Biz 116520 DP2 ve ORAU Ralph Powe Acemi Fakültesi Geliştirme Ödülü NIH Yeni Yenilikçisi Ödülü destek kabul ediyorsunuz.

1. Hücre Bakım <ol><li> Medya her gün değiştirmek ile H1 hESC (WiCell), mTeSR1 medya ile hESC nitelikli matrigel kuyucuklar da saklandı. F12: Wells DMEM ile 25 ml hESC matrigel 300 ul ilave edilerek hazırlanır seyreltik matrigel çözeltisi ile kaplandı. Bu matrigel çözeltinin 1 ml altı kuyulu plakanın her oyuğa ilave ya da 400 ul bir 12 kuyulu plakanın her oyuğa ilave edildi ve oda sıcaklığında 1 saat boyunca kat etmesine izin verildi. Hücreler mekanik onlar 1 arasında ve çapı 1.5mm ulaştı kez koloniler kazınarak 1:4 bölünmüş bir oranında pasajlandı. </li><li> RHMVEC (VEC teknolojileri) medya her gün değiştirmek ile MCDB-131 ortamda sürdürüldü. % 80 izdiham 1:3 bölünmüş bir oranına ulaşılmıştır kez Hücreler tripsinizasyon ile ayrıldı. Pasajlar 3 ile 7 arasında endotel hücreleri, bu çalışma için kullanıldı. </li></ol> 2. Stok Çözümler hazırlanması <ol><li> Aktivin A steril P 50 mcg / mL &#39;de yeniden yapıldıBS sığır serum albümini içeren% 0.1. Çözelti -20 ° C&#39;de muhafaza edildi bölünüp </li><li> EGF steril 10 mM asetik asit içerisinde 500 ug / mL &#39;de yeniden çözüldü. Çözelti -20 ° C&#39;de muhafaza edildi bölünüp </li><li> İnsülin suyun 10 ml &#39;ye 0.1 ml glasiye asetik asit ilave edilerek asitleştirildi hazırlanan H2O (pH ≤ 2), ilave edilerek 10 mg / ml&#39; de yeniden çözüldü. </li><li> DAPT 18 mg / ml DMSO içinde yeniden çözüldü. F12, bölünüp -20 ° C&#39;de muhafaza: Bu daha DMEM 300 uM konsantrasyona seyreltildi </li><li> KAAD-Cyclopamine 5mg/ml DMSO içinde yeniden çözüldü. F12, bölünüp -20 ° C&#39;de muhafaza: Bu daha DMEM 2 uM konsantrasyona seyreltildi </li><li> All-trans retinoik asit% 95 etanol içinde 2.7 mg / ml olarak yeniden yapıldı. , F12 bölünüp -80 ° C&#39;de saklanır: Daha da DMEM içinde 2mm konsantrasyona seyreltildi </li></ol> 3. Definitive Endoderm (DE) ve Pankreas Progenitör (PP) İndüksiyon <ol><li> Saat sonraESC koloniler 1 ve çapı 1.5 mm arasında ulaşılır, DE indüksiyon DMEM eklenmesi ile yapıldı: B27 F12,% 0.2 BSA, A ve 4 gün boyunca 1 uM Wortmannin (gün 0-Gün 4) ortam ile 100 ng / ml aktivin ile desteklenmiş her gün değiştirin. </li><li> DE indüksiyonu tamamlandıktan sonra, pankreas progenitör indüksiyon DMEM için ortam değiştirerek oluşturuldu: F12 24 saat için 0.2 mM konsantrasyonda (Gün 4 Gün 5) B27,% 0.2 BSA ve KAAD-Cyclopamine ile desteklenmiş. </li><li> 24 saat sonra medya DMEM şekilde değiştirildi: F12 ile desteklenmiş B27,% 0,2 BSA, medya her gün değiştirmek ile 3 gün için 0.2 mM konsantrasyon ve 2 mM konsantrasyonda all-trans retinoik asit (Gün 5 Gün 8) KAAD-Cyclopamine . </li></ol> 4. Pankreas Olgunlaşma <ol><li> PP indüksiyonundan sonra, tüm gruplar DMEM oluşan olgunlaşma medyaya değiştirildi: F12 2 gün süresince B27,% 0,2 BSA, 10 mM Nikotinamid, 25 mcg / ml insülin, 30 nM Na 2 SeO 3 ve 50 mg / ml transferrin ile desteklendimedya ile ays (Gün 8 Gün 10) her gün değiştirin. </li><li> Olgunlaşması ortam içinde 2 gün sonra, son olgunlaşması adım paralel bir karşılaştırma için, birkaç farklı koşullar kullanılarak gerçekleştirilir. (I) kontrol olarak endotelial hücreleri olmaksızın, sadece eş-kültür ortamı kullanılarak ve (iii) RHMVEC hücrelerle temas co-kültürü ile çentik inhibitörü DAPT (ii) kullanılarak: farklılaşma aşağıdaki koşullar altında endüklenmiştir. Hücreler medya her gün değiştirin ile (Gün 10 Gün 17) bir hafta boyunca DAPT ya da ko-kültür ortamı da sağlandı. <ol><li> DAPT ortam 30 uM DAPT ile olgunlaşması ortam ilave kullanılarak hazırlandı. Bu grup hücreler 6 gün (Gün 11 Gün 17) için ilk 24 saat MCDB131 tamamlamak maruz kalan ve daha sonra DAPT medya maruz bırakıldı. </li><li> Co-kültür ortamı ile MCDB-131 ortam ilave hazırlandı B27,% 0.2 BSA, 10 mM Nikotinamid, 10 ng / ml EGF, 1 ug / ml hidrokortizon, 10 mg EndoGro, 90 ug / ml heparin. Medya kontrol koşulu için ayırt hücreleri maruz bırakıldımedya 6 gün (Gün 11 Gün 17) (hayır endotel hücreleri) için ko-kültür ortamı olarak değiştirildi sonra 24 saat boyunca MCDB-131 tam orta (Gün 10 Gün 11). </li><li> Kontakt co-kültürü durum için, bir milyon RHMVEC bağlanma izin vermek için 24 saat için tam MCDB-131 ortam içinde ayırt hücreleri (VEC teknolojiler) (Günlük 10 Günlük 11) ilave edildi. 24 saat medya medya ile 6 gün (Gün 11 Gün 17) için ko-kültür medya çevrildikten sonra her gün değiştirin. </li></ol></li></ol> 5.. QRT-PCR analizi <ol><li> Farklılaşma her aşamasında (; pankreas progenitör; endoderm olgun adacık) sonunda eridi edildi ve RNA üreticinin talimatlarına göre NucleoSpin II RNA ekstraksiyon kiti kullanılarak ekstrakte edildi. </li><li> RNA kalitesi SmartSpec Plus, spektrofotometre kullanılarak RNA ölçümü takiben, 260 nm ve 280 nm RNA absorbans kontrol ederek analiz edildi. </li><li> Ters transkripsiyon ImProm II ters transkripsiyon k kullanılarak gerçekleştirildiBu üreticinin talimatlarına göre. Bütün reaksiyonlar RNA 100 ng ile yapıldı. </li><li> QRT-PCR üreticinin talimatlarına göre Mx3005P qPCR sistemi (Agilent) ve Brilliant II SYBR Green qPCR ana karışımı kullanılarak gerçekleştirildi. Kullanılan primerler Tablo 1&#39;de verilmiştir. Başlatma adım 50 gerçekleştirildi 10 dakika boyunca 95 ° C&#39;de, ardından 2 dakika süreyle ° C. 50 amplifikasyon döngüsü şu şekilde yapıldı: 95 ° C de 30 saniye, 54 ° ve 30 saniye 1 dakika boyunca 72 ° C&#39;de. </li><li> Andiferansiye hücreleri üzerinde hedef mRNA ekspresyonu kat değişimi aşağıdaki formül kullanılarak CT değerleri hesaplandı: ΔCT (Marker i) = CT (Marker i) - CT (GAPDH) Δ ΔCT (Marker i) = ΔCT (Marker i) (Örnek) - ΔCT (Marker i) (Farklılaşmamış hücreleri) Bağıl ifade (Marker i) = 2-ΔΔCT(Işaretleyici i) </li></ol> 6. İmmünositokimya <ol><li> Farklılaşma her aşamasında (; pankreas progenitör; endoderm olgun adacık) sonunda hücreler oda sıcaklığında 15 dakika boyunca% 4 formaldehit tespit edildi. </li><li> Sabit hücreleri Triton X-100 (TX) 15 dakika boyunca% 0.25 ile permeabilize edildi. </li><li> Spesifik olmayan boyama 30 dakika boyunca TX% 0.05 &#39;in% 10 eşek serum inkübasyonu ile bloke edildi. </li><li> Primer antikor inkübasyon 4 &#39;de bir gece gerçekleştirildi tavsiye edilen seyreltme antikoru (bakınız Tablo 1) de tampon engelleme ° C. </li><li> Hücreler 5 dakika boyunca% 0.05 TX üç kez yıkandı. </li><li> Sekonder antikor inkübasyon tampon bloke edici ile sulandırılmış uygun bir antikor ile birlikte karanlık oda sıcaklığında bir saat süreyle gerçekleştirildi. </li><li> Hücreler 5 dakika boyunca% 0.05 TX üç kez yıkandı. </li><li> Nükleer boyanma PBS içinde 1:1000 dilusyonda leke Hoescht ile inkübasyon yapıldıPBS ile 3 yıkama izledi 5 dakika için. </li><li> Sabit ve boyanan hücrelerin Olympus IX81 inverted mikroskop ve Metamorph görüntüleme yazılımı kullanılarak görüntülendi. </li></ol> 7. Temsilcisi Sonuçlar DE belirteçler Sox17, CXCR4 ve Foxa2 için QRT-PCR analizi ile teyit ve Şekil 2 &#39;de gösterildiği gibi Sox17 için İmmünoboyama olarak aktivin ilavesiyle A ve 4 gün boyunca andiferansiye hESC üzere Wortmannin kesin endoderm indüklemektedir. Cyclopamine ve retinoik asit ilave edildikten sonra pankreas progenitör hücrelerine farklılaşmasını pankreas progenitör belirteçler, Şekil 3 &#39;de gösterildiği gibi Pdx1 için İmmünoboyama QRT-PCR ile teyit edilmiştir. Farklılaşma son aşamada, güçlü hESC edilen pankreas progenitör hücrelerin insülin ifade upregülasyonu indüklenen RHMVEC hücreleri ile ko-kültür başvurun. Co-kültürü aracılı farklılaşma verim co ile analiz edildiDAPT kullanarak kontrol koşulu ile mparing. O anda pankreas olgunlaşması elde etmek için en yaygın olarak kullanılan yöntemlerin biri olduğu DAPT, bir pozitif kontrol olarak kullanılmıştır. Co-endotel hücreleri kültürünün destekleyici faktörleri ile desteklenmiş değiştirilmiş bir ortam içinde gerçekleştirildi beri, ek kontrol farklılaşması üzerinde ortam etkisinin doğrulanması için endotel hücrelerinin yokluğunda ortam ile gerçekleştirildi. Bu analizin ayrıntıları Şekil 4 &#39;de verilmiştir. <img alt="Şekil 1.." src="/files/ftp_upload/3759/3759fig1.jpg" /> Şekil 1. Insülin salgılayan hücre içine hESC ayrımında Çok aşamalı protokolü. <img alt="Şekil 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> Şekil 2. Insan embriyonik kök hücrelerin Definitive endoderm indüksiyon. A ve Wortmannin 4 gün boyunca aktivin maruz hESC hücrelerinde temsil DE belirteçlerinin A) QRT-PCR analizi. Sonuçlar ar<html> e farklılaşmamış hESC göre normalize. B) Sox17 boyama (Yeşil) ve DAPI (mavi) Sox17 nükleer ifade göstermektedir. Ölçek çubuğu: 50 mikron. <img alt="Şekil 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Endoderm hücreleri elde edilen embriyonik kök hücre Şekil 3. Pankreas progenitör indüksiyon. DE indüksiyon sonrası 4 gün cyclopamine ve retinoik asit maruz hESC türetilmiş endoderm hücreleri erken pankreas belirteçlerin A) QRT-PCR analizi. Sonuçlar farklılaşmamış hESC göre normalize. B) Pdx1 boyama (mor) ve DAPI (mavi) Pdx1 nükleer ifade göstermektedir. Ölçek çubuğu: 50 mikron. &quot;&gt; <img alt="Şekil 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Şekil 4. Pankreas olgunlaşma evresi A) QRT-PCR hESC pankreatik hormon analizi DAPT kullanarak pankreas olgunlaşma sonrasında, ortak kültür ve ortak kültür ortamı (kontrol) başvurun. Sonuçlar farklılaşmamış hESC göre normalize. p öğrenci t-testi ile elde edilen değerler. Dil-Ac-LDL etiketli RHMVEC (Kırmızı) ile B) Co-kültür boş alanlar (üst) varsa EC plaka takmak bölgeleri göstermek, diğer RHMVEC ayırt ESC (alt) ile doğrudan temas halinde bulunabilir. Ko-kültür yöntemi ile farklılaşmış hücreler için C) C-peptid (Yeşil) boyama. Ölçek çubuğu: 12.5 mikron (Üst) ve 50 mikron (Alt) D) RHMVEC ve İmmun Boyamanın RHMVEC hiç insülin ifade gösterir. <table border="1"><tbody><tr><td> Işaretleyici </td><td> Primer1 (5 &#39;den 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;den 3&#39;) </td><td> Ref </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> Glukagon </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> İNSÜLİN </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Tablo 1. Primerler qPCR reaksiyonlar için kullanılır.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

Biz ifşa hiçbir şey yok.

Pankreas gelişimi sırasında, ayırt pankreas hücreleri aortadan endotel hücreleri ile birbirine yakın olduğu, ayrıca, pankreas adacık kan şekeri ve adacık hormonların hızlı değişimi teşvik etmek yoğun vaskülarize vardır. Bu gerçekler göz önüne alındığında, endotel hücreleri pankreas organogenez sürecinde önemli bir rol oynaması şaşırtıcı değil. Pankreas geliştirme sırasında endotel hücreleri önemi giderek takdir edilirken, embriyonik hücreler in vitro ayrımında rol?...

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td><td> Konsantrasyonları </td></tr><tr><td> mTeSR1 (ek ile) </td><td> Kök Hücre Teknolojileri </td><td> 5850 </td><td></td></tr><tr><td> hESC nitelikli matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (Tamamlandı) </td><td> VEC Teknolojileri </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Supplement </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Bir aktivin </td><td> Ar-Ge </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1 mikrona </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> All-trans retinoik asit </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30μM </td></tr><tr><td> Nikotinamid </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Sodyum selenit </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Ensülin </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 ug / ml </td></tr><tr><td> Transferrin </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 mcg / ml </td></tr><tr><td> EGF </td><td> Ar-Ge </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10 ng </td></tr><tr><td> EndoGro </td><td> VEC Teknolojileri </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> Heparin </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> Hidrokortizon </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm II ters transkripsiyon Sistemi </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> Brilliant II SYBR Green qPCR master miks </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 keçi poliklonal IgG </td><td> Santa Cruz </td><td> sc-17.355 </td><td> 1/500 </td></tr><tr><td> PDX1 keçi poliklonal IgG </td><td> Santa Cruz </td><td> sc-14662 </td><td> 1/500 </td></tr><tr><td> Poliklonal C-Peptid Tavşan </td><td> Hücre Sinyali </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 eşek anti-tavşan IgG </td><td> Invitrogen </td><td> A-21206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 eşek anti-keçi IgG </td><td> Invitrogen </td><td> A-21447 </td><td> 1/1000 </td></tr></tbody></table> Tablo 2. Reaktifler ve Setleri.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Embriyonik kök hücreler (ESC) iki ana özellikleri: onlar sonsuza kadar böylece birden fazla soy içine ayırt etmek için potansiyeli olan, farklılaşmadan in vitro koşullarda yayılır ve pluripotenttir olabilir. Bu özellikleri hücre temelli tedavi ve rejeneratif tedavi uygulamaları 1 için EKH son derece cazip kılmaktadır. Ancak gerçekleştireceği tam potansiyelini için hücreleri zor bir görev olduğunu olgun ve işlevsel fenotipleri, ayrılabilir gerekir. Hücresel farklılaşmadan indükleyecek şekilde umut verici bir yaklaşım yakından in vitro ortamda organogenezisin yolu taklit etmektir. Pankreas gelişimi karaciğer ve pankreas gibi çeşitli organlar, dönüşebilir endoderm ile başlayan, belli aşamalarına 2 oluştuğu bilinmektedir. Endoderm indüksiyon çeşitli büyüme faktörleri 4-7 ile kombinasyon halinde bir 3 aktivin ilavesi yoluyla nodal yolunun modülasyonu ile elde edilebilir </&gt; sup. Kesin endoderm hücreleri daha sonra cyclopamine 8 ilavesi ile in vitro olarak elde edilebilir sonik kirpi inhibisyonu, inhibe ederek pankreas kararlılığını geçirilir. Pankreas olgunlaşma çentik sinyal inhibisyonu gibi çeşitli paralel etkinlikler aracılığıyla olur; pankreas progenitörlerin agregasyon 3 boyutlu kümeler halinde; vaskülarizasyonu indüksiyon; birkaç isim. En başarılı ESC türetilmiş pankreas progenitör hücrelerin in vitro maturasyonu By DAPT takviyesi 9 ile sinyalizasyon çentik inhibisyonu yoluyla elde edilmiştir. Başarılı olsa da, sınırlı işlevsellik ile olgun fenotip düşük verim elde edilmektedir. Daha az çalışma alanı giderek in-vivo pankreas adacık olgunlaşma 10,11 önemli bir faktör olarak takdir ediliyor pankreas olgunlaşmasında sinyal endotel hücre, etkisidir. Çalışmada endotel tür etkilerini araştıranial adacık hücresi benzeri hücreler üreten insülin içine insan ESC türetilmiş pankreas progenitör hücrelerinin olgunlaşmasında sinyalizasyon. Biz insan EKH ilk PI3K yolun inhibisyonu ile birlikte bir aktivin tarafından endoderm doğru indüklenirler çok aşamalı yönettiği farklılaşma protokolü sunduk. Endoderm hücrelerinin pankreas spesifikasyonu retinoik asidin eklenmesiyle retinoid indüksiyon ile birlikte Cyclopamine tarafından sonik kirpi sinyalleşme inhibisyonu ile elde edilir. Olgunlaşmanın son aşamasında bir ko-kültür yapılandırma elde endotel hücre sinyal sayesinde meydana gelir. Birkaç endotel hücreleri ko-kültür olarak test edilirken, burada öncelikle analiz kolaylığı için, sıçan kalp mikrovasküler endotel hücreleri (RHMVEC) ile verileri sunmak.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Çalışmada insan embriyonik kök hücreleri pankreas farklılaşma uyarması yönlendirilmiş bir farklılaşma yaklaşım anlatılmaktadır. Büyük önem insülin salgılayan hücrelerin içine pankreas ataları edilen insan embriyonik kök hücre bulma olduğu endotel hücre ko-kültür aracılık olgunlasmasi.

İnsan Embriyonik endotel hücre Co-kültür aracılık Olgunlaşma Bir Yönetmen Farklılaşma Yaklaşım Pankreas insülin üreten hücreler için Kök Hücre

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K Görüntüleme.  University of Pittsburgh. Çalışmada insan embriyonik kök hücreleri pankreas farklılaşma uyarması yönlendirilmiş bir farklılaşma yaklaşım anlatılmaktadır. Büyük önem insülin salgılayan hücrelerin içine pankreas ataları edilen insan embriyonik kök hücre bulma olduğu endotel hücre ko-kültür aracılık olgunlasmasi.

Video: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Murin Embriyonik Kök Hücre Hematopoetik Kök Hücre türetilmesi

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Biyoloji

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery İnsan Embriyonik Kök Hücreleri türetilmesi

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Embriyonik Kök Hücre Tedavi Hindlimb İskemi Türetilmiş Endotel Hücreleri

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

İzolasyon ve Büyük Ölçekli Genişleme Yetişkin İnsan Endotel Koloni Oluşturan Progenitör Hücreler

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

İnsan Göbek kordonu İzolasyon ve Hayvan Serum Genişleme Mezenkimal stromal hücreler (MKH) ve endotel Koloni Oluşturan Progenitör Hücreler (ECFCs) Türetilmiş

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Video Biyoinformatik İnsan Embriyonik Kök Hücre Colony Büyüme Analizi

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Embriyonik Kök Hücreler farklılaşma oligodendrosit Öncüleri

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Teratom Oluşumu İnsan Embriyonik Kök Hücre Kader Haritalama

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Küçük Molekül İndüksiyon Pluripotent İnsan Embriyonik Kök Hücreleri İnsan Kardiyak Öncüleri ve kardiyomiyositlerde Verimli türetilmesi

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

GFP Retroviral Vector kullanarak İsteyerek Pluripotent Kök Hücrelerinin (iPSCs) içine İnsan somatik hücreleri yeniden programlama

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...