanisms and therapeutic strategies. However, variable results can be obtained with the current model, even in the hands of experienced investigators. To facilitate future implementation of the DIC model, we present a detailed protocol on how to generate this DIC model in adult zebrafish and describe two alternative ways of intraperitoneal (IP) injection. We further discuss options on how to reduce variations to obtain reliable results and provide suggestions on how to appropriately interpret the results.

A method to generate a doxorubicin-induced cardiomyopathy model in adult zebrafish (Danio rerio) is described here. Two alternative ways of intraperitoneal injection are presented and conditions to reduce variations among different experimental groups are discussed.