Biz Monash Larkins Programı yanı sıra NHMRC CDF ve NHMRC proje hibe mali destek kabul etmek istiyorum. Ayrıca, videoyu üreten onların yardım için onun desteği ve (özellikle Adam Dinsdale olarak) Monash Flowcore takım için, onun yapıcı önerileriniz için Edwina McGlinn Sue Mei Lim teşekkür etmek istiyorum.

1. Gösterge Ayarlar / Reaktif Hazırlama / Genotiplendirme <ol><li> IPS hücresi ortamı hazırlayın: 5 mi, esansiyel olmayan amino asitler, 500 ul β-merkaptoetanol, 75 ml cenin sığır serumu (FBS), 5 ml L-glutamin ile, 5 x 10 5 adet Lösemi önleyici faktörü 500 mi Nakavt DMEM ortamı Supplement ( LIF). Bu yazının bağlamında kullanılan reaktif için ürün ve satın alma bilgileri için Malzemeler Listesi&#39;nde bakınız. </li><li> MEF ortamı hazırlayın: 50 mi FBS, 5 ml L-glutamin, 5 mi, esansiyel olmayan amino asitler, sodyum piruvat 5 mi, 500 ul β-merkaptoetanol, 500 ml DMEM ortamı Ek. </li><li> , 10 ml DMSO içinde 1 ml FBS 9 ml bir araya getirilir: orta dondurma hazırlayın. </li><li> Hazırlama Jelatin yemekler hemen kullanımdan önce en az 10 dakika ve oda sıcaklığında aspiratı, T75 şişeye 3-5 mi% 0.1 domuz jelatin solüsyonu eklenir inkübe kaplanmıştır. </li><li> , 10 ml FBS, 0.1 ml PBS içinde 9.9 ml bir araya getirilir: FACS etiketleme ortamı hazırlayın. </li><li> GerçekleştirinRosa26 m2rtTA lokusu için genotipleme PCR: üreticinin talimatlarına uygun olarak, Taq DNA polimeraz ile reaksiyonları gerçekleştirmek. Kullanın MgCl2 3.5 mM ve aşağıdaki 3 Primerlerin -concentration güncellendi: oIMR8052: 5 &#39;JGK AAG AGT TTG TTK TCA ACC 3&#39;, oIMR8545: 5&#39;AAA GTC GTT CTG AGT TGT TAT 3 &#39;, oIMR8546: 5&#39; GGA JGK GGA GAA ATG GAT ATG 3 &#39;. Döngü koşulları: 3 dakika boyunca 94 ° ° C; (30 saniye için 94 ° C, 1 dakika için 65 ° C, 1 dakika için 72 ° C) 35 döngü; 2 dakika boyunca 72 ° ° C; 12 ° C&#39;de tutun. Beklenen ürün boyutu: vahşi tür alel için 650 bp ve mutant alel için 340 bp&#39;lik. </li><li> Kolajen StemCa / OKSM lokusu için genotipleme PCR yapın: talimatlarına uygun olarak, Taq DNA polimeraz ile reaksiyonları gerçekleştirmek. Bu işlemde bir MgCI2 2.5 mM, ve takip eden 3 primerlerin -concentration tadil edilmiş: Col / FRT B: 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, sütun / frtA1: 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, sütun / frtC1: 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. Döngü koşulları: 1 dakika boyunca 95 ° C (30 saniye için 94 ° C, 45 sn için 70 ° C) 2 devir, 6 çevrim (30 saniye için 94 ° C, 45 sn için 68 ° C) ve 30 devirden (20 saniye boyunca 94 ° C, 1 dakika için 60 ° C); 5 dakika boyunca 72 ° ° C; 12 ° C&#39;de tutun. Beklenen ürün boyutu: vahşi tip alel için 331 bp ve mutant alel için 551 bp. </li><li> 4 ° C&#39;de 3 dakika boyunca 400 x g&#39;de santrifüj tüm işlemleri yapınız. </li></ol> Fare Embriyonik Fibroblastlarına 2. Nesil <ol><li> M2rtTA soyunun karşı cinse bir üyesi ile OKSM soyunun bir hayvan arasında bir zaman ayarlı çiftleşme gerçekleştirin. Anne itlaf ve uterin boynuz çıkararak embriyonik gün 13.5 de Hasat embriyolar. Önceki uterin boynuz çıkarılması için, mikrobiyal kontaminasyonu önlemek için,% 80 etanol çözeltisi ile karın bölgesini sprey. </li><li> (Steril fosfat tamponlu tuzlu çözeltisi, 10 ml içeren 10 cm&#39;lik bir doku kültürü kabı içine PB uterin boynuzu aktarınS). (B Şekil 3A) bir embriyo içeren parçalar halinde uterus boynuzu kesmek için steril cerrahi sınıf makas kullanın. </li><li> Dikkatli rahim zarfı ve her embriyoyu çevreleyen ekstra embriyonik membranlar kaldırmak için diseksiyon (ideal bir doku kültürü kaputu içinde yer) mikroskop ve sterilize forseps kullanın. 10 ml PBS ile ayrı bir 10 cm&#39;lik bir tabak için her embriyo transferi. </li><li> Embriyonun başını, bacaklarını, kuyruk ve forseps ile iç organları (kalp, karaciğer, bağırsak vb) sökerek devam edin (Şekil 3C). 1.5 ml tüp içine embriyonun başını aktarmak ve gerekirse genotiplemeye kullanılabilecek şekilde aşağı dondurma. </li><li> Boş bir 10cm tabak içine embriyonun gövde aktarın ve 2 dakika boyunca embriyo kıymaya iki cerrahi bıçakları kullanın. Kıyılmış embriyonun üst tripsin / EDTA çözeltisi 200 ul ilave edin ve oda sıcaklığında 3-5 dakika inkübe edilir. , Ek bir 2 dakika daha devam kıyma olarak MEF ortam 2 ml ilave<html> Tripsin, etkinleştirme ve 15 ml&#39;lik bir tüp içine aktarılır. </li><li> Ayrıca mekanik nazik pipetleme doku ayırmak 1.000 ul pipet kullanın. Jelatin kaplı 10 cm tabağına aktarın ve MEF ortam ek olarak 10 ilave edin. Her iki normoksik ve hipoksik kuluçka kültürü için kullanılabilecek daha fazla bilgi için tartışmaya bakınız: edin. </li><li> 24-48 saat sonra plaka yoğun MEF&#39;ler ile kaplanmış olmalıdır. </li><li> Alternatif olarak, hücreler daha sonra yayılır veya aşağı dondurulabilir. Hücrelerin dondurulması, kültür ortamı çıkartın PBS 3 ml Tripsin / EDTA çözeltisi ile medya ve bindirmenin izlerini kaldırmak için mi, 10 ile çanak durulayın. , 37 ° C&#39;de 3-5 dakika boyunca inkübe 15 ml&#39;lik bir santrifüj tüpüne MEF ortam ve transfer 5 ml tripsin ilave edilerek sindirim etkisiz hale getirirler. Spin ve dondurma medya 3 ml pelletini. 3 cryovials aktarın ve bir hücre dondurma kap aşağı dondurma. </li></ol> MEF&#39;lerin 3. yeniden programlanması &quot;ove_content&gt; Not: Pelet, 4 ° C&#39;de 5 dakika boyunca 200 x g&#39;de santrifüj ile hücreler ve tekrar programlanması için bir doku kültürü kuluçka normoksik kullanımı Bu türetme ve hipoksik koşullar altında (% 5 oksijen altında MEFS genişletmek, daha fazla bilgi için bakınız tartışma için yararlı olabilir. ). <ol><li> Hızlı bir su banyosuna (37 ° C) düşük bir geçiş meydana gelmekteydi (P0-P1, 2-3 Milyon hücre) çözülmesi ve önceden ısıtılmış MEF ortam, 10 ml bir tüp içine aktarılmaktadır. Pelet hücreleri, 12 ml taze MEF medyada tekrar süspansiyon, bir jelatin kaplı T75 kültür kabına aktarın ve hücreler devam etmeden önce 24-48 saat boyunca kurtarmak için izin. Not: MEF&#39;ler de doğrudan türetme sonra kullanılabilir. </li><li> Kültür ortamının çıkarılmasının ardından, bir tripsin / EDTA solüsyonu (37 ° C&#39;de 3-5 dakika boyunca 3 mi) üzerine yerleştirilmesi ile, PBS ile hücreselleştirilmesi MEFS yıkayın. MEF medya 5 ml ekleyerek tripsin söndürün ve ayrıca 10 ml pipet ile Hafifkarıştırmayı tarafından hücreleri ayırmak. Hemasitometre kullanarak hücre sayıları belirleyin. </li><li> Reprogra içinfeatures deneyler, 6.7 x 10 3 hücre / cm 2 yoğunluklarda jelatin kaplı T75 balonlarına üzerine tohum MEF&#39;ler (~ kap başına 0,5 Milyon hücre) 2 ug / ml ihtiva eden doksisiklin iPSC ortam içerisinde gerçekleştirilmektedir. Her bir zaman noktası için yaklaşık 2 Mio yeniden programlama ara maddelerini elde etmek için, Tablo 1 ile ilgili olarak tohumlama öneriler bakınız. Not: yeniden programlanması doksisiklin (2 ug / ml) eklenmesi ile başlar ortamı desteklenmiş </li><li> Ilk 6 gün ortamı yerine taze doksisiklin ile her gün iPSC ortam (T75 şişesi başına ortam 12 ml) desteklenmiştir. Yüksek hücre sayıları varsa, bu noktadan sonra bir günlük bazda medya yenilemek. Medya değişiklikleri sadece alternatif her gün yapılabilir eğer kültür hacmini iki katına. </li><li> Gerekli zaman noktalarında Hasat yeniden programlama ara maddeler: Bir (3 ml PBS, uygun hacimde (T75 şişeye 10 mi) ile durulanır ve Tripsin-EDTA çözeltisi ile kaplanacağı, tüm ortam ortadan saldırılarak (öneri Gün 3, 6, 9, 12) T75 şişesi). Inkübe37 ° C&#39;de 3-5 dakika boyunca ve yumuşak pipetleme ardından iPSC ortam 5 ml ilave etmek suretiyle söndürün. </li><li> , Santrifüj ile hücrenin bir hemositometre ile süspansiyon (yukarıya bakınız), topak sayısı tripsin kalıntılarını gidermek için, 10 ml PBS içinde tekrar süspansiyon hücreleri ve süpernatan aspire. , Bir kez daha Pelet hücreleri aspire yüzenler ve yeniden programlama ara maddeleri izole etmek adıma 4.1 ile devam edin. Not: yeniden programlama geçiren hücreler dondurulmuş ve bir sonraki aşamada FACS izolasyonu için çözülmüş olabilir. </li><li> Tam olarak yeniden programlanabilir iPS kültürleri oluşturmak için, ilave bir 4-7 gün boyunca serbest doks-iPSC ortam içinde hücreler büyür. Not: Başarıyla yeniden programlanması kültürler gün 12 kolonilerin çok sayıda içerecektir (bakınız Şekil 4). Bu süre boyunca, hala OKSM ifadesini gerektiren anormal iPS hücreleri kaybolur. </li><li> , Başlangıçta 15 cm x 10 3 hücre / cm 2 yoğunluğunda radyasyona tabi tutulmuş tohum MEFS: Alternatif olarak, geri kalan tam yeniden programlanması iPS kültürleri yayılmasına </s&gt; kadar T75 kaplanmış bir jelatin üzerine iPSC ortam 12 ml bir gün önce deneyler için ya da 6 saat şişeye. </li><li> Daha sonra, Tripsin-EDTA solüsyonu, 3 ml ile uzanır ve 37 ° C&#39;de 3-5 dakika boyunca kuluçkalanması, 10 ml PBS ile T75 balon durulama tüm ortam ortadan saldırılarak hücreselleştirilmesi iPS hücresi kültürleri. , Hafifçe karıştırılarak, ardından iPSC ortam 5 ml ilave etmek suretiyle, tripsin söndürün 15 ml konik tüp transferi, durması ve daha sonra 10 ml iPS ortam içinde yeniden süspansiyon haline getirildi. </li><li> Işınlanmış MEF&#39;ler (T75 şişesi) üzerine bu hücre süspansiyonu 500 ul aktarın ve kültürler için 4-5 gün büyümeye olanak sağlar. Not: Kurulmuş iPS kültürler Kriyoprezerve veya deneyleri için kullanılan olabilir. Klonal hücre soyları bir mikroskop altında ayrı ayrı 22 koloni iPSC çekme ile elde edilebilir. </li><li> MEF&#39;ler için 2.8 açıklandığı gibi Cryo konfluen iPSC kültürleri korumak. </li></ol> 4. Antikor etiketleme <ol><li> Içinde, Bölüm 3 hazırlandığı gibi yeniden programlama kültürlerin süspanse hücre pelletleri,Antikorları ile takviye edilmiş FACS etiketleme medya (1, anti-Thy-1.2 pasifik mavi: 400, anti-SSEA-1 biotin 1: 400 ve anti-EpCAM Fitc 1: 400). 5.000.000 hücre başına takviye işaretleme karışımı 200 ul kullanın ve buz üzerinde inkübe edilir. </li><li> 10 dakika sonra yavaşça buz üzerinde bir 10 dakika daha tekrar süspansiyon hücreleri inkübe etmek ve tüp dokunun. Tüp başına soğuk PBS 10 ml ekleyin ve aşağı doğru döndürün. </li><li> 5.000.000 hücre başına: her bir tüp için (200 1) 1 ul streptavidin-PeCy7 ile takviye edilmiş ortam etiketleme 200 ul hazırlama lekelenmesine. Hücreler pelet sonra, dikkatli bir şekilde Streptavidin PeCy7 ile takviye edilmiş ortam etiketleme uygun bir hacminde tekrar süspansiyon ve süpernatan aspire. </li><li> , Tekrar süspansiyon buz üzerinde bir 10 dakika bekletilir, tüp başına soğuk PBS 10 ml ekleyin, aşağı spin ve aspire süpernatant için dokunun, 10 dakika boyunca buz üzerinde hücreleri tutun. </li><li> Etiketleme ortam içinde yeniden süspanse hücre topakları, yaklaşık 1 x 10 7 hücre / ml &#39;de propidyum iyodür (PI) (2 ug / ml) ile desteklenmiş. 70 mikron süzgeç vasıtasıyla süspansiyonu geçerek hücre kümeleri çıkarın. Uygun bir FACS tüpü hücreleri aktarın ve buz üzerinde saklayın. </li><li> Bireysel antikorlar ile ayrı örnek hazırlayın (anti-Thy-1.2, anti-SSEA-1 ve anti-EpCAM). NOT: Bu analizde kullanılan üç kanal renk telafisini gerçekleştirmek için gereklidir. Ayrıca, etiketsiz hücreleri sıralamak için gerilimleri ve kapıları ayarlamak için gereklidir. İdeal iPS hücreleri kompanzasyonu için kullanılır: ışınlanmış MEF&#39;ler tutulan 0.5-1 x 10 6 iPS hücrelerinin stoklar sıvı nitrojende cryovials depolanır. MEF&#39;ler varlığı Thy-1.2 kanal sinyali elde etmek için gereklidir. </li><li> MEF&#39;ler (bölüm 3) için tarif edildiği gibi iPS hücrelerinin kriyotüpe çözülme. Santrifüj sonrasında, etiketleme tampon 800 ul ve bu örnek 200 ul süspansiyon hücreleri etiketsiz kontrol olarak kenara ayarlanır. </li><li> Tazminat kontrol olarak kalan hücreleri kullanın. Üç adet 15 ml tüpler ve ek antikorlar arasında bölünür hücrelerininPacific Blue kompanzasyon kontrolü: Anti-Thy-1.2 Pacific Blue antikor 0.5 ul ekleyin, aşağıdaki gibi. Fitc dengeleme borusu: anti-EpCAM-FITC antikoru 0.5 ul ekle. Pe-Cy7 kompanzasyon kontrolü: Anti SSEA-1-Biyotin antikor 0.5 ul. </li><li> , 10 dakika boyunca buz üzerinde hücreye antikor örnekleri tutmak dokunarak karıştırılması ve buz üzerinde 10 dakika inkübe edilir. </li><li> 10 ml soğuk PBS ile yıkayın örnekleri, bağlanmamış antikor çıkarmak aşağı hücreleri spin ve süpernatant aspire. FACS etiketleme ortam 200 ul hücre topakları yeniden süspanse. </li><li> Anti-SSEA-1-Biyotin etiketli örnekler, bir streptavidin-PeCy7 konjugatı (200 ul hücre başına 1 ul). Etiket hücreleri birincil antikor (SSEA-1-biotin) için tarif edildiği. </li><li> 70 mikron süzgecinden etiketsiz kontrol de dahil olmak üzere, tüm örnekler geçmek ve PI (2 ug / ml) ilave edilmektedir. FACS tüpler hücreleri aktarın ve gereken kadar buz üzerinde tutmak. </li></ol> Ara maddelerin 5. FACS izolasyonu Not:Hücreler 405 nm, 488 nm ve 560 nm eksitasyon ve lazerler 100 um ağızlık ile bir floresan faaliyete geçen gen sıralayıcı kullanılarak sıralanır. <ol><li> Hücre popülasyonu düzgün görüntülenmiştir böylece ileri ve yan dağılım için ayarlama gerilimleri. Enkaz dışlamak Şekil 5A belirtildiği gibi hücrelerin etrafında bir kapı çizin. Not: hücre sıralayıcı gerilimlerin doğru kurmak karmaşık olabilir ve deneyimli bir FACS operatörü gerektirir. </li><li> FSC alanına karşılık Kullanımı İleri saçılım (FSC) yüksekliği agrega (Şekil 5B) dışlamak için. </li><li> PI negatif canlı hücreleri (Şekil 5C) üzerinde kapısı FSC karşı PI kanalı gözünüzde canlandırın. </li><li> PB, FITC / GFP, Pe-Cy7, flüoresan kanalları için gerilimleri ayarlamak için, etiketlenmemiş hücreleri kullanır. İdeal olarak ilgili kanala alt ucunda hücre popülasyonu yerleştirin. </li><li> Alt fraksiyon yeniden programlama kült Şekil 6A, B&#39;de gösterildiği gibi etiketsiz kontrol hücreleri ile kapı ayarlama3. gün, 6 içine ures ve 9 popülasyonlar: SSEA-1 / Thy-1.2 + hücreler; SSEA-1 / Thy-1.2 ila hücreleri; ve yeniden programlama SSEA-1 + /-Thy 1.2 ila hücreler aracılık etmektedir. </li><li> Ayrıca Gün 9 SSEA-1 subdivide + / Thy-1.2- fraksiyon Fitc beneği karşı Pe-Cy7 kullanarak; Sse-a1 + / EpCAM + hücreleri ve SSEA-1 + / Epcam- hücrelerinin etrafında kapıları çizin. Şekil 6C&#39;de, D&#39;de gösterildiği gibi, etiketlenmemiş kontrol hücreleri ile kapıları ayarlayın. </li><li> İstenilen subpopülasyonunun (MEF&#39;ler temsilcisi FACS profilleri, 3. Gün / Gün 6 / Gün 9 / Gün 12 kültürler ve iPS hücreleri için bakınız Şekil 7) sıralamadan önce iPS hücre medya (1-2 ml) ile uygun toplama tüpleri önceden doldur. </li><li> FACS sıralama protokolü üretmektedir göre gerçekleştirin. </li><li> FACS izole edildikten sonra moleküler profilleme (RNA / protein çıkarılması, kromatin immunoprecipitation, DNA methylome analizi vb) hücreleri gönderin. Alternatif olarak, çeşitli hücre fraksiyonları kültürlenebilir. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Başarıyla iPS hücrelerinin içine MEFS yeniden programlamak ve yüksek miktarda at yeniden programlama ara maddeleri saflaştırmak için bu genel verimliliği üzerinde bir etkiye sahip faktörlerin farkında olmak önemlidir. Özellikle FBS toplu zararlı bir etkiye sahip olabilir iPS ortam olarak desteklenmesi için kullanılır. Genel olumlu deneyimleri Embriyonik kök (ES) hücre nitelikli FBS ama ucuz bir alternatif tanımlamak olabilir satıcılarının çeşitli serumların toplu test ile yapıldı. Yeniden programlama verimliliği etkiler MEF&#39;ler 15,20 genotip bir başka faktör. OKSM ve yeniden programlayın yok m2rtTA odağı homozygousity birinde veya daha yüksek yeniden programlama verimliliği hem loci sonuçları için farenin heterozigot (het) türetilen MEF&#39;ler rağmen. Het / het &lt;homo / het &lt;het / homo &lt;homo /: Gerçekten, OKSM ve m2rtTA haçlar yavruların türetilen MEF&#39;ler aşağıdaki sırayla (OKSM / m2rtTA) olarak yeniden programlama verimlilik artışını göstermektedirhomo (Tablo 1&#39;de verilen rakamlar het / het hayvanlar için olduğunu unutmayın). Bir erkek homo / homo hayvan tanımlanan nadir vesilesiyle, birden m2rtTA kadın ile çiftleşme harem kurulabilir. Bu haçlar tüm yavrular sırasıyla OKSM / m2rtTA lokuslarına / homo het edilecektir. Yetiştiriciliği için küçük fareler (6-15 haftalık) kullanıldığında büyük yavrular elde edilir Buna ek olarak, litre hızla genotipleme tavsiye edilir. Ayrıca, yeniden programlama için düşük geçit MEF&#39;lerin kullanımı 23 vurgulandı. MEF&#39;ler bir Normoksik doku kültürü inkübatör türetilmiştir ve genişletilmiş olsaydı şiddetle sadece Ancak geçişi 2. bu hücrelerin kullanmanızı öneririz, deneyci MEF&#39;lerin türetme ve genişleme için bir düşük oksijen inkübatör erişimi (% 5 oksijen) varsa, hala iyi sonuçlar 23 verecek 3 gibi yüksek bir pasaj numaraları. Durumda, deneyci yeniden programlamayla ilişkili sorunlarla karşılaştığında,<html> belirtildiği gibi, en olası açıklama doks Ayrıca, yanlış farelerin genotip veya iPS hücresi üretimi için elverişli değildir FBS, kullanım sırasında yüksek geçit sayılardır. Ancak, nadir durumlarda biz MEF&#39;ler ideal şartlarda bile yeniden programlamak mümkün olmadığını gözlemledik. Bu durumlarda m2rtTA açık okuma çerçevesi içinde spontan olarak de novo silme en önemli nedeni olarak tanımlanmıştır. Bu metodoloji başarıyla manyetik hücre izolasyonu (MACS) üzerinden SSEA-1 + arabileşikleri ayıklamak için uyarlanmıştır. MACS kullanarak, belli bir zaman bir avantaj vardır, ancak, SSEA-1 + hücre toplumların saflık hücreleri oluşturabilecek yönlendirilmiş Deneyin tipine bağlı olarak yaklaşık% 80-90, daha çok% 95 den fazla, indirgenir bir sorun. Bu durumda, bir seçenek SSEA-1 + / + ve EpCAM SSEA-1 + / Epcam- hücrelerine saflığı ve / veya parçası bunları artırmak için FACS ile ve ardından SSEA-1 + hücreleri zenginleştirmek için MACS kullanmaktır. Belirtilen protokol ve fare modelinden elde edilen iPS hücreleri olduğu ve etkili bir şekilde, pluripotent kimerik hayvanların tüm dokularına 15,20 katkıda gösterilmiş olmasına rağmen &quot;&gt; tamamen tetraploit olarak tamamlanması yoluyla bu iPS hücrelerinin oluşan embriyolar üretme yönünde azaltılmış kapasite olmuştur 24 gösterdi. Dlk-Dio3 gen kümesinin bir metilasyon modelleri, altta yatan neden 24 olarak tespit edilmiştir. Bununla birlikte, yeniden programlama sırasında ortama 50 ug / ml &#39;lik bir konsantrasyonda, bir askorbik asit ilaveli tetraploit tamamlama yetkili iPS hücrelerini 24 üretecektir. Alternatif bir yeniden programlanabilir fare modeli, daha da askorbik asit tedavisinin 25 yokluğunda, tetraploid yetkili iPS hücrelerini üreten bir farklı bir stoikiometride yeniden programlama faktörleri ifade etmek için kullanılabilir olduğunu hatırlatırız. Ancak, eller hücrelerindeki en önemli ölçüde daha düşük bir frekans göre bu soy reprogram ikinci Burada kullanılan fare modul. Bu yazıda anlatılan metodoloji, nüfusun refrakter dökme gelen yeniden programlama ara ayrılmasını sağlar ve örneğin incelemek ve profil için bir fraksiyone nüfusu kullanmak zorunda eski sınırlamaları kaldırarak, yeniden programlama sürecini anlamak için değerli bir araç (olarak görülmelidir refrakter hücrelerden yüksek sinyal gürültü). Burada tarif edilen antikor kombinasyonu, ancak bu ek-hücresi yüzey işaretleyicileri daha yüksek bir saflıkta elde edilmesine olanak sağlamaktadır ara maddeleri gelecekte ortaya çıkarılan edilmesi mümkündür, yüksek saflıkta fare hücrelerinden elde ara ürünlerin izolasyonunu sağlar. SSEA-1 ifade insan uyarılmış pluripotent kök hücrelerin bir özelliğidir değildir ve bu bu protokolü olarak insan kaynaklı hücreler yeniden programlanması hakkında kullanılamaz unutmayın. Sonuç olarak, bir kere bu anlatılan yöntemle izole yeniden programlama ara-sentezleme profilin&#39;e dahil olmak üzere moleküler analiz için kullanılabilirg, kromatin immünopresipitasyon, methylome analizi ve protein denemeleri.

Embriyonik kök (ES) hücreleri üretilmiş blastosit evresinde canlı embriyo 1 iç hücre kütlesinden türetilmiştir. Uygun kültür koşulları altında onlar kendi kendilerini yenilerler ve pluripotent kalır. 2006 yılında Yamanaka, ve arkadaşları, olgun hücreler transkripsiyon zorunlu sentezlenmesiyle sözde uyarılmış pluripotent kök (IPS) hücrelere faktörleri yeniden olabilir göstermiştir Ekim-4, Klf-4, Sox-2, c-Myc (OKSM) 2&#39;dir. iPS hücreleri, ES hücreleri gibi, vücudun tüm hücre tiplerinde ortaya çıkmasına neden olabilir, ancak, ES hücreleri 3 üretilmesini çevreleyen etik sınırlamalarından muaftır. Ayrıca, iPS hücreleri kişiselleştirilmiş rejeneratif tıp sözünü taşımak ve 4,5 eleme hastalık modelleme gibi uygulamalar ve in vitro ilaç muazzam bir potansiyele sahip. Bu potansiyeli gerçekleştirmek için teknolojiyi yeniden programlanması için sırayla, nükleer yeniden programlama temel mekanizması tam anlaşılması gerekir. Ancak çabaları yeniden programlama pat incelemek içinHway hücrelerin sadece çok küçük bir sayı (% 0.1-1) reprogram gerçeği ile engellenmiştir. Başarıyla yeniden programlanması fibroblastlar yeniden programlanması, nüve Pluripotency ağının 11-14 aktivasyon son aşamalarında bir epitel geçiş 6-10 mezenkimal ve dahil olayların farklı bir dizi geçmesi bildirilmiştir. Bu ve diğer 12,13,15-17 son ısıya dayanıklı kütle popülasyonundan nadir ara maddelerin ayrılması için izin veren hücre yüzeyi markerlerinin bir dizi tanımlanmıştır. Reprogramming fare embriyonik fibroblastlar (MEFS) 2 hafta süren yeniden programlama işlemi 15 sırasında Thy-1.2, Ssea1 ve (diğerleri arasında) EpCAM ifadesinde değişikliklere uğrarlar. Erken MEF&#39;lerin bir alt kümesini yeniden programlanması sırasında fibroblast kimlik belirteci (Thy-1.2) ifadesini aşağı-regüle ve ardından Pluripotency ilişkili işaretleyici SSEA-1 12 sağmaya başlamak. Yeniden programlama Ssea1-pozitif hücrelerin son aşamalarında ReactivBöyle Ekim-4 10-13,15 gibi endojen Pluripotency genleri yedik. Bu en son geçiş tespit EpCAM ekspresyonu (Şekil 1 e bakınız) ya da daha sonraki bir aşamada PECAM 15 ile hücre yüzeyi üzerinde işaretlenir. Son zamanlarda, O&#39;Malley ve diğ. Yeniden programlama ara maddelerinin tanımlanması için Thy-1.2 ve SSEA-1 alternatif veya tamamlayıcı olarak, CD44 ve ICAM-1 kullanımını bildirmiştir. Daha önce, FACS, bu hücre yüzey belirteçleri 15,18 göre Gün 0, Gün 3, 6. günde, 9. Gün ve 12. Gün yeniden programlama kültürlerinden yeniden programlama ara maddeleri, hem de ikinci oluşturulan iPS hücre hatları ekstre var. , Aşağıda tarif edilen yeniden programlama sistemi ve koşullar için biz homojen popülasyonları sessiz olmasına karşın, tespit ara popülasyonlarında heterojenite belirli bir ölçüde olduğu tek hücre düzeyinde göstermiştir. Bu nüfus içindeki hücrelerin yalnızca bir alt kümesini ilgili bir sonraki sta ilerleme mümkün olduğu unutulmamalıdıryeniden programlama işleminin ge ve daha önceden geniş ölçüde karakterize edilmiştir 15,19 farklı verim, en iPS hücresi koloniler meydana getirirler. Ayrıca, bu popülasyonlarının yeniden programlama verimliliği yeniden tabaklama ve kültür koşullarına da bağlıdır. Deney tekrar elde edilebilirliğini arttırmak için, biz Rosa26 lokusunun bir kontrol ve doksisiklin tepkimeli yükseltici 20,21 kontrolü altında bir polisistronik OKSM kaset altında bir transkripsiyon transaktivatörü (m2rtTA) ifade etmek için genetik olarak düzenlenmiş bir yeniden programlanabilir fare soyunu kullanmak. Bu fare modeli kullanarak iPS hücresi üretimi, örneğin, sayı ve viral entegrasyon sitelerinden insertlerin konumu değişkenlik hücre için hücre ile heterojen bir başlangıç ​​popülasyonunun geleneksel viral yöntemleri istenmeyen yan etkileri aşılmaktadır. İki transjenik fare soyu (OKSM, m2rtTA), Jackson Laboratory yerinde homozigus Kurucu hayvanların olarak bulunabilirlik, reprogra kurmak için çaprazlanabilir zorundammable fare modeli (bakınız Şekil 2). Bu yazıda, MEFS türetmek iPS hücrelerini oluşturmak ve FACS dönüşüm sürecinin çeşitli aşamalarında yeniden programlama ara maddeleri izole etmek nasıl ayrıntılı olarak açıklar.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

E13.5 fare embriyo diseksiyonu, ayrıştırma ve sonra kaplama, 10 cm çanak yaklaşık olarak 1 ila 2 gün içinde confluency ulaşması bekleniyor. Kültür uygun cellularized edilmemiş dokusunun bir kısmı yapışkan parçalarını almak için bu aşamada, normaldir. Bu pasaj sonra kaybolur. Doksisiklin indüksiyon üzerine, yeniden programlanması MEF&#39;ler farklı morfolojik değişikliklere uğrarlar. Yaklaşık 6 gün, erken koloni gibi yamalar (Şekil 4C) ortaya başlamalıdır. Bu kültürde daha sonra boyutu büyümeye devam edecektir (Şekil 4D, E). İyi bir yeniden programlama deneyi ilk olarak 5 x 10 5 hücre (Şekil 4E) ile tohumlanmış ve T75 500&gt; &#39;de koloniler sonuçlanmalıdır. Oluşturulan iPS kültürler karakteristik kubbe şeklindeki sömürgelere sahip ve çoğunlukla farklılaşmış hücreleri (Şekil 4F) yoksun olmalıdır. IPS kültürlerdeki Buldukça, ek PasajlanmasıRes farklılaşmamış / kısmi olarak yeniden programlanması hücreleri çıkarmak için gerekli olabilir; hücrelerinin konfluent şişe ışınlanmış MEF&#39;ler bir besleyici tabaka üzerine 1:10 oranında ayrılabilir. Yukarıda zikredildiği gibi, yeniden programlama esnasında morfolojik ve moleküler değişikliklere Thy-1.2, SSEA-1 ve sonuçta EpCAM (Şekil 7A-F) için FACS profillerinde değişiklikler yansıtılmaktadır. MEF&#39;ler Thy-1.2 için ağırlıklı olarak pozitif ve diğer belirteçleri negatif ise, daha önce 12,15 bildirdiği gibi, 3. Gün kültürler zaten oldukça farklı görünüyor. Hücrelerin büyük bir bölümü Thy-1.2 sentezlenmesini ve bu Thy-1.2 negatif hücrelerinin çok küçük bir alt kümesini SSEA-1, bir zaman noktası için ara gerçek tekrar programlanması için pozitif olmuştur aşağı regüle başlamıştır. Gün 3 kültürleri elde edilebilir yeniden programlama ara-sayısı yüzdesi olarak çok değişken olan SSEA-1 + /-Thy 1.2 ila süresi viabl 1-10% arasında bir aralık içinde yer alırE hücreleri. 6 ve 9 gün SSEA-1 + hücrelerinin artan oranı üzerinde, genellikle de% 10&#39;un üzerinde, tespit edilebilir. 12. günde de EpCAM pozitif tespit edilebilir etiket SSEA-1 pozitif hücrelerinin bir alt civarında. Değişkendir ve genellikle tüm canlı hücrelerin sadece% 2-4 aralığında bulunan SSEA-1.2 + / + hücrelerinin EpCAM yüzdesi olarak 12 gün kültür, 3 gün kültürler gibi, ara bağların arıtılmasına bir darboğaz temsil eder. Tablo 1&#39;de sunulmuştur yeniden programlama ara beklenen sayısı sadece kaba bir yaklaşım olarak hizmet vermektedir. Kurulmuş niyetli iPS hücre kültürleri SSEA-1 ve EpCAM için güçlü pozitif olacaktır. <img alt="Şekil 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> Yeniden programlama yolunun sırasında Şekil 1. Yüzey işaret değişikliği: fibroblast kimlik belirteç Thy-1.2 Aşağı düzenleme up-regülasyonu ile takipSSEA-1. Pluripotent devlete karşı SSEA-1 pozitif hücrelerinin bir alt kümesi geçiş günün 12 civarında EpCAM iktisap ile gösterilir. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">, bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> Şekil 2. yeniden programlanabilir fare modelinin şematik gösterimi:. M2rtTA ifade her yerde bulunan bir aktif Rosa26 mahalinin kontrolü altında olduğu doksisiklin varlığında (doks) m2rtTA proteini Kolajen 1a1 bir tetrasiklin bağımlı promoteri (TetOp) bağlanmaktadır (COL1A1) Dört faktörlü kasetinin ekspresyonu ile sonuçlanan eğrisi. İki bisistronik kasetleri, bir iç ribozom giriş alanı (IRES) ile bağlantılıdır. Ekim-4 / Klf-4 ve SOx-2 / c-Myc için açık okuma çerçevesi vardır Fu<html> kendi kapanan F2A ve E2A dizileri ile sed, sırasıyla. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> Şekil 3. Embriyo diseksiyon: 10 ml PBS ve (B) ile dolu bir 10 cm&#39;lik bir tabak içerisine (A) &#39;Aktarım uterin boynuzu bir embriyoyu içeren parçalar halinde kesilir. (C) forseps ekstra embriyonik dokudan embriyo özgür ve baş, bacak, kuyruk ve iç organları kaldırmak kullanma. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">, bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> les / ftp_upload / 51728 / 51728fig4highres.jpg &quot;width =&quot; 500 &quot;/&gt; Şekil 4 içinde tekrar programlanması morfolojik değişiklikler. Koloni gibi yamalar günden sonra 6&#39;dan kültürlerde anlaşılacaktır. Niyetli iPSCs kubbe şeklindeki morfoloji ile karakterize edilir. (A), 0 / MEF&#39;ler (B) Gün 3, (C), 6. gün, (D), 9 gün, (E) Gün 12, (F), hücre kültürü iPS. Ölçek çubuğu:. 200 mikron <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> Şekil 5. Temel FACS kurulum. (A) Forward Scatter Alan lekesi karşı Side Scatter ile enkaz hariç. (B)İleri Yayılım Yüksek lekesi karşı Forward Scatter Alanlı tek hücre nüfus kapılayarak olmayan enkaz agrega hariç. (C). Blot İleri Yayılım Alanı karşı PI kanalı ile PI düşük olayları kapılayarak tek hücre nüfus ölü hücreleri dışla <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 6," fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> Şekil 6. Yolluk. Thy-1.2 + / SSEA-1 hücreleri, Thy-1.2 ila / SSEA-1 hücreleri ve kapıları ayarlamak etiketsiz kontrol hücreleri kullanılarak (A, B)-Thy 1.2 ila / SSEA-1 + hücreler. (C) EpCAM pozitif ve negatif EpCAM hücreleri için kapıları ayarlamak için etiketsiz kontrol hücreleri kullanın. + /-Thy 1.2 ila hücreleri ayrılabilir SSEA-1 (D) &#39;Pozitif ve negatif EpCAM nüfusun içine EpCAM içine. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">, bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> Şekil 7. Thy-1.2 yeniden programlama işleminin çeşitli aşamalarında SSEA-1, FACS blotlar karşı (A). Gün 0 / MEF&#39;ler (B) Gün 3, (C), 6. gün, (D), 9 gün, (E) Gün 12, (O) iPS hücresi kültürü. Tablo 1. OKSM ve m2rtTA için bir embriyo heterozigus P1 MEF&#39;ler için ekim yoğunluğu, şişeyi numarasını ve beklenen sonuçlarını Önerilen. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">h tıklayınız</a>ere Bu rakamın büyük bir versiyonunu görmek için. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gün </td><td> T75 balonlarına sayısı 0. günde ekildi </td><td> FACS sonra Ssea1 + hücrelerinin sayısı </td><td> FACS sonra Ssea1 + / EpCAM + hücrelerinin sayısı </td></tr><tr><td> 3 </td><td> 8 </td><td> 2.000.000 </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2.000.000 </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2.000.000 </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10 milyon </td><td> 2.000.000 </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Bir programlayabilme Fare Modeli iPS Hücre araürünler Hücre Yüzey Etiket Aracılı Arıtma

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K Görüntüleme.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Video: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Yüksek Aktif Maya Ribozomlar Kromatografik Arıtma

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Biyoloji

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Kinesin İzolasyonu ve Saflaştırılması gelen Drosophila Embriyolar

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

Düşük afiniteli Ekstrasellüler Reseptör-ligand Etkileşimlerinin Ölçeklenebilir Algılama için Avidite tabanlı Ekstrasellüler Etkileşim Gösterimi (AVEXIS)

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

İsteyerek Pluripotent Kök Hücrelerinin Elde Edilen Fare Üretimi

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Glycopeptide Capture for Cell Surface Proteomics

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, differentiation, and proliferation. A comprehensive characterization of these proteins provides rich information for biomarker discovery, cell-type identification, and drug-target selection, as well as helping to advance our understanding of cellular biology and physiology. Surface proteins, however, pose significant analytical challenges, because of their inherently low abundance, high hydrophobicity, and heavy post-translational modifications. Taking advantage of the prevalent glycosylation on surface proteins, we introduce here a high-throughput glycopeptide-capture approach that integrates the advantages of several existing N-glycoproteomics means. Our method can enrich the glycopeptides derived from surface proteins and remove their glycans for facile proteomics using LC-MS. The resolved N-glycoproteome comprises the information of protein identity and quantity as well as their sites of glycosylation. This method has been applied to a series of studies in areas including cancer, stem cells, and drug toxicity. The limitation of the method lies in the low abundance of surface membrane proteins, such that a relatively large quantity of samples is required for this analysis compared to studies centered on cytosolic proteins.

Cell surface proteins are biologically important and widely glycosylated. We introduce here a glycopeptide-capture approach to solubilize, enrich, and deglycosylate these proteins for facile LC-MS based proteomic analyses.

Hücre Yüzey Proteomics için glikopeptiddir Yakalama

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

İnsan iPS Hücreleri MicroRNA İfade Profilleri, iPS Kaynaklanan Retina pigment epiteli ve Fetal Retina pigment epiteli

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

Epizomlar ve HDAC inhibitörleri kullanarak Blood Verimli iPS Hücre Üretimi

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Light Sheet Fluorescence Microscopy of Plant Roots Growing on the Surface of a Gel

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the observation of the whole organ with a high spatial- as well as temporal resolution over prolonged periods of time, which may cause photo-toxic effects. This protocol shows a plant sample preparation method for light-sheet microscopy, which is characterized by mounting the plant vertically on the surface of a gel. The plant is mounted in such a way that the roots are submerged in a liquid medium while the leaves remain in the air. In order to ensure photosynthetic activity of the plant, a custom-made lighting system illuminates the leaves. To keep the roots in darkness the water surface is covered with sheets of black plastic foil. This method allows long-term imaging of plant organ development in standardized conditions.

This protocol shows a plant sample preparation method for light-sheet microscopy. The setup is characterized by mounting the plant vertically on the surface of a gel and letting it grow in controlled bright conditions. This allows long-term observation of plant organ development in standardized conditions.

Bir Gel Yüzeyinde Büyüyen Bitki kökleri Işık Sac Flüoresan Mikroskopi

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

Trans-iç hücre embriyonik kök hücrelerin kitle enjeksiyon daha yüksek Chimerism oranları için yol açar.

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

Fare retina Pigment epiteli birincil hücre kültürleri

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...