Nos gustaría agradecer el apoyo financiero del Programa de Larkins Monash, así como de una CDF NHMRC y una subvención para el proyecto NHMRC. Además, nos gustaría dar las gracias a Sue Lim Mei por sus sugerencias constructivas, Edwina McGlinn por su apoyo y el equipo de Monash Flowcore (en particular, Adam Dinsdale) por su ayuda en la producción del video.

1. Instrument Settings / Preparación de los reactivos / Genotipado <ol><li> Preparar medio de células iPS: Suplemento 500 ml Knockout medio DMEM con suero de 75 ml fetal bovino (FBS), 5 ml de L-glutamina, 5 ml aminoácidos no esenciales, 500 l β-mercaptoetanol, 5 x 10 5 unidades de factor inhibidor de la leucemia ( LIF). Por favor, consulte la Lista de Materiales para el producto e información de compras para los reactivos utilizados en el contexto de este manuscrito. </li><li> Preparar medio MEF: Suplemento de 500 ml DMEM con 50 ml de FBS, 5 ml de L-glutamina, 5 ml Los aminoácidos no esenciales, piruvato de sodio 5 ml, 500 l β-mercaptoetanol. </li><li> Preparar medio de congelación: Por 10 ml, combine 9 ml de FBS con 1 ml de DMSO. </li><li> Preparar platos recubiertos con gelatina, añadir la solución de gelatina porcina 3-5 ml 0,1% a un matraz T75, se incuban a temperatura ambiente durante al menos 10 min y aspirar justo antes de su uso. </li><li> Preparar medio de marcaje FACS: para 10 ml, mezclar 9,9 ml de PBS con 0,1 ml de FBS. </li><li> Realiceuna PCR genotipo para el locus Rosa26 m2rtTA: Realizar reacciones con Taq ADN polimerasa según las instrucciones del fabricante. Use un modificado MgCl2 -concentración de 3,5 mM y las siguientes 3 ​​cebadores: oIMR8052: 5 &#39;GCG AAG AGT TTG TCC TCA ACC 3&#39;, oIMR8545: 5&#39;AAA GTC GCT CTG TGT AGT TAT 3 &#39;, oIMR8546: 5&#39; GGA GCG GGA GAA GAT ATG ATG 3 &#39;. Ciclismo condiciones: 94 ° C durante 3 min; 35 ciclos de (94 ° C durante 30 segundos, 65 ° C durante 1 min, 72 ° C durante 1 min); 72 ° C durante 2 minutos; mantener a 12 ° C. Tamaño del producto esperado: 650 pb para el alelo de tipo salvaje y de 340 pb para el alelo mutante. </li><li> Lleve a cabo una PCR genotipificación para el locus colágeno-StemCa / OKSM: Realizar reacciones con Taq ADN polimerasa según las instrucciones. Use un modificado MgCl2 -concentración de 2,5 mM y las siguientes 3 ​​cebadores: col / frt-B: 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, col / frtA1: 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, col / frtC1: 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. Condiciones de los ciclos: 95 ° C durante 1 min: 2 ciclos de (94 ° C durante 30 segundos, 70 ° C durante 45 s), 6 ciclos de (94 ° C durante 30 segundos, 68 ° C durante 45 segundos) y 30 ciclos de (94 ° C durante 20 seg, 60 ° C durante 1 min); 72 ° C durante 5 minutos; mantener a 12 ° C. Tamaño del producto esperado: 331 pb para el alelo de tipo salvaje y 551 pb para el alelo mutante. </li><li> Llevar a cabo todos los pasos de centrifugación a 400 xg durante 3 min a 4 ° C. </li></ol> 2. Generación de fibroblastos embrionarios de ratón <ol><li> Realizar un apareamiento sincronizado entre un animal de la cepa OKSM con un miembro del sexo opuesto de la cepa m2rtTA. Cosecha embriones en el día embrionario 13,5 por sacrificio de la madre y de la eliminación de la trompa uterina. Antes de la retirada del cuerno uterino, rocíe la región abdominal con una solución de etanol al 80%, para evitar la contaminación microbiana. </li><li> Transferir el cuerno uterino en una placa de cultivo de tejidos de 10 cm que contenía 10 ml de solución salina tamponada con fosfato estéril (PBS). Utilice tijeras quirúrgicas de grado esterilizados para cortar el cuerno uterino en trozos que contienen un embrión (véase la Figura 3A, B). </li><li> Utilice un microscopio de disección (idealmente colocado dentro de una campana de cultivo de tejidos) y pinzas esterilizadas para quitar cuidadosamente la envoltura del útero y las membranas extra-embrionarias que rodean a cada embrión. Transferir cada embrión a un 10 cm separada plato con 10 ml de PBS. </li><li> Proceder mediante la eliminación de la cabeza del embrión, las extremidades, la cola y los órganos internos (corazón, hígado, intestino, etc) con las pinzas (véase la Figura 3C). Transferencia de la cabeza del embrión en un tubo de 1,5 ml y congelar hacia abajo de modo que puede ser utilizado para el genotipado si es necesario. </li><li> Transferir el torso del embrión en un 10cm plato vacío y utilizar dos hojas quirúrgicas para picar el embrión durante 2 min. Añadir 200 l de solución de tripsina / EDTA en la parte superior del embrión picada y se incuba durante 3-5 min a TA. Continuar picado durante 2 min, añadir 2 ml de medio MEF en<html> activar la tripsina, y luego transferir a un tubo de 15 ml. </li><li> Utilice una pipeta de 1.000 l para disociar más mecánicamente el tejido mediante pipeteo suave. Transferencia a una gelatina recubierto placa de 10 cm y añadir otros 10 ml de medio MEF. Nota: Las dos incubadoras normoxic hipóxica y pueden ser utilizados para la cultura, se refieren a la discusión para más información. </li><li> Después de 24 a 48 horas, la placa debe ser densamente cubierto con MEFs. </li><li> Alternativamente, las células pueden propagarse a continuación, o se congelan aún más. Para la congelación de las células, eliminar el medio de cultivo, enjuagar el recipiente con 10 ml de PBS para eliminar los restos de medios de comunicación y de superposición con 3 ml de solución / EDTA tripsina. Incubar durante 3-5 min a 37 ° C, inactivar la digestión con tripsina añadiendo 5 ml de medios de comunicación y la transferencia de MEF a un tubo de centrifugación de 15 ml. Haga girar hacia abajo y volver a suspender el sedimento en 3 ml de congelación medios de comunicación. Traslado al 3 crioviales y congelar en un recipiente de congelación celular. </li></ol> 3. Reprogramación de MEFs ove_content &quot;&gt; NOTA: Precipitar las células por centrifugación a 200 g durante 5 min a 4 ° C y utilizar incubadoras de cultivo de tejidos para la reprogramación normóxicas Puede ser beneficioso para derivar y ampliar MEFs bajo condiciones de hipoxia (5% de oxígeno, véase la discusión para más información. ). <ol><li> Descongelar rápidamente un criovial paso bajo (P0-P1, con 2-3 células de Mio) en un baño de agua (37 ° C) y transferir el contenido en un tubo con 10 ml de medio MEF pre-calentado. Precipitar las células, volver a suspender en medios MEF 12 ml frescas, transferir a un recipiente de cultivo T75 gelatina recubiertos, y permiten que las células se recuperen durante 24-48 horas antes de continuar. Nota: MEFs también se pueden usar directamente después de la derivación. </li><li> Después de la eliminación de medios de cultivo, lavar con PBS y MEFs cellularize mediante la superposición con una solución de tripsina / EDTA (3 ml para 3-5 min a 37 ° C). Se inactiva la tripsina mediante la adición de 5 ml de medio MEF y disociar además células por mezclado suave con una pipeta de 10 ml. Determinar el número de células utilizando un hemocitómetro. </li><li> Para reprograexperimentos Mming, MEFs semillas Onto frascos T75 recubiertos con gelatina a densidades de 6,7 x 10 3 células / cm 2 (~ 0,5 millones de células por frasco) en los medios de comunicación IPSC que contienen 2 mg / ml de doxiciclina. Consulte la Tabla 1 con respecto a las recomendaciones de siembra para obtener alrededor de 2 Mio intermedios de reprogramación para cada punto de tiempo. Nota: La reprogramación se inicia con la adición de doxiciclina (2 mg / ml) suplementado medios </li><li> Para los primeros 6 días a sustituir los soportes cada dos días con doxiciclina fresco complementado medios IPSC (12 ml de medio por matraz T75). Más allá de este punto de renovar los medios de comunicación sobre una base diaria si hay números altos de células. El doble de volumen de cultivo si los cambios de medios sólo se pueden realizar cada dos días. </li><li> Intermedios de reprogramación de la cosecha en los puntos de tiempo requeridos (sugerencia: días 3, 6, 9, 12) mediante la eliminación de los medios de comunicación, aclarando con volumen apropiado de PBS (10 ml para un matraz T75) y la superposición con una solución de tripsina-EDTA (3 ml para una matraz T75). Incubardurante 3-5 minutos a 37 ° C y se inactiva mediante la adición de 5 ml de medio de IPSC seguidos por pipeteo suave. </li><li> Número de suspensión de células con un hemocitómetro (ver arriba), pellet por centrifugación, aspirar las células sobrenadante y resuspender en 10 ml de PBS para eliminar cualquier rastro de tripsina. Se precipitan las células una vez más, se aspira el sobrenadante y proceder con el paso 4.1 para aislar los productos intermedios de reprogramación. Nota: Las células que sufren la reprogramación pueden ser criopreservados y descongelado para el aislamiento FACS en una etapa posterior. </li><li> Para establecer cultivos iPS totalmente reprogramadas, crecer las células en-dox libre IPSC medios durante otros 4-7 días. NOTA: Los cultivos con éxito reprogramación de contener un gran número de colonias por día 12 (ver Figura 4). Durante este tiempo, las células iPS aberrantes que aún requieren expresión OKSM desaparecerán. </li><li> Alternativamente, para propagar los cultivos restantes iPS totalmente reprogramadas: Inicialmente, la semilla MEFs irradiados a una densidad de 15 x 10 3 células / cm 2 </shasta&gt; en 12 ml de medio de IPSC en una gelatina recubierta T75 matraz de un día o 6 horas antes de los experimentos. </li><li> A continuación, los cultivos de células iPS cellularize mediante la eliminación de los medios de comunicación, enjuagando el matraz T75 con 10 ml de PBS, con superposición de 3 ml de solución de tripsina-EDTA e incubando durante 3-5 min a 37 ° C. Se inactiva la tripsina mediante la adición de 5 ml de medio de IPSC seguido de un mezclado suave, transferir a un tubo cónico de 15 ml, girar hacia abajo y luego se resuspendieron en 10 ml de medios de comunicación iPS. </li><li> Transferir 500 l de esta suspensión de células en los MEFs irradiados (matraz T75) y permitir que los cultivos crezcan durante 4-5 días. Nota: culturas iPS establecidas pueden ser criopreservados o utilizados para experimentos. Líneas celulares clonales se pueden derivar por recoger colonias individuales IPSC bajo un microscopio de disección 22. </li><li> Cryo preservar culturas IPSC confluentes como se describe en 2.8 para MEFs. </li></ol> 4. Anticuerpo etiquetado <ol><li> Volver a suspender los sedimentos celulares de las culturas de reprogramación, que se preparaba en la Sección 3, enFACS medios etiquetado complementado con anticuerpos (anti-Thy-1.2 Pacific Blue 1: 400, anti-SSEA-1 biotina 1: 400 y anti-EpCAM Fitc 1: 400). Utilice 200 l de mezcla de marcaje complementado por 5 millones de células y se incuba en hielo. </li><li> Después de 10 min golpee suavemente el tubo para resuspender las células y se incuba durante 10 minutos adicionales en hielo. Añadir 10 ml de PBS frío por tubo y centrifugar. </li><li> Para cada tubo que se va manchado preparar 200 l de material de etiquetado suplementado con 1 l de estreptavidina-PeCy7 (1: 200) por 5 millones de células. Cuando las células han sedimentado, aspirar cuidadosamente el sobrenadante y resuspender en un volumen apropiado de los medios de etiquetado suplementadas con estreptavidina-PeCy7. </li><li> Mantener las células en hielo durante 10 min, toque para volver a suspender, incubar durante otros 10 minutos en hielo, añadir 10 ml de PBS frío por tubo, centrifugar y sobrenadante aspirado. </li><li> Resuspender los sedimentos celulares en medios suplementados etiquetado con yoduro de propidio (PI) (2 mg / ml) a aproximadamente 1 x 10 7 células / ml. Eliminar grupos de células haciendo pasar la suspensión a través de un colador de 70 micras. Transferir las células a un tubo de FACS apropiado y mantenerlos en hielo. </li><li> Preparar muestras separadas con anticuerpos individuales (anti-Thy-1.2, anti-SSEA-1 y anti-EpCAM). NOTA: Estos están obligados a realizar la compensación de color en los tres canales utilizados en el análisis. Además, se necesitan células no marcadas para ajustar los voltajes y puertas para la clasificación. Lo ideal sería que las células iPS se utilizan para la compensación: existencias de 0,5 a 1 x 10 6 células iPS mantenidos en MEFs irradiados se almacenan en crioviales en nitrógeno líquido. La presencia de MEFs es esencial para obtener una señal en el canal de Thy-1.2. </li><li> Descongelar un criovial de células iPS como se describe para MEFs (sección 3). Después de la centrifugación, se resuspenden las células en 800 l de tampón de etiquetado y 200 l de esta muestra se encuentra a un lado como el control sin etiquetar. </li><li> Utilizar las células restantes como controles de compensación. Las células se dividen entre tres tubos de 15 ml y añadir anticuerposcomo sigue: Pacific Blue control de compensación de: añadir 0,5 l de anticuerpo anti-Thy-1.2 Pacific Blue. Tubo de compensación FITC: añadir 0,5 l de anticuerpo anti-EpCAM-FITC. Pe-Cy7 control de compensación: 0,5 l de anticuerpo anti SSEA-1-biotina. </li><li> Mantener las muestras de células de anticuerpos en hielo durante 10 min, la mezcla tocando y se incuba durante 10 min en hielo. </li><li> Lávese las muestras con 10 ml de PBS frío para eliminar el anticuerpo no unido, giran celdas hacia abajo y aspirar el sobrenadante. Sedimentos celulares Resuspender en 200 l de FACS medios etiquetado. </li><li> Por contra SSEA-1-biotina-etiquetados muestras, añadir un conjugado estreptavidina-PeCy7 (1 l por 200 células mu l). Células de la etiqueta como se describe para el anticuerpo primario (SSEA-1-Biotina). </li><li> Pasar todas las muestras incluyendo el control no marcado a través de un colador de 70 micras y añadir PI (2 g / ml). Transferir las células a tubos de FACS y mantener en hielo hasta que se requiera. </li></ol> 5. FACS Aislamiento de los Intermedios Nota:Las células se clasifican usando un clasificador celular activado por fluorescencia con 405 nm, 488 nm y 560 nm de excitación láser y una boquilla de 100 micras. <ol><li> Configuración de los voltajes de dispersión frontal y lateral de manera que la población de células se visualiza correctamente. Dibujar una puerta alrededor de las células como se indica en la figura 5A para excluir los desechos. Nota: La configuración correcta de las tensiones en el clasificador de células puede ser complejo y requiere un operador experimentado FACS. </li><li> Uso dispersión frontal (FSC) de altura frente a área FSC excluir agregados (Figura 5B). </li><li> Visualice el canal PI frente FSC a puerta en las células vivas negativos PI (Figura 5C). </li><li> Utilice las células no marcadas para ajustar los voltajes para los canales fluorescentes de PB, FITC / GFP, Pe-Cy7. Idealmente posicionar la población de células en el extremo inferior del canal respectivo. </li><li> Conjunto puertas con las células de control no marcados como se muestra en la Figura 6A, B a la fracción sub el culto reprogramaciónUres en el día 3, 6 y 9 poblaciones: SSEA-1-/ Thy-1.2 + células; SSEA-1-/ Thy-1.2- células; y la reprogramación como intermediaria en SSEA-1 + / células Thy-1.2-. </li><li> Además subdividir el día 9 SSEA-1 + / Thy-1.2- fracción usando el Pe-Cy7 frente Fitc blot; dibujar puertas alrededor de la ESS-a1 + / + células las células / Epcam- SSEA-1 EpCAM + y. Conjunto puertas con las células de control no marcados como se muestra en la Figura 6C, D. </li><li> Prellenado tubos de recogida apropiados con los medios de comunicación de células iPS (1-2 ml) antes de la clasificación de las subpoblaciones que desee (vea la Figura 7 para FACS perfiles representativos de MEFs, Día 3 / Día 6 / Día 9/12 Día de las culturas y las células iPS). </li><li> Realizar FACS clasificación de acuerdo con fabrica protocolo. </li><li> Después del aislamiento FACS someter las células a perfiles moleculares (ARN / extracción de proteínas, la inmunoprecipitación de la cromatina, ADN metiloma análisis, etc). Alternativamente, las diversas fracciones de células pueden ser cultivadas. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

Los autores no tienen nada que revelar.

Con el fin de reprogramar con éxito MEFs en células iPS y purificar los intermedios de reprogramación a gran cantidad es fundamental ser conscientes de los factores que tienen un impacto en la eficiencia global. En particular, el lote de FBS utiliza para complementar los medios de comunicación iPS puede tener un efecto perjudicial. En experiencias positivas generales se hicieron con madre embrionarias FBS cualificados (ES) de células, pero las pruebas de lote de sueros de una variedad de proveedores podría identificar una alternativa más barata. Otro factor que incide en la eficiencia de la reprogramación es el genotipo de MEFs 15,20. Aunque MEFs derivados de ratones heterocigotos (het) tanto para el OKSM y el locus m2rtTA no reprogramar, homozygousity en uno o ambos loci resultados en la eficiencia de reprogramación más altas. De hecho, MEFs derivados de las crías de OKSM y m2rtTA cruces muestran un aumento en la eficiencia de reprogramación en el siguiente orden (OKSM / m2rtTA): het / het &lt;homo / het &lt;het / homo &lt;homo /homo (tenga en cuenta que los números dados en la Tabla 1 son para animales het / het). En las raras ocasiones un homo / homo animal macho se identifica, un harén de apareamiento con múltiples hembras m2rtTA se puede configurar. Todos los descendientes de estos cruces será Het / homo para el OKSM / m2rtTA loci, respectivamente. Además, se recomienda la rápida determinación del genotipo de camadas como camadas más grandes se obtienen cuando se utiliza para la cría de ratones más jóvenes (6-15 semanas de edad). Por otra parte, el uso de MEFs el paso bajo para la reprogramación se enfatiza 23. Si se derivaron y expandido MEFs en una incubadora de cultivo de tejidos de normoxia se recomienda utilizar sólo estas células hasta el paso 2. Sin embargo, si el experimentador tiene acceso a una incubadora de bajo oxígeno (5% de oxígeno) para la derivación y la expansión de MEFs, números de hasta 3 seguirá siendo dar buenos resultados 23 pasaje. En caso de que el experimentador se encuentra con problemas asociados con la reprogramación,<html> como se indica, las explicaciones más probables son números de alto pasaje en el momento de la adición de dox, el genotipo de los ratones incorrecta o el uso de FBS que no es propicio para la generación de células iPS. Sin embargo, en casos raros se observó que MEFs no fueron capaces de reprogramar incluso bajo condiciones ideales. En estos casos, una deleción espontánea de novo dentro de marco de lectura abierto de la m2rtTA se identificó como la razón subyacente. Esta metodología se ha adaptado con éxito para extraer SSEA-1 + intermedios a través de aislamiento de células magnético (MACS). Existe una clara ventaja de tiempo en el uso de MACS, sin embargo, la pureza de los SSEA-1 + &#39;poblaciones de células se reduce a 80-90%, en lugar de más de 95%, lo que según el tipo de experimento, las células están destinadas para podría plantear un problema. Por lo tanto, una opción es utilizar MACS para enriquecer en células SSEA-1 +, seguido de FACS para aumentar la pureza y / o fracción en células SSEA-1 + / + y EpCAM SSEA-1 + / Epcam-. &quot;&gt; Mientras que las células iPS producidos por el protocolo descrito y modelo de ratón han demostrado ser pluripotentes y efectivamente contribuir a todos los tejidos de animales quiméricos 15,20, una capacidad reducida para producir embriones enteramente compuestas de estas células iPS a través de la complementación tetraploide ha sido demostrado 24. patrones de metilación aberrante en el grupo de genes Dlk-Dio3 se han identificado como la causa subyacente 24. Sin embargo, la adición de ácido ascórbico a una concentración de 50 mg / ml a los medios de comunicación durante la reprogramación producirá células de complementación tetraploide iPS competentes 24. Por favor, tenga en cuenta que un modelo alternativo del ratón reprogramable diseñado para expresar los factores de reprogramación en una estequiometría diferente puede producir tetraploides células iPS competentes, incluso en ausencia de tratamiento con ácido ascórbico 25. Sin embargo, en nuestras células manos de esta reprogramación deformación a frecuencias considerablemente menor en comparación al modo de ratón utilizado en el presente documentol. La metodología descrita en este manuscrito permite la separación de los compuestos intermedios de reprogramación de la masa refractaria de la población y debe ser visto como valiosa herramienta para diseccionar y entender el proceso de reprogramación, la eliminación de las limitaciones anteriores de tener que utilizar una población no fraccionada para el perfil (por ejemplo, ruido de alta señal de las células refractarios). La combinación anticuerpo descrito en el presente documento permite el aislamiento de los compuestos intermedios a partir de células de ratón en alta pureza, sin embargo es posible que los marcadores de la superficie celular adicionales serán descubiertas en el futuro que permitirá obtener productos intermedios en aún mayor pureza. Tenga en cuenta que SSEA-1 de expresión no es una característica de las células madre pluripotentes inducidas humanas y como tal este protocolo no se puede utilizar en la reprogramación de células de origen humano. En conclusión, los compuestos intermedios de reprogramación Una vez aislado con el método descrito se pueden utilizar para los análisis molecular incluyendo expresión profilinag, de inmunoprecipitación de la cromatina, metiloma análisis y ensayos de proteínas.

Las células madre embrionarias (ES) se derivan de la masa celular interna de embriones en estadio de blastocisto 1. En condiciones de cultivo apropiadas se auto-renuevan y mantienen su pluripotencia. En 2006 Yamanaka y sus colegas demostraron que las células maduras pueden ser reprogramadas en células llamada madre pluripotentes inducidas (iPS) por la expresión forzada de los factores de transcripción Oct-4, Klf-4, Sox-2, c-Myc (OKSM) 2. células iPS, como las células ES, pueden dar lugar a todos los tipos de células del cuerpo, sin embargo, que están libres de las restricciones éticas en torno a la generación de células ES 3. Además, las células iPS llevan la promesa de la medicina regenerativa personalizada y tienen un enorme potencial para aplicaciones como el modelado de la enfermedad y en la detección de drogas in vitro 4,5. A fin de que la reprogramación de la tecnología para cumplir con este potencial, el mecanismo básico de la reprogramación nuclear necesita ser completamente comprendido. Sin embargo, los esfuerzos para diseccionar la palmadita reprogramaciónhway han visto obstaculizados por el hecho de que sólo un número muy pequeño de células reprogramar (0,1-1%). Fibroblastos con éxito reprogramación se ha informado de que someterse a una serie distinta de eventos incluyendo una a la transición epitelial mesenquimal 6-10 y, en las etapas finales de la reprogramación, la activación de la red 11-14 pluripotencia núcleo endógeno. Nosotros y otros 12,13,15-17 Recientemente hemos identificado un conjunto de marcadores de superficie celular que permite la separación de compuestos intermedios raras de la población mayor refractario. Fibroblastos de embriones de ratón (MEFs Reprogramación) sufren cambios en la expresión de Thy-1.2, Ssea1 y EpCAM (entre otros) durante el proceso de reprogramación de 2 semanas de duración 15. Temprano durante la reprogramación de un subconjunto de MEFs regular a la baja la expresión del marcador de la identidad de los fibroblastos (Thy-1.2) y luego comenzar expresando el marcador de pluripotencia asociada SSEA-1 12. Durante las etapas finales de la reprogramación de células Ssea1-positivos REACTIVcomió genes pluripotencia endógenos como Oct-4 10-13,15. Esta última transición está marcado en la superficie celular por la expresión detectable de EpCAM (véase la Figura 1) o en una etapa posterior Pecam 15. Recientemente, O&#39;Malley et al. Informaron el uso de CD44 y ICAM1 como alternativas o complementarias a Thy-1.2 y SSEA-1 para la identificación de los productos intermedios de reprogramación. Hemos FACS previamente extraída intermedios de reprogramación desde el Día 0, Día 3, Día 6, culturas Día 9 Día 12 de reprogramación, así como de líneas de células iPS establecidas sobre la base de estos marcadores de superficie celular 15,18. Para el sistema de reprogramación a continuación se describe y condiciones que hemos mostrado en el nivel de células individuales que, aunque las poblaciones son tranquilas homogénea, hay un cierto grado de heterogeneidad en las poblaciones intermedios identificados. Cabe señalar que sólo un subconjunto de las células dentro de estas poblaciones son capaces de avanzar a la siguiente respectiva stage del proceso de reprogramación y dan lugar a colonias de células iPS en diferentes eficiencias, que han sido ampliamente caracterizadas previamente 15,19. Por otra parte, la eficiencia de la reprogramación de estas poblaciones dependerá también de las condiciones de re-enchapado y cultura. Para aumentar la reproducibilidad experimental utilizamos una cepa de ratón reprogramable que ha sido diseñado para expresar un transactivador transcripcional (m2rtTA) bajo el control del locus Rosa26 y un casete policistrónico OKSM bajo control de un promotor sensible a la doxiciclina 20,21. Usando este modelo de ratón evita los efectos secundarios no deseados de los métodos virales tradicionales de generación de células iPS, es decir, una población heterogénea de partida con la célula a la variabilidad celular en número y ubicación de los sitios de integración de inserciones virales. Dos cepas de ratones transgénicos (OKSM, m2rtTA), disponibles como animales fundadores homocigotos en el Laboratorio Jackson, tienen que ser cruzado con el fin de establecer la reprogramodelo de ratón mmable (véase la Figura 2). En este manuscrito se describe en detalle cómo derivar MEFs, generar células iPS, y aislar los compuestos intermedios de reprogramación en las diversas etapas del proceso de conversión por FACS.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

Después de la disección, la desagregación y el chapado de un embrión E13.5 ratón, se espera que una placa de 10 cm para llegar a la confluencia en aproximadamente 1 a 2 días. En esta etapa, es normal para que la cultura contiene algunas piezas de tejido adherentes que no se han cellularized correctamente. Estos desaparecerán después de los pases. Tras la inducción doxiciclina, MEFs reprogramación sufren cambios morfológicos distintos. Alrededor del día 6, parches-colonias como primeras pueden comenzar a surgir (Figura 4C). Estos seguirán creciendo en tamaño a un cultivo adicional (ver Figura 4 D, E). Un buen experimento reprogramación debería resultar en&gt; 500 colonias por T75 que se sembró inicialmente con 5 x 10 5 células (Figura 4E). Culturas iPS establecidas poseen colonias en forma de cúpula característicos y sobre todo deben estar desprovistos de células diferenciadas (Figura 4F). De vez en cuando, los pases adicional de iPS cultures pueden ser necesarios para eliminar las células indiferenciadas / parcialmente reprogramadas; un matraz confluente de células se puede dividir en una proporción de 01:10 sobre una capa alimentadora de MEFs irradiados. Como se mencionó anteriormente, los cambios morfológicos y moleculares durante la reprogramación se reflejan en cambios en los perfiles de FACS para Thy-1.2, SSEA-1 y en última instancia EpCAM (véase la Figura 7A-F). Como se informó anteriormente 12,15, mientras que MEFs son predominantemente positivos para Thy-1.2 y negativo para los otros marcadores, Día 3 culturas ya se ven muy diferentes. Una gran proporción de las células han empezado a regular a la baja la expresión de Thy-1.2 y un muy pequeño subconjunto de estas células negativas Thy-1.2 se han convertido en positivo para SSEA-1, la reprogramación intermedio efectivo para este punto de tiempo. El número de intermedios de reprogramación que se pueden extraer a partir del día 3 culturas es muy impredecible como el porcentaje de SSEA-1 + / Thy-1.2- por lo general se encuentra en un rango entre 1-10% de viablcélulas e. Los días 6 y 9 un mayor porcentaje de células SSEA-1 +, por lo general muy por encima de 10%, se puede detectar. Alrededor del día 12 de un subconjunto de SSEA-1 células positivas se puede detectar que también etiquetar positivo para EpCAM. Día 12 culturas, como el día 3 culturas, representa un cuello de botella en la purificación de los productos intermedios, como el porcentaje de + / EpCAM células SSEA-1.2 + es variable y generalmente cae en el rango de sólo el 2-4% de todas las células vivas. El número esperado de intermedios de reprogramación presentados en la Tabla 1 sólo sirve como una aproximación. Culturas celulares establecidas de buena fe iPS serán fuertemente positiva para SSEA-1 y EpCAM. <img alt="Figura 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> Figura 1: Superficie cambios marcador durante la vía reprogramación: Down-regulación de la seña de identidad de fibroblastos Thy-1.2 es seguido por la sobre regulación deSSEA-1. La transición de un subconjunto de células SSEA-1 positivos hacia un estado pluripotente se indica mediante la adquisición de EpCAM alrededor del día 12. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> Figura 2. Representación esquemática del modelo de ratón reprogramable:. M2rtTA expresión está bajo el control del locus Rosa26 ubicua activo en presencia de doxiciclina (dox) la proteína m2rtTA se une a un promotor dependiente de tetraciclina (tetOP) en el colágeno 1A1 (COL1A1) locus resulta en la expresión del casete de cuatro factores. Dos casetes bicistrónicos están unidos por un sitio de entrada de ribosoma interno (IRES). Marcos de lectura abierta para octubre-4 / Klf-4 y Sox-2 / c-Myc son fu<html> sed por F2A y E2A secuencias autoescindibles, respectivamente. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> Figura 3. Embrión disección: cuerno uterino (A) Transferencia en un plato de 10 cm llena con 10 ml de PBS y (B) corta en trozos que contienen un embrión. (C) El uso de pinzas liberan los embriones a partir de tejido embrionario extra y eliminar la cabeza, las extremidades, la cola y los órganos internos. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> les / ftp_upload / 51728 / 51728fig4highres.jpg &quot;width =&quot; 500 &quot;/&gt; Parches Figura 4. Cambios morfológicos durante la reprogramación. Colonia-como se hacen evidentes en las culturas desde el día 6 en adelante. IPSCs Bona fide se caracterizan por una morfología en forma de cúpula. (A) Día 0 / MEFs, (B) Día 3, (C) Día 6, (D) Día 9, (E) Día 12, (F) IPS cultivo celular. Barra de escala:. 200 m <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> Figura 5 Configuración básica FACS. (A) No incluir escombros con dispersión lateral frente a la dispersión de la zona de transferencia. (B)Excluir agregados de no residuos, colocando puertas en la población de células individuales con Forward Area de dispersión frente a la dispersión de alta blot. (C) Excluir las células muertas de la población de células individuales, colocando puertas en PI eventos de baja con el canal de PI frente a la dispersión Área Blot. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> Figura 6. Gating. (A, B) El uso de las células de control sin marcar establecidos puertas de Thy-1.2 células + / SSEA-1-, 1.2- Thy-/ células SSEA-1 y Thy-1.2- / SSEA-1 + células. (C) Use las células control sin marcar para establecer puertas de las células positivas y negativas EpCAM EpCAM. (D) SSEA-1 células + / Thy-1.2- pueden separarseen un EpCAM positivo y en una población negativa EpCAM. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> Figura 7. Thy-1.2 contra SSEA-1 FACS blots en varias etapas del proceso de reprogramación. (A) Día 0 / MEFs, (B) Día 3, (C) Día 6, (D) Día 9, (E) Día 12, el cultivo de células (F) iPS. Tabla 1. sugeridos densidad de siembra, número de frasco y el resultado esperado para P1 MEF de un heterocigotos embriones para OKSM y m2rtTA. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">Por favor, haga clic h</a>ere para ver una versión más grande de esta cifra. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Día </td><td> Número de matraces T75 sembró en el día 0 </td><td> Número total de células Ssea1 + después de FACS </td><td> Número total de células Ssea1 + / EpCAM + después de FACS </td></tr><tr><td> 3 </td><td> 8 </td><td> 2 millones </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2 millones </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2 millones </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10 millones </td><td> 2 millones </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Marcador de superficie celular mediada Purificación de iPS intermedios célula de un modelo reprogramable Ratón

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K vistas.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Video: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Purificación por cromatografía de ribosomas de levadura de gran actividad

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Investigación

Biología

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Aislamiento y purificación de Kinesin desde Drosophila Los embriones

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

Avidez detección basada en la interacción extracelular (AVEXIS) para la detección escalable de extracelular de baja afinidad interacciones ligando-receptor

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

Generación de ratones derivados de células madre pluripotentes inducidas

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

Perfiles de expresión de microARN de las células iPS humanas, de la retina del epitelio pigmentario Derivado de Ips y Fetal epitelio pigmentario de la retina

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

Eficiente iPS Generación Celular de sangre usando episomas y HDAC inhibidores

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

Trans-interno celular masiva inyección de células madre embrionarias conduce a mayores tasas de quimerismo

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

Cultivos celulares primarios de células del epitelio pigmentario de la retina del ratón

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...

Visualization and Quantification of Mesenchymal Cell Adipogenic Differentiation Potential with a Lineage Specific Marker

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy to use and widely utilized by laboratories analyzing the adipogenic potential of mesenchymal cells. However, they are not specific to changes in gene transcription. We have developed a gene-specific differentiation assay to analyze when a mesenchymal cell has switched its fate to an adipogenic lineage. Immuno-labelling against fatty acid binding protein-4 (FABP4), a lineage-specific marker of adipogenic differentiation, enabled visualization and quantification of differentiated cells. The ability to quantify adipogenic differentiation potential of mesenchymal cells in a 96 well microplate format has promising implications for a number of applications. Hundreds of clinical trials involve the use of adult mesenchymal stromal cells and it is currently difficult to correlate therapeutic outcomes within and especially between such clinical trials. This simple high-throughput FABP4 assay provides a quantitative assay for assessing the differentiation potential of patient-derived cells and is a robust tool for comparing different isolation and expansion methods. This is particularly important given the increasing recognition of the heterogeneity of the cells being administered to patients in mesenchymal cell products. The assay also has potential utility in high throughput drug screening, particularly in obesity and pre-diabetes research.

Traditional methods of assessing adipogenic differentiation are cheap and easy to use, but are not specific to changes in gene expression. We have developed an assay to quantify mesenchymal cell differentiation into mature adipocytes using a lineage specific marker. This assay has diverse applications across basic research and clinical medicine.

Visualización y cuantificación del potencial de la diferenciación de células mesenquimales Adipogenic con un marcador específico de linaje

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy ...

A Mouse Model of Intestinal Partial Obstruction

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including tumorous growths. However, the cellular remodeling mechanisms involved in, and caused by, intestinal obstructions are poorly understood. Several animal models of intestinal obstructions have been developed, but the mouse model is the most cost/time effective. The mouse model uses the surgical implantation of an intestinal partial obstruction (PO) that has a high mortality rate if it is not performed correctly. In addition, mice receiving PO surgery fail to develop hypertrophy if an appropriate blockade is not used or not properly placed. Here, we describe a detailed protocol for PO surgery which produces reliable and reproducible intestinal obstructions with a very low mortality rate. This protocol utilizes a surgically placed silicone ring that surrounds the ileum which partially blocks digestive movement in the small intestine. The partial blockage makes the intestine become dilated due to the halt of digestive movement. The dilation of the intestine induces smooth muscle hypertrophy on the oral side of the ring that progressively develops over 2 weeks until it causes death. The surgical PO mouse model offers an in vivo model of hypertrophic intestinal tissue useful for studying pathological changes of intestinal cells including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), PDGFR&#945;+, and neuronal cells during the development of intestinal obstruction.

Intestinal obstructions are a partial or complete blockage of the intestine that can cause severe abdominal pain, nausea, vomiting, and preventing the passage of stool. This procedure for creating intestinal partial obsructions in mice is reliable in studying the mechanisms underlying pathological cell growth and death in the intestine.

Un modelo de ratón de la obstrucción Intestinal parcial

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...