Biz eleştirel yazının okunması için James Waters, Gable Wadsworth&#39;u ve Bo Broadwater teşekkür ederim. Biz de yararlı yorumlar sağlamak için dört anonim yorumcular teşekkür ederim. Biz Georgia Teknoloji Enstitüsü, Bilimsel Arakesitte Burroughs Wellcome Fonu Kariyer Ödülü ve Yaşam Sistemleri NSF Fizik gelen öğrenci araştırma ağı hibe mali destek kabul.

1. DsDNA Numune Hazırlama <ol><li> 10-mer dizisini tekrarlayarak küresel kavisli DNA&#39;lar tasarlayın. Örneğin, 5&#39;-GTGCCAGCAACAGATAGC - (TTTATCATCCTTTATCATCC X) 7 - TTTCATTCGAGCTCGTTGTTG-3 &#39;, bir 186-bp X kavisli rastgele bir ilave baz DNA ve tekrar 10-mer dizisini kuşatan sekans adaptör dizileri olmasıdır. Not:. Bu örnekte Kaplan ve arkadaşları tarafından, büyük ölçekli nükleozom doluluk çalışmaya dayanarak nükleozom oluşumuna karşı tercihler iki 10-mer 15 seçilmiştir. DsDNA sarmal tekrar 10 bp yakın olduğu için, 10-mer sarmal eksen herhangi bir net saptırma dairesel bir yay (Şekil 3A) gibi bir şekil üretilmesi için birikecektir. Sarmal süresi 10.5 bp yakın olduğundan, ekstra bir baz olabildiğince düzlemsel olarak kavisli yapısını korumak için her iki tekrarlar sonra eklenir. 200 bp daha kısa Bu diziler Companie sipariş edilebilirs sunan gen sentezi hizmet. Bu daha sonraki aşamalar için ortak bir adaptör dizisiyle birlikte, bu sekansları yan yüzey için uygundur. Bu prosedür Şekil 3B&#39;de şematize edilmiştir. </li><li> Primer 1 (GTGCCAGCAACAGATAGC) ve Primer 2 (/ 5Cy3/TAAATTCCTACAACAACGAGCTCGAATG) ile PCR yapın. Not: Primer 2 5 &#39;ucunda FRET verici Cy3 ile etiketlenir. Tipik bir PCR protokol tarifi ve bisiklet Tablolar 1 ve 2&#39;de sunulmuştur. </li><li> Primer 3 (/ 5BioTEG/GAAACATAG/iCy5/GAATTTACCGTGCCAGCAACAGATAGC) ve Primer 4 (CAACAACGAGCTCGAATG) ile PCR gerçekleştirin. NOT: Primer 3 5 &#39;ucunda omurga ve biyotin bağlayıcı aracılığıyla FRET alıcı Cy5 ile etiketlenir. PCR tarifi ve bisiklet protokol yukarıdaki gibidir. </li><li> Bir PCR temizleme kiti kullanılarak PCR ürünleri saflaştırılır. </li><li> 0.4 ve nihai konsantrasyonlarda iplik değişimi için bir tampon (100 mM NaCl, 10 mM Tris-HCl pH 7.0, 1 mM EDTA) içinde Cy3-etiketli ürün ve Cy5 etiketli ürünün karıştırın# 181; sırasıyla M ve 0.1 mcM. Not: aşırı Cy3-DNA şerit değişimi sonucu Cy3 ve Cy5 hem taşıyan çift yönlü konsantrasyonunu arttırır. </li><li> 2 dakika için 98.5 ° C &#39;de enkübe edilerek Değişim şeritler, yavaş yavaş 5 soğutulduktan ° C 0.1 ° C / sn bir artış hızı ile ve 5 de inkübe &#160; 2 saat boyunca ° C. </li></ol> 2.. Jel Elektroforez dsDNA Eğrilik Algılama <ol><li> 29.2:0.8 oranında akrilamid ve bis-akrilamid solüsyon karıştırılarak bir poliakrilamid jeli 16,17 dökün,% 5 (ağ / hac) pH 8.0 &#39;de 1X Tris / borat / EDTA (TBE) tamponu. Not: jel solüsyonu 10 mi içerir: 1.217 ml% 40 akrilamit, 0.667 ml% 2 bis-akrilamid, 1 mi TBE 10X, 100 L amonyum persülfat (APS) 10,% 10, L TEMED, ve geri kalan dH 2 O olduğu Jelin tam katılaşması yaklaşık 30 dakika sürer. </li><li> DNA örnekleri ve 1X yükleme tamponu içinde DNA merdiveni (% 5 gliserol,% 0.03 (ağırlık / hacim) bromofenol bl ile poliakrilamid jel yükue) ve 5-8 de jel de 45 dakika boyunca 4 ° C&#39;de veya boya ön kadar V / cm jel sonuna yaklaşır. </li><li> 30 dakika için 0.5 g / ml etidyum bromid içeren 1X TBE tamponu kullanılarak jel leke. UV ışık altında DNA bantları belirlenmesi. DNA moleküllerinin belirgin boyutlarını hesaplamak için boyut markeri (100 bp DNA merdiven) ile bant pozisyonları karşılaştır. NOT: Kavisli DNA&#39;lar genellikle düz DNA&#39;ların daha yavaş hareket eder. </li></ol> 3.. Hücre Hazırlama Akış <ol><li> Bir matkap basın ve elmas matkap kullanarak bir cam slayt iki zıt kenarları (3&#39;&#39; x 1&#39;&#39;) boyunca delik 6-7 çiftleri delin. Delindikten sonra, görünür cam tozunu su akan slayt ovmak. NOT: delik perfüzyon giriş ve çıkışları olarak hizmet vermektedir. Sondaj esnasında su ile slayt soğutma çatlamasını önlemek için önemlidir. </li><li> Cam bir kavanoza dik slaytlar yerleştirin ve su ile doldurun. 15 dakika boyunca sonikasyon ve başka bir cam kavanoz de içine aktarabilirsinizaseton temizlik için endikedir. 15 dakika boyunca aseton ve sonikasyon ile doldurun. Daha sonra bir sprey şişesi ve su kullanılarak, etanol ile slaytlar durulayın. Polipropilen kavanoza koyun, 5 M potasyum hidroksit ile doldurun ve sonicate 15 dakika için. Son olarak, 15 dakika boyunca su içinde slaytlar sonikasyon. Aynı protokolü kullanarak lamelleri (No. 1, 24 x 40 mm) temizleyin. NOT: Temizlenmiş slaytlar ve lamelleri uzun süreli kullanım için dH 2 O saklanabilir. </li><li> 0.1 M sodyum bikarbonat çözeltisi 340 L mPEG-silan 80 mg (MW 2000) ile biotin-PEG-silan, 1 mg (MW 3400) karıştırın. İyice karıştırın ve baloncuklar kurtulmak için kısaca karışımı santrifüj. NOT: Polietilen glikol (PEG) ile yüzeyin işlevselleştirme yüzeyine spesifik olmayan DNA bağlanma azaltmaya yardımcı olur. </li><li> Her slaytta PEG çözeltisi 80 L koyun ve hafifçe üzerine bir lamel düşük. 45 dakika boyunca bekleyin. , Cımbız ile slayt lamel ayırın dH 2 O bol miktarda durulayın ve izin taçık havada hem kuru. </li><li> Kanallar oluşturmak üzere slaytta çift-çubuk ince şerit bant yerleştirin. Bunun üzerine bir lamel hizalayın ve sıkıca sıvı geçirmez kanallar oluşturmak üzere slayt karşı lamel basın. Kanalların kenarları mühür 5 dakika epoksi kullanın. </li></ol> Trolox Çözüm 4. Hazırlanması <ol><li> Bir şişe içinde ~ 30 mg troloks ve 10 ml dH 2 O koyun ve 18 saat süre ile açık havada solüsyonu karıştırmak için bir mıknatıs karıştırma çubuğu kullanmaktadır. </li><li> Bir 0.2 mikron filtre kullanılarak filtre edilir ve çözelti 1 M Tris bazı (pH 11)-6 ul ekleyerek pH 7&#39;ye ayarlanır. Not: Trolox genel olarak 18 çalışmalar, tek bir molekül olarak kullanılan bir anti-yanıp sönen reaktiftir. Trolox ® solmaya hareket kısmen bozulmuş Trolox ® çözeltisi 19 içinde mevcut olan kendi oksitlenmiş türevi gelmektedir. Metanol ya da yüksek hızlı bir şekilde pH Tris Trolox ® çözeltisi içinde çözündürülmesi için yetersiz oksidasyon kaçınılmalıdır. </li></ol> 5. Tek molecule Görüntüleme <ol><li> Kanala NeutrAvidin çözeltisi (0.5 mg / ml) 15 ul enjekte edilir ve T50 tampon 100 ul (10 mM Tris-HCl, 50 mM NaCl, pH 7.0) ile yıkamadan önce 2 dakika boyunca bekleyin. </li><li> Kanalın içine DNA örneği (50-100 pM), 50 ul enjekte edilir. 5 dakika bekleyin ve T50 tampon 100 L uzakta ilişkisiz DNA durulayın. Not: DNA molekülleri, özellikle NeutrAvidin-biyotin etkileşimi yoluyla yüzeye bağlanacaktır. </li><li> Bir oksijen tutucu sistem 20 (100 mM PCD, 5 mM PCA, 1 mM Trolox ve 500 mM NaCl) içeren bir görüntüleme tamponu ile kanal doldurun. </li><li> Saniyede 25 kare bilgisayara 2 x 2 binned görüntüleri (256 x 256) akışı çerçeve transfer modunda EMCCD ayarlayın. </li><li> Mikroskop objektif üzerinde daldırma yağ koymak, ve numune klipsler kullanılarak mikroskop sahnede akış hücresi düzeltmek. Duvara lazer yansıma şekline bakarak odağı kaba ayarlayın. Floresan im canlı görünümünü kullanarak odağı İnce ayarımonitörde yaş. </li><li> Üzerinde 532 nm lazer ile veri toplama başlar. Canlı görünümünü kontrol edin ve gerekirse odağı ayarlayın. En molekülleri photobleached olduğunda veri toplama durdurun. NOT: Bu tesiste, mikroskop kontrol ve sabit diske kaydedilmiş olarak monitörde canlı görüntüleri görüntülemek için bir laboratuvar-C yazılı programı kullanılmıştır. </li></ol> 6.. Görüntü İşleme ve Veri Analizi NOT: 256 x 256 görüntülerin bir zaman serisi Cy3 ve Cy5 şiddetlerinde tek-molekül zaman izlerini oluşturmak için bir MATLAB kodu tarafından işlenir. Donör kanal ve bölünmüş görünüm görüntü alıcı kanal arasındaki pikselleri eşleştirmek için, Cy3 ve Cy5 noktalar 6-7 çifti, eşit görüş alanına yayılmış aynı molekülün her çifti, elle bir afin dönüşüm aldı, ve vardır çapa noktaları olarak bu noktalar koordinatları kullanılarak hesaplanır. <ol><li> MATLAB komut dosyası kullanarak, tüm tek-molekül süre bakmak t izleridüşük ve yüksek FRET sinyalleri arasında şapka gösterisi çoklu geçişler. Döngüye ve unlooped durumlarını belirlemek. Not: FRET sinyali Cy5 yoğunluğu olarak tanımlanan (I a) Cy3 ve Cy5 yoğunluklarının toplamı (I I a + d) bölünür. Unlooped hali düşük FRET değere sahip iken döngüye devlet yüksek FRET değeri vardır. Tek bir molekülden FRET sinyallerinin histogram bimodally için geri loop ve unlooping arasında dağıtılır. </li><li> İki monte Gauss eğrileri arasındaki kesişim belirleyerek iki dağılımları ayıran eşik bulun. </li><li> FRET verimliliği gibi hesaplayın <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq7.jpg" /> ve yüksek FRET değerleri ve düşük FRET değerleri ile unlooped devletlerle döngüye durumları atayın. </li><li> MATLAB komut dosyası kullanarak, moleküllerin (N (t)) kümülatif sayısını analiz o döngüye (veyaveri toplama başından bu yana farklı zaman geçerse de yüksek FRET devlet) ulaştı. NOT: dsDNA molekül veri toplama başında unlooped devletin herhangi bir yapısındaki başlayabilirsiniz yana, ilmekli nüfus artış oranı ortalama döngü oranı ilk konformasyonlar üzerinden ortalama yansıtır. Üstel fonksiyonu ile N (t) takarak döngü oranı k döngü Özü: <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq1.jpg" /> Biphasically artarsa, o bir çift üstel fonksiyonu ile donatılmış olabilir: <img fo:content-width="2.2in" src="/files/ftp_upload/51667/eq2.jpg" /> Bu durumda, k döngü elde edilir: <img fo:content-width="1.7in" src="/files/ftp_upload/51667/eq3.jpg" /> Not: Teorik olarak, bir polimer t zamanında döngüye olmadığını hayatta kalma olasılığı, tek veya çift üstel fonksiyon 12 değildir. Üstel fitting ortalama döngü süresini elde etmek için pratik bir araç olarak kullanılır. </li></ol> 7. J Factor Belirlenmesi Not: J faktörü dsDNA bir ucu diğer ucunda yaklaşık kadar konsantre edildi temsil eder. Bu döngü oranı olarak ölçülen diğer ucu bölümü ile aynı reaksiyon oranını üretecektir DNA&#39;nın bir ucu diliminin konsantrasyonunu interpolasyonuyla belirlenebilir. Deneysel olarak, bir uç kademeli bir yüzeyi üzerinde immobilize edilir ve diğer uç kademeli bir belirli konsantrasyon ° C&#39;de ilave edilir. Iki ucu arasındaki ölçülen bağlanma oranı k tavlama ise, J faktörü 21 ile verilir <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq4.jpg" /> . Tavlama oranı sabiti (k tavlama = k tavlama / C), prob konsantrasyonu bağımsızdır. <ol><li> 30-50 pM biotin-Cy5 oligo 20 ul (Primer 3) akış iBir NeutrAvidin kaplı kanal nto. Ilişkisiz oligolarını yıkayacak 100 ul T50 ile kanal durulayın. </li><li> 50 nM&#39;lik bir nihai konsantrasyonda Cy3 oligo (Primer 2) ilavesi ile kısmen 5&#39;te tarif edildiği gibi görüntüleme tamponu hazırlayın. Kanala bu görüntüleme tampon akış. </li><li> Üzerinde 532 nm lazer tutarken, kısaca yüzey bağlı Cy5 Oligoların konumlarını belirlemek için 640 nm lazer açın. 640 nm lazer kapatın ve FRET sinyal izleme başlar. NOT: Bir yüzeye bağlı Cy5 oligo için bir Cy3 oligo hibridizasyon üzerine, Cy5 floresans FRET dan ortaya çıkacaktır. </li><li> MATLAB komut dosyası kullanılarak, ilişkisiz devlet (düşük yoğunluklu Cy5) başlar ama daha sonra Cy5 yoğunluk izlerinden zamanın bir fonksiyonu olarak tavlı devlet (yüksek Cy5 yoğunluğu) dönüşmesi moleküllerinin sayısını analiz. </li><li> Tavlı moleküllerin karşı zaman bu sayı çiziniz. Tek bir üstel fonksiyonu ile (bu eğrinin <img fo:content-width="1.8in" src="/files/ftp_upload/51667/eq5.jpg"/&gt;), Tavlama oranı (k anneal) elde edilmiştir. </li><li> Tavlama oranı ve reaktan konsantrasyonu arasında lineer teyit etmek için farklı oligo Cy3 konsantrasyonda (60, 100 ve 180 nM) bu deney tekrarlayın. Ikinci dereceden tavlama oranı sabiti (k tavlama Özü ) Yamaç. </li><li> J faktör hesaplayın <img fo:content-width="0.6in" src="/files/ftp_upload/51667/eq6.jpg" /> , K döngü aynı tampon durumda ölçülen döngü hızıdır. </li></ol>

<ol>
	<li>Garcia, H. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biological+consequences+of+tightly+bent+DNA:+The+other+life+of+a+macromolecular+celebrity.">Biological consequences of tightly bent DNA: The other life of a macromolecular celebrity.</a> Biopolymers. 85, 115-130 (2007).</li><li>Wiggins, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+flexibility+of+DNA+on+short+length+scales+probed+by+atomic+force+microscopy.">High flexibility of DNA on short length scales probed by atomic force microscopy.</a> Nature Nanotechnology. 1, (2006).</li><li>Lionberger, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperative+kinking+at+distant+sites+in+mechanically+stressed+DNA.">Cooperative kinking at distant sites in mechanically stressed DNA.</a> Nucleic Acids Research. 41, 6785-6792 (2011).</li><li>Shore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+flexibility+studied+by+covalent+closure+of+short+fragments+into+circles.">DNA flexibility studied by covalent closure of short fragments into circles.</a> Proc Natl Acad Sci U S A. 78, 4833-4837 (1981).</li><li>Geggier, S., Vologodskii, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+dependence+of+DNA+bending+rigidity.">Sequence dependence of DNA bending rigidity.</a> Proc Nat Acad Sci U S A. 107, 15421-15426 (1992).</li><li>Smith, S. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+mechanical+measurements+of+the+elasticity+of+single+DNA+molecules+by+using+magnetic+beads.">Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads.</a> Science. 258, 1122-1126 (1992).</li><li>Peters, J. P., Maher, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+curvature+and+flexibility+in+vitro+and+in+vivo.">DNA curvature and flexibility in vitro and in vivo.</a> Quarterly Reviews of Biophysics. 43, 23-63 (2010).</li><li>Cloutier, T. E., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+sharp+bending+of+double-stranded+DNA.">Spontaneous sharp bending of double-stranded DNA.</a> Molecular Cell. 14, 355-362 (2004).</li><li>Du, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclization+of+short+DNA+fragments+and+bending+fluctuations+of+the+double+helix.">Cyclization of short DNA fragments and bending fluctuations of the double helix.</a> Proc Natl Acad Sci U S A. 102, 5397-5402 (2005).</li><li>Yuan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T4+DNA+ligase+is+more+than+an+effective+trap+of+cyclized+dsDNA.">T4 DNA ligase is more than an effective trap of cyclized dsDNA.</a> Nucl. Acids Res. 35, 5294-5302 (2007).</li><li>Manzo, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+nonspecific+binding+of+lambda+repressor+on+DNA+looping+dynamics.">The effect of nonspecific binding of lambda repressor on DNA looping dynamics.</a> Biophysical Journal. 103, 1753-1761 (2012).</li><li>Le, T. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+shape-dependent+looping+probability+of+DNA.">Measuring shape-dependent looping probability of DNA.</a> Biophys. J. 104, 2068-2076 (2013).</li><li>Vafabakhsh, R., Ha, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extreme+bendability+of+DNA+less+than+100+base+pairs+long+revealed+by+single-molecule+cyclization.">Extreme bendability of DNA less than 100 base pairs long revealed by single-molecule cyclization.</a> Science. 337, 1097-1101 (2012).</li><li>Friedman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viewing+dynamic+assembly+of+molecular+complexes+by+multi-wavelength+single-molecule+fluorescence.">Viewing dynamic assembly of molecular complexes by multi-wavelength single-molecule fluorescence.</a> Biophysical Journal. 91, 1023-1031 (2006).</li><li>Kaplan, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-encoded+nucleosome+organization+of+a+eukaryotic+genome.">The DNA-encoded nucleosome organization of a eukaryotic genome.</a> Nature. 458, 362-366 (2009).</li><li>Koo, H. S., Crothers, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+of+DNA+curvature+and+a+unified+description+of+sequence-directed+bending.">Calibration of DNA curvature and a unified description of sequence-directed bending.</a> Proc Nat Acad Sci U S A. 85, 1763-1767 (1988).</li><li>Prosseda, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+temperature-induced+narrow+DNA+curvature+range+sustains+the+maximum+activity+of+a+bacterial+promoter+in+vitro.">A temperature-induced narrow DNA curvature range sustains the maximum activity of a bacterial promoter in vitro.</a> Biochemistry. 49, 2778-2785 (2010).</li><li>Rasnik, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonblinking+and+long-lasting+single-molecule+fluorescence+imaging.">Nonblinking and long-lasting single-molecule fluorescence imaging.</a> Nature Methods. 3, 891-893 (2006).</li><li>Cordes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+mechanism+of+Trolox+as+antiblinking+and+antibleaching+reagent.">On the mechanism of Trolox as antiblinking and antibleaching reagent.</a> J. Am. Chem. Soc. 131, 5018-5019 (2009).</li><li>Aitken, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+oxygen+scavenging+system+for+improvement+of+dye+stability+in+single-molecule+fluorescence+experiments.">An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments.</a> Biophys J. 94, 1826-1835 (2008).</li><li>Taylor, W. H., Hagerman, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+the+method+of+phage+T4+DNA+ligase-catalyzed+ring-closure+to+the+study+of+DNA+structure:+II.+NaCl-dependence+of+DNA+flexibility+and+helical+repeat.">Application of the method of phage T4 DNA ligase-catalyzed ring-closure to the study of DNA structure: II. NaCl-dependence of DNA flexibility and helical repeat.</a> Journal of Molecular Biology. 212, 363-376 (1990).</li><li>Bolshoy, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Curved+DNA+without+A-A:+experimental+estimation+of+all+16+DNA+wedge+angles.">Curved DNA without A-A: experimental estimation of all 16 DNA wedge angles.</a> Proc Natl Acad Sci U S A. 88, 2312-2316 (1991).</li><li>Gibson, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+DNA+fragments+in+yeast+by+one-step+assembly+of+overlapping+oligonucleotides.">Synthesis of DNA fragments in yeast by one-step assembly of overlapping oligonucleotides.</a> Nucl. Acids Res. 37, 6984-6990 (2009).</li><li>Vologodskii, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bending+of+short+DNA+helices.">Bending of short DNA helices.</a> Artif DNA PNA XNA. 4, (2013).</li><li>Hoover, D. M., Lubkowski, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNAWorks:+an+automated+method+for+designing+oligonucleotides+for+PCR-based+gene+synthesis.">DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis.</a> Nucl. Acids Res. 30, (2002).</li><li>Waters, J. T., Kim, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Equilibrium+Statistics+of+a+Surface-Pinned+Semiflexible+Polymer.">Equilibrium Statistics of a Surface-Pinned Semiflexible Polymer.</a> Macromolecules. 46, 6659-6666 (2013).</li><li>Mills, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+evidence+that+single-stranded+regions+of+1+or+more+nucleotides+dramatically+increase+the+flexibility+of+DNA.">Electrophoretic evidence that single-stranded regions of 1 or more nucleotides dramatically increase the flexibility of DNA.</a> Biochemistry. 33, 1797-1803 (1994).</li></ol>

Yazarlar çıkar çatışması beyan ederim.

FRET göre basit bir tek-molekül deney farklı şekillerde iç DNA&#39;ların ilmek kinetiğini incelemek için kullanılmıştır. Eğimli DNA&#39;lar 10.5 bp&#39;lik sarmal süresi ile aynı fazda bir 10-mer dizisini tekrar ile hazırlanabilir, ve eğrilikleri PAGE kullanılarak tahmin edilebilir. Bu dsDNAs geçici döngü stabilizasyonu sağlamak için yapışkan uçları ile tasarlanmıştır. Zamanla döngüye moleküllerin sayısındaki artıştan üstel döngü hızı ekstre edilmiştir. Kesilmiş yapışkan uç...

DsDNA&#39;nın mekanik özelliklerini anlama, temel bilimler ve mühendislik uygulamalarında temel bir öneme sahiptir. Ardışık baz çiftleri arasına rulo, eğim ve büküm açıları dizisi ile değişebilir çünkü dsDNA&#39;nın yapısı düz bir sarmal merdiven daha karmaşıktır. Termal dalgalanmalar dsDNA gibi, bükme büküm ve germe gibi yapısal dalgalanmalara farklı modları geçmesi neden olabilir. Bu eritme ve dolanmaya olarak geçişleri de aşırı koşullarda oluşabilir. Bu hareketler arasında, dsDNA bükme en çok dikkat çeken biyolojik etkiye sahiptir 1. dsDNA eğilme birbirine yakın iki uzak siteleri getirerek gen baskıyla veya aktivasyonu ile ilişkilidir. Ayrıca, DNA hücre çekirdeğinin içine ambalaj veya bir viral kapsid önemli bir rol oynar. DsDNA bükülmesi deformasyonu yüksek çözünürlüklü mikroskopisi (AFM 2 ve 3 TEM) ve Thermodyn ile deneysel olarak görselleştirilebiliramics ve kinetik kimyasal dsDNA&#39;nın yan yana sitelere link loop tahliller ile ele alınabilir. Böyle bir deney, ligaz bağımlı siklizasyon 4&#39;tür. Bu testte, &#39;yapışkan&#39; (yapışkan) uçları ile dsDNA moleküller sirküle veya DNA ligazı ile dimerize. Daire ve dimer oluşumunun oranlarını karşılaştırarak, bir J faktör olarak bilinen diğer ucu, yakın DNA&#39;nın bir ucunun etkin bir molar konsantrasyon elde edebilir. Bu, J faktör diğer ucunda, kısa bir mesafede, DNA&#39;nın bir ucu bulma olasılığı yoğunluğuna boyutlu eşdeğerdir ve bu şekilde DNA&#39;nın bir esneklik göstermektedir. DNA uzunluğunun bir fonksiyonu olarak J faktörünün ölçülmesi kalıcı uzunluğu 4,5 &#39;da dahil olmak üzere bir DNA ile ilgili birçok mekanik özelliklerini ortaya koymaktadır. Solucan benzeri zincir (WLC) modeli yaygın bir açıklamaya onun başarısına dayanan dsDNA mekaniği için kanonik polimer modeli olarak kabul edilmiştirDNA deneyleri 6 çekerek, doğru ve uzun 200 bp 7 daha dsDNAs arasında J faktörleri tahmin elde kuvvet-uzatma eğrileri adencilik. Bununla birlikte, 100 bp kadar kısa dsDNA moleküller üzerinde siklizasyon deneyi kullanılarak, Cloutier ve Widom WLC modeli tahmin 8 daha yüksek, birkaç kat olmak J faktörleri ölçülür. Bir yıl sonra, Du ve ark. ligazı düşük konsantrasyonları ile siklizasyon deneyi kullanılarak WLC modeli ile uyum içinde J faktörleri üretilen ve Widom gruptan 9 ligaz kullanılan yüksek konsantrasyonlara anormal sonucu bağlanabilir. Geleneksel tahlil 9 kullanırken bu tartışma siklizasyonudur kinetik DNA ligaz kaçınılmaz etkisini örneğidir. Ayrıca, DNA ligaz, aynı zamanda non-spesifik bağlanma 10,11 aracılığıyla gerçekleştirilen DNA yapısı ve sertlik etkileyebilir. Protein-bağımlı ilmek testlerin teknik endişelerini ortadan kaldırmak için, son zamanlarda bir prot gösterdiFlüoresans Rezonans Enerji Transferi (FRET) 12 göre ein içermeyen döngü deneyi. Bu yöntemde, döngüye konformasyonları bir DNA molekülünün yapışkan uçlarının yakınında bağlı verici ve alıcı arasında FRET ile tespit edilir. Objektif tipi toplam iç yansıma flüoresans mikroskobu (TIRFM) geri loop ve uzun bir süre için hareketsiz kılınmış yüzeye tek bir DNA moleküllerinden unlooping etkinlikleri yörüngeleri kaydetmek için kullanılır. Bu yöntem, Vafabakhsh Ha ve 13 ile benzer bir yöntem üzerinde çok önemli bir gelişmedir uyumsuzluk içermeyen DNA molekülleri oluşturmak için DNA moleküllerinin PCR tabanlı bir montaj sağlar. Bu protokol, tek moleküllü bir yönü, FRET yönü bir hatta ligaz aktivitesi bozabilir koşullarda, aynı molekülde tekrar tekrar DNA ilmek dinamikleri ölçmek için sağlar Buna ek olarak dağılımlarının ölçüm ortalamalar topluluğa sağlar. TIRFM düzeneği Şekil 1&#39;de gösterilmiştir. Özel bir-Tasarlanmış numune aşama bir Olympus IX61 mikroskop vücuda yerleştirilir. 532 nm ve 640 nm lazerler tarafından tanıtıldı ve lamel-su arayüzünde geliş kritik açıyı elde etmek için yüksek NA objektif içine küçük eliptik ayna 14 tarafından yansıtılır. Daha yaygın bir dikroik ayna veya prizma bazlı TIR kurulumları kullanılarak objektif TIR da FRET, bu uygulama için kullanılabilir unutmayın. Mikroskop ile oluşan floresan görüntü bir dikroik ayna, verici ve alıcı görüntüleri ayrılmıştır. Daha sonra, bir EMCCD iki yarısı üzerine yeniden görüntülü. Ek uzun geçiş filtresi emisyon arka plan sinyali azaltmak için kullanılır. Sıcaklık kontrolü tekrarlanabilir kinetik verileri elde etmek için gereklidir. Sıcaklık kontrolü için, objektif, sıcaklık kontrollü bir soğutucu / ısıtıcı ısı transferi, ve su en aza indirmek için mikroskop vücudun burun parçası ayrılır sıkıca oturan bir pirinç bileziği yoluyla sirküle ediliramaç kılıfın altında iç metal etrafında. Bu kurulum 15 ve 50 ° C arasında lamel yüzey (Şekil 2) sağlam sıcaklık kontrolünü sağlamak mümkün. Bu çalışmada, örnek sıcaklığı 24 ° C&#39;de muhafaza edilmiştir Aşağıdaki protokol DNA yapımında, DNA şekil tahmini, tek molekül deney ve J faktör belirlenmesi için adım adım işlemi sunar.

<table border="0" cellpadding="0" cellspacing="0" width="793">
	<tbody>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Small DNA FRAG Extract Kit-100PR</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97060-558</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Acrylamide 40% solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97064-522</td>
			<td style="width:183px;"></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Bis-acrylamide 2% (w/v) solution 500 mL</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">97063-948</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">GeneRuler 100 bp DNA Ladder, 100-1000 bp</td>
			<td style="width:124px;">Fermentas</td>
			<td>SM0241</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Mini Vertical PAGE System</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">89032-300</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Syringe filter 0.2um CS50</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Trolox</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">238813-1G</td>
			<td>triplet state quencher</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuic acid (PCA)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">08992-50MG</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Protocatechuate 3,4-Dioxygenase (PCD)</td>
			<td style="width:124px;">Sigma-Aldrich</td>
			<td style="width:135px;">P8279-25UN</td>
			<td>oxygen scavenging system</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">mPEG-silane, MW 2000 1g</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">MPEG-SIL-2000-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Biotin-PEG-Silane, MW 3400</td>
			<td style="width:124px;">Laysan Bio</td>
			<td style="width:135px;">Biotin-PEG-SIL-3400-1g</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Avidin, NeutrAvidin Biotin-binding Protein</td>
			<td style="width:124px;">Invitrogen</td>
			<td style="width:135px;">A2666</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Phusion Hot Start High-Fidelity DNA Polymerase</td>
			<td style="width:124px;">New England Biolabs</td>
			<td style="width:135px;">F-540L</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">Gel/PCR DNA Fragments Extraction Kit</td>
			<td>IBI Scientific</td>
			<td>IB47020</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Premium plain glass microscope slides</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;">12-544-1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">VWR micro cover glass, rectangular, no. 1</td>
			<td style="width:124px;">VWR</td>
			<td style="width:135px;">48404-456</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fisher Scientific Isotemp 1006s Recirculating Chiller/Heater</td>
			<td style="width:124px;">Fisher Scientific</td>
			<td style="width:135px;"></td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective Cooling Collar</td>
			<td style="width:124px;">Bioptechs</td>
			<td style="width:135px;">150303</td>
			<td>temperature control</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">KMI53 Biological Micrometer Measuring Stage</td>
			<td style="width:124px;">Semprex</td>
			<td style="width:135px;">KMI53</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">High Performance DPSS Laser 532nm 50mW&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">NT66-968</td>
			<td>Cy3 excitation</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:351px;">CUBE Fiber Pigtailed 640 nm, 30mW, Fiber, FC/APC Connector</td>
			<td style="width:124px;">Coherent</td>
			<td style="width:135px;">1139604</td>
			<td>Cy5 excitation</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">650 nm BrightLine Dichroic Beamsplitter</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">FF650-Di01-25x36</td>
			<td>splitting dichroic</td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:351px;">LaserMUX Beam Combiner, reflects 514.5, 532, &#38; 543.5 nm lasers, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">LM01-552-25</td>
			<td>combining dichroic</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Brightline Fluorescence Filter 593/40</td>
			<td style="width:124px;">Semrock</td>
			<td>FF01-593/40-25</td>
			<td>Cy3 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">635 nm EdgeBasic LWP longpass Filter, 25 mm</td>
			<td style="width:124px;">Semrock</td>
			<td style="width:135px;">BLP01-635R-25</td>
			<td>Cy5 emission filter</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">EMCCD iXon+</td>
			<td style="width:124px;">Andor Technology</td>
			<td style="width:135px;">DU-897E-CS0-#BV</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">IX51 inverted microscope frame</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Objective UApo N 100x/1.49 Oil TIRF</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;"></td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Immersion oil type-F for fluorescence microscopy</td>
			<td style="width:124px;">Olympus</td>
			<td style="width:135px;">IMMOIL-F30CC</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">2mm Diameter 45&#176; Rod Lens Aluminum Coated&#160;</td>
			<td style="width:124px;">Edmund optics</td>
			<td style="width:135px;">54-092</td>
			<td>miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">1/4&#34; Travel Single-Axis Translation Stage</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">MS-1</td>
			<td>translation of miniature mirror</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;">&#216;1&#34; Achromatic Doublet, ARC: 400-700 nm, f=200 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-200-A</td>
			<td>focusing lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Adjustable Mechanical Slit</td>
			<td style="width:124px;">Thorlabs</td>
			<td>VA100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dielectric Mirror</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">BB1-E02</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">&#216;1&#34; Achromatic Doublet, f = 100 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">AC254-100-A</td>
			<td>relay lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Lens Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LMR1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Dichroic Filter Mount</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">FFM1</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Fixed Cage Cube Platform</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">B3C</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">Kinematic Mount for &#216;1&#34; Optics</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">KM100</td>
			<td></td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lens, &#216;1&#34;, f = 40 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1422-A</td>
			<td>collimating lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 15 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1222-A</td>
			<td>telescope lens</td>
		</tr>
		<tr height="17">
			<td height="17" style="height:17px;width:351px;">N-BK7 Plano-Convex Lense, &#216;6.0 mm, f = 150 mm</td>
			<td style="width:124px;">Thorlabs</td>
			<td style="width:135px;">LA1433-A</td>
			<td>telescope lens</td>
		</tr>
	</tbody>
</table>

studying dna looping by single-molecule fret

Iki-şeritli DNA (dsDNA) eğilmesi gibi DNA-protein tanıma ve nükleozom içine DNA paket gibi birçok önemli biyolojik süreçler ile ilişkilidir. DsDNA bükme Termodinamik kovalent bir dsDNA&#39;nın kısa yapışkan uçlarını birleştiren DNA ligaz dayanan bir yöntem denilen siklizasyonu tarafından incelenmiştir. Bununla birlikte, bu gibi bağlama verimliliği DNA katılan yapışkan uçlarını çevreleyen yapı ve ligaz gibi döngü dsDNA ile ilişkili olmayan bir çok faktör tarafından etkilenebilir, aynı zamanda, non-spesifik bağlanma gibi mekanizmalar yoluyla belirgin ilmek hızını etkileyebilir. Burada, biz FRET (Floresan Rezonans Enerji Transferi) tarafından geçici DNA döngü oluşumunu tespit ederek ligazın olmadan dsDNA ilmek kinetik ölçmek için nasıl göstereceğim. dsDNA molekülleri, FRET çifti ve bir biyotin bağlayıcı ile basit PCR tabanlı bir protokol kullanılarak inşa edilmektedir. J faktörü olarak bilinen döngü olasılık yoğunluk kapa iki döngü arasındaki oran ile tavlama oranı elde edilirted yapışkan biter. Farklı içsel eğriliğe sahip iki dsDNAs test ederek, J faktör dsDNA iç şekline duyarlı olduğunu göstermektedir.

Ilmekleme çalışma için kullanılan DNA molekülleri değişken sırasının uzunluğu ve her bir diğerine tamamlayıcı olan tek şeritli çıkıntılarının bir çift yönlü bölge oluşur. 7-baz uzunluğunda olan çıkıntılar, ilmekli durumunu yakalamak için birbirine bağlandığı olabilir. Her bir çıkıntı sitidin kimya yoluyla DNA omurgada bağlantılıdır Cy3 veya Cy5 ya da içerir. Cy5-çıkıntı da hareketsizleştirme yüzeyi (Şekil 4A) için biotin-TEG (15-atom Tetra-Etilen Gli...

Watch this Scientific Journal Video about Studying DNA Looping by Single-Molecule FRET at JoVE.com

Studying DNA Looping by Single-Molecule FRET

Bu çalışma, tek bir molekül flüoresan rezonans enerji transferi (FRET) kullanılarak çift sarmallı DNA ilmek dinamiklerini ölçmek için bir ayrıntılı deneysel prosedür sunmaktadır. Protokol ayrıca J faktörü denilen döngü olasılık yoğunluğunu ayıklamak için nasıl açıklar.

Tek Molekül FRET DNA döngü oluşturma incelenmesi

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into ...

studying-dna-looping-by-single-molecule-fret

Research

JoVE Journal

Biology

15.3K Görüntüleme.  Georgia Institute of Technology.  Bu çalışma, tek bir molekül flüoresan rezonans enerji transferi (FRET) kullanılarak çift sarmallı DNA ilmek dinamiklerini ölçmek için bir ayrıntılı deneysel prosedür sunmaktadır. Protokol ayrıca J faktörü denilen döngü olasılık yoğunluğunu ayıklamak için nasıl açıklar. 

Video: Studying DNA Looping by Single-Molecule FRET

Single Molecule Methods for Monitoring Changes in Bilayer Elastic Properties

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein interactions and more general lipid bilayer-protein interactions. These interactions are particularly important in pharmacological research, as many current pharmaceuticals on the market can alter the lipid bilayer material properties, which can lead to altered membrane protein function.   The formation of gramicidin channels are dependent on conformational changes in gramicidin subunits which are in turn dependent on the properties of the lipid.  Hence the gramicidin channel  current is a reporter of altered properties of the bilayer due to certain compounds.  

Membrane protein function is regulated by the cell membrane lipid composition. This video-article details how to form a patch using bilayer patch electrodes, as well as how to use gramicidin channels as reporters of altered membrane properties.

Çift katlı Elastik Özellikleri İzleme Değişiklikler için Tek Molekül Yöntemleri

Membrane protein function is regulated by the cell membrane lipid composition.  This regulation is due to a combination of specific lipid-protein ...

Biyoloji

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

Birleştiren QD FRET Mikroakiskan Real-Time DNA Nanocomplex Self-Meclis Monitör

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides (Figure 1). The growing product double-strand DNA (dsDNA) is extended with laminar flow and visualized by using an intercalating dye. Measuring the position of the growing DNA end in real time allows precise determination of replication rate (Figure 2). Furthermore, the length of completed DNA products reports on the processivity of replication. This experiment can be performed very easily and rapidly and requires only a fluorescence microscope with a reasonably sensitive camera.


This protocol demonstrates a simple single-molecule fluorescence microscopy technique for visualizing DNA replication by individual replisomes in real time.

Floresan Mikroskop ile görselleştirme Tek molekül DNA replikasyonu

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Yüzey immobilize Biyomoleküller Tek Molekül Floresans Ölçümler için Otomatik Sistem

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. Linearized &lambda; DNA is modified to have a biotin on the end of one strand, and a digoxigenin moiety on the other end of the same strand. The biotinylated end is attached to a functionalized glass coverslip and the digoxigeninated end to a small bead. The assembly of these DNA-bead tethers on the surface of a flow cell allows a laminar flow to be applied to exert a drag force on the bead. As a result, the DNA is stretched close to and parallel to the surface of the coverslip at a force that is determined by the flow rate (Figure 1). The length of the DNA is measured by monitoring the position of the bead. Length differences between single- and double-stranded DNA are utilized to obtain real-time information on the activity of the replication proteins at the fork. Measuring the position of the bead allows precise determination of the rates and processivities of DNA unwinding and polymerization (Figure 2).

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system.

Enzimlerin Klonlanması DNA Doğrudan Gözlem Tek bir molekülü DNA Testi Esneme

We describe a method for observing real time replication of individual DNA molecules mediated by proteins of the bacteriophage replication system. ...

Single-Molecule Imaging of Nuclear Transport

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the last decade. The investigation of molecular interactions with high temporal and spatial resolutions deep within cells has remained challenging due to the inherently weak signals arising from individual molecules. Recent works by Yang et al. demonstrated that narrow-field epifluorescence microscopy allows visualization of nucleocytoplasmic transport at the single molecule level. By the single molecule approach, important kinetics, such as nuclear transport time and efficiency, for signal-dependent and independent cargo molecules have been obtained. Here we described a protocol for the methodological approach with an improved spatiotemporal resolution of 0.4 ms and 12 nm. The improved resolution enabled us to capture transient active transport and passive diffusion events through the nuclear pore complexes (NPC) in semi-intact cells. We expect this method to be used in elucidating other binding and trafficking events within cells.

Single molecule microscopy approch provided novel insights into nuclear transport.

Tek Molekül Görüntüleme Nükleer Ulaştırma

The utility of single molecule fluorescence microscopy approaches has been proven to be of a great avail in understanding biological reactions over the ...

Monitoring Kinase and Phosphatase Activities Through the Cell Cycle by Ratiometric FRET

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such probes typically consist of variants of CFP and YFP, intervened by a phosphorylatable sequence and a phospho-binding domain. Upon phosphorylation, the probe changes conformation, which results in a change of the distance or orientation between CFP and YFP, leading to a change in FRET efficiency (Fig 1). Several probes have been published during the last decade, monitoring the activity balance of multiple kinases and phosphatases, including reporters of PKA2, PKB3, PKC4, PKD5, ERK6, JNK7, Cdk18, Aurora B9 and Plk19. Given the modular design, additional probes are likely to emerge in the near future10. 
Progression through the cell cycle is affected by stress signaling pathways 11. Notably, the cell cycle is regulated differently during unperturbed growth compared to when cells are recovering from stress12.Time-lapse imaging of cells through the cell cycle therefore requires particular caution. This becomes a problem particularly when employing ratiometric imaging, since two images with a high signal to noise ratio are required to correctly interpret the results. Ratiometric FRET imaging of cell cycle dependent changes in kinase and phosphatase activities has predominately been restricted to sub-sections of the cell cycle8,9,13,14.
Here, we discuss a method to monitor FRET-based probes using ratiometric imaging throughout the human cell cycle. The method relies on equipment that is available to many researchers in life sciences and does not require expert knowledge of microscopy or image processing.

FRET-based reporters are increasingly used to monitor kinase and phosphatase activities in live cells. Here we describe a method on how to use FRET-based reporters to assess cell cycle-dependent changes in target phosphorylation.

Hücre Döngüsü FRET oranlı metrik sayesinde Kinaz ve Fosfataz Aktiviteleri İzleme

F&ouml;rster resonance energy transfer (FRET)-based reporters1 allow the assessment of endogenous kinase and phosphatase activities in living cells. Such ...

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage (CoTrAC)

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method makes it possible to count the numbers of protein molecules produced in one cell during sequential, five-minute time windows. It requires a fluorescence microscope with laser excitation power density of ~0.5 to 1 kW/cm2, which is sufficiently sensitive to detect single fluorescent protein molecules in live cells. The fluorescent reporter used in this method consists of three parts: a membrane targeting sequence, a fast-maturing, yellow fluorescent protein and a protease recognition sequence. The reporter is translationally fused to the N-terminus of a protein of interest. Cells are grown on a temperature-controlled microscope stage. Every five minutes, fluorescent molecules within cells are imaged (and later counted by analyzing fluorescence images) and subsequently photobleached so that only newly translated proteins are counted in the next measurement.
Fluorescence images resulting from this method can be analyzed by detecting fluorescent spots in each image, assigning them to individual cells and then assigning cells to cell lineages. The number of proteins produced within a time window in a given cell is calculated by dividing the integrated fluorescence intensity of spots by the average intensity of single fluorescent molecules. We used this method to measure expression levels in the range of 0-45 molecules in single 5 min time windows. This method enabled us to measure noise in the expression of the &lambda; repressor CI, and has many other potential applications in systems biology.

Single-molecule Imaging of Gene Regulation In vivo Using Cotranslational Activation by Cleavage CoTrAC

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC), to image the production of protein molecules in live cells with single-molecule precision without perturbing the protein's functionality. This method has been used to follow the stochastic expression dynamics of a transcription factor, the &lambda; repressor CI 1.

Gen Yönetmelik Tek molekül Görüntüleme<em&gt; In vivo</em&gt; Dilinim tarafından Cotranslational Aktivasyon (CoTrAC) kullanma

We describe a fluorescence microscopy method, Co-Translational Activation by Cleavage (CoTrAC) to image the production of protein molecules in live cells ...

Combining Single-molecule Manipulation and Imaging for the Study of Protein-DNA Interactions

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method offers the opportunity of investigating interactions occurring in solution (thus avoiding problems due to closeby surfaces as in other single molecule methods), controlling the DNA extension and tracking interaction dynamics as a function of both mechanical parameters and DNA sequence. The methods for establishing successful optical trapping and nanometer localization of single molecules are illustrated. We illustrate the experimental conditions allowing the study of interaction of lactose repressor (lacI), labeled with Atto532, with a DNA molecule containing specific target sequences (operators) for LacI binding. The method allows the observation of specific interactions at the operators, as well as one-dimensional diffusion of the protein during the process of target search. The method is broadly applicable to the study of protein-DNA interactions but also to molecular motors, where control of the tension applied to the partner track polymer (for example actin or microtubules) is desirable.

Here we describe the instrumentation and methods for detecting single fluorescently-labeled protein molecules interacting with a single DNA molecule suspended between two optically trapped microspheres.

Protein-DNA Etkileşiminin Çalışmaları Tek molekül Manipülasyon ve Görüntüleme birleştiren

The paper describes the combination of optical tweezers and single molecule fluorescence detection for the study of protein-DNA interaction. The method ...

FRET Imaging in Three-dimensional Hydrogels

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly employ two-dimensional (2D) culture, which does not mimic the three-dimensional (3D) cellular microenvironment. A method to perform quenched emission FRET imaging using conventional widefield epifluorescence microscopy of cells within a 3D hydrogel environment is presented. Here an analysis method for ratiometric FRET probes that yields linear ratios over the probe activation range is described. Measurement of intracellular cyclic adenosine monophosphate (cAMP) levels is demonstrated in chondrocytes under forskolin stimulation using a probe for EPAC1 activation (ICUE1) and the ability to detect differences in cAMP signaling dependent on hydrogel material type, herein a photocrosslinking hydrogel (PC-gel, polyethylene glycol dimethacrylate) and a thermoresponsive hydrogel (TR-gel). Compared with 2D FRET methods, this method requires little additional work. Laboratories already utilizing FRET imaging in 2D can easily adopt this method to perform cellular studies in a 3D microenvironment. It can further be applied to high throughput drug screening in engineered 3D microtissues. Additionally, it is compatible with other forms of FRET imaging, such as anisotropy measurement and fluorescence lifetime imaging (FLIM), and with advanced microscopy platforms using confocal, pulsed, or modulated illumination.

F&#246;rster resonance energy transfer (FRET) imaging is a powerful tool for real-time cell biology studies. Here a method for FRET imaging cells in physiologic three-dimensional (3D) hydrogel microenvironments using conventional epifluorescence microscopy is presented. An analysis for ratiometric FRET probes that yields linear ratios over the activation range is described.

Üç boyutlu Hidrojeller içinde Görüntüleme FRET

Imaging of F&#246;rster resonance energy transfer (FRET)&#160;is a powerful tool for examining cell biology in real-time. Studies utilizing FRET commonly ...