우리는 모나 쉬 Larkins 프로그램에서뿐만 아니라 NHMRC CDF와 NHMRC 프로젝트 기금에서 재정 지원을 인정하고 싶습니다. 또한, 우리는 비디오를 생산하는 그들의 도움에 대한 그녀의 지원 (특히 아담 Dinsdale에서) 모나 쉬 Flowcore 팀에 대 한 그녀의 건설적인 제안 에드 위나 McGlinn를 슈 메이 임에게 감사의 말씀을 전합니다.

1 장비 설정 / 시약 준비 / 유전자형 <ol><li> 만능 줄기 세포 배지를 준비 : 5 ㎖의 비 필수 아미노산, 500 μL의 β 머 캅토 에탄올 75 ml의 소 태아 혈청 (FBS) 5 ㎖의 L-글루타민으로, 5 × 5 단위 백혈병 억제 인자를 500 ㎖의 넉 아웃 DMEM 매체를 보충 ( LIF). 이 원고의 맥락에서 사용되는 시약은 제품 및 구매 정보 자료 목록을 참조하십시오. </li><li> MEF 매체를 준비 : 50 ML의 FBS, 5 ㎖의 L-글루타민, 5 ㎖의 비 필수 아미노산, 5 피루브산 나트륨, 500 μL의 β-메르 캅토 에탄올과 함께 500 ㎖의 DMEM 미디어 보조 식품. </li><li> 10 ML은 DMSO의 1 ml의 FBS의 9 ml의 결합 : 중간 동결 준비합니다. </li><li> 준비 젤라틴은 요리를 잘 사용하기 전에 적어도 10 분 흡인 실온에서, T75 플라스크에 3 ~ 5 ㎖의 0.1 %, 돼지의 젤라틴 용액을 추가 배양 코팅. </li><li> 10 ML 들어 FBS의 0.1 ml의 PBS의 9.9 ML을 결합 : FACS 라벨 매체를 준비합니다. </li><li> 수행Rosa26 m2rtTA 궤적에 대한 유전자형 PCR은 : 제조업체의 지침에 따라의 Taq DNA 중합 효소와 반응을 수행합니다. 사용 MgCl2를 3.5 mM의 다음과 같은 세 프라이머 -concentration 수정 : oIMR8052 : 5 &#39;GCG AAG AGT TTG TCC TCA ACC 3&#39;, oIMR8545 : 5&#39;AAA의 GTC의 GCT CTG AGT TGT TAT 3 &#39;, oIMR8546 : 5&#39;GGA GCG GGA GAA ATG GAT ATG 3 &#39;. 사이클링 조건 : 3 분 94 ° C; (30 초 동안 94 ° C, 1 분 동안 65 ° C, 1 분 동안 72 ° C)의 35주기; 2 분 동안 72 ° C; 12 ° C에서 개최합니다. 예상 제품 크기 : 야생형 대립 유전자에 대한 650 BP와 돌연변이 대립 유전자 340 bp의. </li><li> 콜라겐 StemCa / OKSM 궤적에 대한 유전자형 PCR를 수행 지침에 따라의 Taq DNA 중합 효소 반응을 수행합니다. 사용 MgCl2를 2.5 mM의 다음과 같은 세 프라이머 -concentration 수정 : COL / FRT-B : 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, COL / frtA1 : 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, COL / frtC1 : 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. 사이클링 조건 : 1 분 동안 95 ° C (30 초 동안 94 ° C, 45 초 동안 70 ° C)의 2주기의 6주기 (30 초 동안 94 ° C, 45 초 동안 68 ° C) 30 회 (20 초 동안 94 ° C, 1 분 동안 60 ° C)의; 5 분 동안 72 ° C; 12 ° C에서 개최합니다. 예상 제품 크기 : 야생형 대립 유전자 331 bp의 돌연변이 대립 유전자 551 bp의. </li><li> 4 ℃에서 3 분 동안 400 XG에서 모든 원심 분리 단계를 수행하십시오. </li></ol> 마우스 배아 섬유 아세포의 2 세대 <ol><li> m2rtTA 균주의 이성의 일원으로 OKSM 변형의 동물 사이의 시간이 초과 짝짓기를 수행합니다. 어머니 컬링과 자궁 경적을 제거하여 배아 일 13.5에서 수확 배아. 종래 자궁 뿔의 제거에, 미생물 오염을 피하기 위해, 80 % 에탄올 용액으로 복부를 스프레이. </li><li> (무균 인산염 완충 식염수 10 ㎖를 함유 10cm 조직 배양 접시에 PB를 자궁 뿔을 전송S). (B를도 3a 참조) 한 배아를 포함하는 조각으로 자궁 뿔을 잘라 멸균 수술 등급 가위를 사용합니다. </li><li> 조심스럽게 자궁 봉투 및 각 배아를 둘러싼 여분의 배아 세포막을 제거하기 위해 절개 (이상적으로는 조직 문화 후드 내에 위치) 현미경 및 멸균 집게를 사용합니다. PBS의 10 ㎖로 별도의 10cm 접시에 각각의 배아를 전송합니다. </li><li> 태아의 머리, 사지, 꼬리와 집게로 내부 장기 (심장, 간, 대장 등)을 제거하여 진행합니다 (그림 3C 참조). 1.5 ㎖의 튜브에 태아의 머리를 전송하고, 필요한 경우에는 마스크 유전자형에 사용할 수 있도록 아래로 동결. </li><li> 빈 10cm 접시에 배아의 몸통을 전송하고 2 분 동안 배아를 말하다이 수술 블레이드를 사용합니다. 다진 배아의 상단에 트립신 / EDTA 용액 200 μl를 추가하고 실온에서 3 ~ 5 분 동안 배양한다. , 추가로 2 분 동안 닦지 계속에서에 MEF 미디어 2 ㎖를 추가<html> 트립신을 활성화 한 다음 15 ML 튜브로 전송합니다. </li><li> 더 기계적으로 부드러운 피펫으로 조직을 떼어 놓다 1000 μL 피펫을 사용합니다. 젤라틴 코팅 10cm 접시에 전송하고 MEF 매체의 추가로 10 ML을 추가합니다. , 두 정상 산소 저산소 창업 보육 센터가 문화에 사용할 수 있습니다 자세한 내용은 설명을 참조하십시오합니다. </li><li> 24 ~ 48 시간 후 판은 밀도가 MEFs으로 덮여해야합니다. </li><li> 대안 적으로, 상기 세포는 그 다음 아래로 전파 또는 동결 될 수있다. 세포의 동결 들어, 배양 배지를 제거 PBS 3 ml의 트립신 / EDTA 용액으로 미디어 및 오버레이의 흔적을 제거하기 위해 10 ㎖의 접시를 헹군다. 37 ° C에서 3 ~ 5 분 동안 품어 15 ㎖의 원심 분리 관에 MEF 미디어 및 전송 5 ㎖를 추가하여 트립신 소화를 비활성화. 스핀 다운 및 미디어를 동결 3 ㎖에 펠렛을 재현 탁. 3 cryovials에 전송하고 세포 냉동 컨테이너에 아래로 동결. </li></ol> MEFs의 3 재 프로그래밍 &quot;ove_content&gt; 참고 : 펠렛은 4 ° C에서 5 분 동안 200 XG에 원심 분리하여 세포 리 프로그래밍을위한 정상 산소 조직 문화 인큐베이터를 사용 그것은 파생 저산소 상태 (5 % 산소에서 MEFs을 확장, 자세한 내용은 설명을 참조하기 위해 도움이 될 수 있습니다. ). <ol><li> 빠르게 물 목욕 (37 ° C)의 낮은 통로 cryovial (P0-P1, 2-3 미오 셀) 해동 및 예열 MEF 매체의 10 ml의 튜브에 내용을 전송합니다. 펠렛 세포는 12 ㎖의 신선한 MEF 매체에 resuspend는 젤라틴 코팅 T75 배양 용기에 전송하고, 세포를 진행하기 전에 24 ~ 48 시간 동안 복구 할 수 있습니다. 참고 : MEFs가 직접 유도 한 후 사용할 수 있습니다. </li><li> 문화 미디어의 제거 후, ​​트립신 / EDTA 용액 (37 ° C에서 3 ~ 5 분 동안 3 ml)로 중첩에 의해 PBS와 cellularize와 MEFs을 씻는다. MEF 매체 5 ㎖를 첨가하여 켄 칭하고 트립신 및 추가 10 ㎖ 피펫으로 부드러운 혼합하여 세포를 해리. 혈구를 사용하여 세포 수를 결정합니다. </li><li> reprogra 들어mming 실험, 6.7 × 103 세포 / cm 2의 밀도에서 젤라틴 코팅 T75 플라스크 위에 씨앗 MEFs (~ 플라스크 당 0.5 미오 셀) 2 μg / ml의 독시 싸이클린을 포함 IPSC 미디어에서. 각 시점에 대한 주위 미오 리 프로그래밍이 중간체를 수득 표 1에 관한 시딩 추천 정보를 참조. 주 : 리 프로그래밍은 독시사이클린 (2 μg / ㎖)의 첨가로 개시 매체를 보충 </li><li> 첫번째 육일 미디어를 대체 들어 신선한 독시사이클린 (doxycycline)와 다른 모든 일이 IPSC 미디어 (T75 플라스크 당 미디어의 12 ml)에 보충. 높은 셀 번호가 있으면이 시점 이후 매일 갱신 매체. 미디어 변경 할수마다 다른 일을 수행 할 수 있는지 배양 부피를 두배. </li><li> 필요한 시점에서 수확 리 프로그래밍 중간체 : 위해 (3 ml의 PBS의 적절한 음량 (T75 플라스크에 10 ㎖)으로 세척하고 트​​립신-EDTA 용액으로 중첩 매체를 제거하여 (제안 일 3, 6, 9, 12) T75 플라스크). 품다37 ° C에서 3 ~ 5 분 동안 부드러운 피펫 다음 IPSC 미디어 5 ㎖를 추가하여 해소. </li><li> 원심 분리에 의해 혈구 세포와 서스펜션 (상기 참조), 펠렛 카운트 트립신의 흔적을 제거하는 PBS 10 ㎖에 재현 탁하고 세포 상등액을 흡인. 다시 한번 펠렛은 세포 흡인 뜨는 및 재 프로그래밍 중간체를 분리하는 단계 4.1를 진행합니다. 주 : 리 프로그래밍을받은 세포는 냉동 보존 및 이후 단계에서 FACS 격리를위한 해동 할 수있다. </li><li> 완전히 재 프로그래밍 만능 문화를 확립하기 위해, 더 4~7일에 DOX없는 IPSC 미디어에서 세포를 성장. 참고 : 성공적으로 재 프로그램 배양 12 일에 의해 콜로니를 다수 포함하고 (도 4 참조). 이 시간 동안 계속 OKSM 표현을 필요로 탈선 만능 줄기 세포가 사라집니다. </li><li> 초기에 15 × 103 세포 / cm 2의 밀도로 조사 MEFs를 시드 : 대안 적으로, 나머지 완전히 재 프로그래밍 만능 배양을 전파 </s&gt; 최대 T75 코팅 된 젤라틴 상 IPSC 미디어의 12 ㎖에 일일 또는 이전 실험에 6 시간 플라스크. </li><li> 다음으로, 트립신-EDTA 용액 3 ㎖의 중첩 및 37 ° C에서 3 ~ 5 분 동안 배양, PBS 10 mL로 T75 플라스크를 세척, 미디어를 제거하여 cellularize 만능 줄기 세포 배양. 부드러운 혼합 한 다음 IPSC 미디어 5 ㎖를 추가하여 트립신을 끄다 15 ML 원뿔 튜브로 전송, 스핀 다운 한 다음 10 ㎖의 만능 줄기 미디어에 재현 탁. </li><li> 조사 MEFs (T75 플라스크)에이 세포 현탁액 500 μl를 전송하고 문화 4 ~ 5 일 동안 성장 할 수 있습니다. 주 : 설립 만능 문화가 냉동 보관 또는 실험에 사용 할 수 있습니다. 클론 세포주 해부 현미경 (22)에서 개별 IPSC의 식민지를 선택하여 유도 될 수있다. </li><li> MEFs 2.8에 설명 된 곳을 알아내는이 합류 IPSC 문화를 보존 할 수 있습니다. </li></ol> (4) 항체 라벨링 <ol><li> 에, 3 장에서 제조 된 프로그램을 다시 문화의 재현 탁 세포 펠렛,항체 보충 FACS 라벨 용지 (1 안티 네 - 1.2 태평양 파랑 : 400, 항 SSEA-1 비오틴 1 : 400 및 안티는 EpCAM FITC 1 : 400). 5000000 세포 당 보충 라벨 믹스 200 μl를 사용하여 얼음에 품어. </li><li> 10 분 후 부드럽게 얼음에 추가로 10 분 동안 세포를 재현 탁하고 배양 할 수있는 튜브를 누릅니다. 튜브 당 차가운 PBS의 10 ML을 추가하고 스핀 다운. </li><li> 5000000 세포 당 각 튜브 (200 일) 1 ㎕의 스트렙 타비 딘-PeCy7 보충 라벨 용지 200 μl를 준비 스테인드합니다. 세포 펠렛되면, 조심스럽게 스트렙 타비 딘-PeCy7 보충 라벨 미디어의 적절한 볼륨에 뜨는에 resuspend을 대기음. </li><li> , 재현 탁 얼음에 또 다른 10 분 동안 품어, 튜브 당 차가운 PBS 10 ㎖를 추가, 스핀 다운 및 흡인 뜨는 살짝 눌러 10 분 동안 얼음에 세포를 보관하십시오. </li><li> 라벨 매체에 재현 탁 된 세포 펠렛은 약 1 × 10 7 세포 / ml에서 요오드화 프로피 듐 (PI) (2 μg / ml)로 보충. 70 μm의 여과기를 통해 서스펜션을 전달하여 세포 덩어리를 제거합니다. 적절한 FACS 튜브에 세포를 전송하고 얼음에 보관하십시오. </li><li> 개별 항체를 개별의 샘플을 준비합니다 (안티 - 네 - 1.2, 항 SSEA-1 및 안티는 EpCAM). NOTE : 이러한 분석에 사용되는 세 개의 채널의 색상 보정을 수행하기 위해 요구된다. 또한, 레이블이없는 세포를 정렬하는 전압과 게이트를 설정하는 데 필요합니다. 이상적으로 유도 만능 줄기 세포는 보상을 위해 사용됩니다 조사 MEFs에서 유지 관리 0.5 × 10 6 만능 줄기 세포의 주식은 액체 질소에 cryovials에 저장됩니다. MEFs의 존재는 네 - 1.2 채널 신호를 얻기 위해 필수적이다. </li><li> MEFs (섹션 3)에 대하여 기술 된 바와 같이 유도 만능 줄기 세포의 cryovial을 해동. 원심 분리 후, 라벨 버퍼 800 μL이 샘플 200 μL에 재현 탁 세포는 레이블이없는 컨트롤로 따로 설정되어 있습니다. </li><li> 보상 컨트롤로 남아있는 세포를 사용합니다. 세 15 ML 튜브 및 추가 항체 사이 나누기 세포퍼시픽 블루 보상 제어가 : 안티 - 네 - 1.2 퍼시픽 블루 항체의 0.5 μl를 추가 다음과 같은. FITC 보상 관 : 안티는 EpCAM-FITC 항체의 0.5 μl를 추가합니다. PE-Cy7 보상 제어 : SSEA-1 항 - 비오틴 항체 0.5 μL. </li><li> 10 분 동안 얼음에 세포 항체 샘플을 계속 눌러 혼합하고 얼음에 10 분 동안 배양한다. </li><li> 10 ㎖의 차가운 PBS로 세척 샘플은, 언 바운드 항체를 제거 아래로 세포를 스핀 뜨는을 대기음합니다. FACS 라벨 용지를 200 μL에 재현 탁 세포 펠렛. </li><li> 안티-SSEA-1-비오틴 표지 된 시료를 들어, 스트렙 타비 딘-PeCy7 접합체 (200 ㎕를 세포 당 1 μL)을 추가한다. 라벨 세포로서 일차 항체 (SSEA-1-비오틴)에 대해 설명했다. </li><li> 70 μm의 여과기를 통해 레이블이없는 컨트롤을 포함하여 모든 샘플을 전달하고 PI (2 μg / ㎖)를 추가합니다. FACS 튜브에 세포를 전송하고 필요한 때까지 얼음에 보관하십시오. </li></ol> 중간체의 5 FACS 격리 참고 :세포는 405 nm의, 488 nm에서 560 nm의 여기 레이저와 100 μm의 노즐 형광 활성 세포 분류기를 사용하여 분류되어 있습니다. <ol><li> 세포군 적절히 시각화되도록 전방 및 측면 스 캐터에 설정된 전압. 파편을 제외도 5a에 표시된 세포 주위에 게이트를 그립니다. 참고 : 셀 소터에 전압의 올바른 셋업이 복잡하고 숙련 된 FACS 연산자를 필요로 할 수 있습니다. </li><li> FSC 영역 대를 사용하여 앞으로 분산 형 (FSC) 높이 집계 (그림 5B)를 제외한다. </li><li> PI 부정적인 살아있는 세포 (그림 5C)에 게이트에 FSC 대 PI 채널을 시각화. </li><li> PB, FITC / GFP, PE-Cy7의 형광 채널의 전압을 조정하는 레이블이없는 세포를 사용합니다. 이상적으로, 각 채널의 하단부에 세포군 위치. </li><li> 하위 부분 재 프로그래밍 숭배 그림 6A, B에서와 같이 레이블이없는 대조군 세포와 게이트를 설정일 3, 6에을 마련해 9 인구 : SSEA-1 / 네 - 1.2 + 세포; SSEA-1 / 네 - 1.2 ~ 세포; 및 리 프로그래밍이 SSEA-1 + / - 1.2 ~ 네 셀 중간체. </li><li> 또한 9 일 SSEA-1을 분할 + / - 1.2 ~ 네 부분 FITC 오점 대 PE-Cy7을 사용하여; SSE-A1 + /는 EpCAM + 세포와 SSEA-1 + / Epcam- 세포 주위에 게이트를 그립니다. 그림 6C, D와 같이 레이블이없는 대조군 세포와 게이트를 설정합니다. </li><li> 원하는 부분 집단을 (MEFs에 대한 대표 FACS 프로필, 3 일 / 6 일 / 9 일 / 일 12 문화와 유도 만능 줄기 세포에 대한 그림 7 참조) 정렬 전에 만능 줄기 세포 미디어 (1-2 mL)로 적절한 수집 튜브를 미리 기입. </li><li> FACS 정렬 프로토콜을 제조에 따라 수행합니다. </li><li> FACS 분리 한 후 분자 프로파일 링 (RNA / 단백질 추출, 크로 마틴 면역 침강, DNA의 methylome 분석 등)에 세포를 제출합니다. 대안 적으로, 다양한 세포 분획을 배양 할 수있다. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

저자가 공개하는 게 없다.

성공적 IPS 세포로 재 프로그램 MEFs 높은 양으로 재 프로그래밍 중간체를 정제하기 위하여는 전체 효율에 영향을 미치는 요인을 인식하는 것이 필수적이다. 특히, FBS의 배치 해로운 영향을 미칠 수 만능 용지를 보충하기 위해 사용된다. 일반적으로 긍정적 인 경험에서 배아 줄기 (ES) 세포 자격을 갖춘 FBS하지만 싼 대안을 식별 할 수 다양한 공급 업체에서 혈청의 배치 테스트를 하였다. 재 프로그래밍 효율에 미치는 영향은 MEFs 15,20의 유전자형 또 다른 요인. OKSM 및 재 프로그램 할 m2rtTA 궤적, homozygousity 일에서 이상 재 프로그래밍 효율성의 두 궤적 결과 모두 쥐 이형 (HET)에서 파생 된 MEFs 있지만. 헤트 / 헤트 &lt;호모 / 헤트 &lt;헤트 / 호모 &lt;호모 / : 사실, OKSM 및 m2rtTA 십자가의 자손에서 유래 MEFs는 다음과 같은 순서 (OKSM / m2rtTA)에서 재 프로그래밍 효율의 증가를 보여호모 (표 1에 주어진 번호는 노한 / HET 동물 바랍니다 참고). 남성 호모 / 호모 동물이 확인 된 드문 경우에, 여러 m2rtTA 암컷과 짝짓기 하렘은 설정할 수 있습니다. 이 십자가의 모든 자손이 각각 OKSM / m2rtTA 궤적에 대한 / 호모 HET됩니다. 번식 젊은 쥐 (생후 6~15주)를 사용할 때 더 큰 새끼를 얻을대로 또한, 새끼의 급속한 유전자형을 권장합니다. 또한, 재 프로그래밍에 대한 낮은 통로 MEFs의 사용은 23를 강조한다. MEFs가 정상 산소 조직 문화 인큐베이터에서 파생 된 확장한다면 우리는 강력하게 만 그러나 통로 (2)에이 세포를 사용하는 것이 좋습니다, 실험자 MEFs의 유도 및 확장을위한 저산소 배양기에 대한 액세스를 (5 % 산소)가있는 경우, 여전히 양호한 결과를 수득한다 (23) 3만큼 높은 통로 번호. 경우 실험자들은 재 프로그래밍과 관련된 문제가 발생,<html> 설명한 바와 같이, 대부분의 설명은 DOX 첨가 부정확 쥐 유전자형 또는 만능 줄기 세포 생성에 도움이되는 없습니다 FBS의 사용시의 높은 통로 번호이다. 그러나 드문 경우에 우리는 MEFs도 이상적인 조건에서 재 프로그램 할 수 없었던 것을 관찰했다. 이 경우 m2rtTA의 오픈 리딩 프레임 내에서 자연 드 노보 삭제 근본적인 이유 확인되었다. 이 방법론은 성공적으로 자기 세포 분리 (MACS)를 통해 SSEA-1 + 중간체를 추출하도록 하였다. MACS를 사용에서 클리어 시간 이점이있다, 그러나, SSEA-1 + 세포 집단 &#39;순도 세포 포즈 수도 향하는 실험의 종류에 따라 80~90%보다는 95 % 이상으로 감소된다 문제. 따라서, 옵션 SSEA-1 + / +는 EpCAM 및 SSEA-1 + / Epcam- 세포로 순도 및 / 또는 분획을 늘릴 FACS이어서 SSEA-1 + 세포 풍부 MACS를 사용하는 것이다. 설명 된 프로토콜과 마우스 모델에 의해 생성 IPS 세포가 다 능성하고 효과적으로 키메라 동물 15,20 모든 조직에 기여할 도시되었지만 &quot;&gt; 완전히 배체 보완 통해 이들 만능 줄기 세포로 구성 배아를 생산 감소 용량왔다 24를 보여 주었다. DLK-DIO3 유전자 클러스터에서의 비정상적 메틸화 패턴 근본적인 원인 24로 확인되었다. 그러나, 리 프로그래밍 동안 미디어에 50 μg / ml의 농도로 아스코르브 산의 첨가를 배체 보완 유능한 IPS 세포 (24)를 생산한다. 대안으로 재기록 가능한 마우스 모델에서도 아스코르브 산 처리 (25)의 부재하에 배체 유능한 만능 줄기 세포를 제조 할 수있는 다른 화학 양론에 리 프로그래밍 인자를 발현하도록 조작 된 것을 알려드립니다. 그러나 우리 손 세포에서 상당히 낮은 주파수를 비교하여이 균주 다시 프로그래밍에서 본원에 사용 된 마우스 모드리터. 이 논문에 기재된 방법은, 모집단의 내화물 벌크로부터 리 프로그래밍 중간체의 분리를 허용하고 예를 해부 프로파일 링 unfractioned 인구를 사용할 필요없이 이전의 한계를 제거, 재 프로그래밍 과정을 이해하기 위해 유용한 도구 (것처럼 보여야 내화성 셀로부터 하이 신호 노이즈). 본원에 기재된 항체의 조합은 그러나 추가적인 세포 표면 마커는 더 높은 순도 중간체를 수득 할 수 앞으로 발견 될 가능성이 높은 순도 마우스 세포에서 중간체의 분리를 허용한다. SSEA-1의 발현은 인간의 유도 만능 줄기 세포의 특징되지 않고,이 프로토콜로 인간 기원의 세포를 재 프로그래밍에 사용할 수 없음을 유의하시기 바랍니다. 결론적으로, 한 번 설명한 방법과 격리 재 프로그래밍 중간체 발현 profilin 포함한 분자 분석을 위해 사용될 수있다g, 크로 마틴 면역 침강, methylome 분석, 단백질 분석.

배아 줄기 (ES) 세포를 포배기 배아 (1)의 내부 세포 덩어리로부터 유도된다. 적절한 배양 조건에서 그들은 자기 갱신과 만능 남아있다. 2006 년 야마나카와 동료들은 성숙한 세포가 전사의 강제 식으로 소위 유도 만능 줄기 (IPS) 세포로 요인을 재 프로그램 될 수 있다는 것을 보여 주었다 월 4, KLF-4, 삭스-2, C-Myc와 (OKSM) 2. IPS 세포는 ES 세포와 같은, 신체의 모든 세포 유형을 야기 할 수 있지만, 그것들은 ES 세포의 3 세대를 둘러싼 윤리적 제약 자유 롭다. 또한, 유도 만능 줄기 세포는 개인 재생 의학의 약속을 수행하고 4,5를 선별 질병 모델링과 같은 애플리케이션을 위해 체외 약물에 엄청난 잠재력을 보유. 이 발휘하기위한 재 프로그래밍 기술을 위하여, 핵 리 프로그래밍의 기본 메커니즘은 완전히 이해 될 필요가있다. 그러나 노력은 프로그램을 다시 두드려 해부하기hway는 세포의 매우 작은 숫자 (0.1 %)을 재 프로그래밍한다는 사실에 의해 방해되어왔다. 성공적으로 재 프로그램 섬유 아세포 리 프로그래밍, 내인성 능성 코어 네트워크 11-14의 활성화의 최종 단계에서 전이 상피 및 간엽에 6-10 포함 이벤트의 고유 일련 겪는 것으로보고되었다. 우리 등 12,13,15-17 최근 내화물 벌크 모집단 드문 중간체의 분리를 허용 세포 표면 마커의 세트를 확인했다. 프로그램을 다시 마우스 배아 섬유 아 세포 (MEFs)은 2 주 동안 재 프로그래밍 과정 15시 네 - 1.2, Ssea1하고 (다른 사람의 사이에서)는 EpCAM의 표현의 변화를 겪는다. 초기 MEFs의 일부를 재 프로그램하는 동안 섬유 아세포의 정체성 마커 (네 - 1.2)의 발현을 하향 조절 한 다음 만능 관련 마커 SSEA-1 (12)을 표현 시작합니다. 재 프로그래밍 Ssea1 양성 세포의 마지막 단계 동안 reactiv같은 월 4 10-13,15 같은 내인성 만능 유전자를 먹었다. 이 마지막 천이 검출는 EpCAM의 식 (도 1 참조) 또는 후단 PECAM (15)에 의해 세포 표면에 표시된다. 최근 오말리 등 알. 재 프로그래밍 중간체의 식별을위한 네 - 1.2 및 SSEA-1을 대체 또는 보완 등의 CD44와 iCAM1의 사용을보고했다. 우리는 이전에 FACS이 세포 표면 마커 15, 18을 기준으로 0 일, 3 일, 6 일, 9 일 및 12 일 재 프로그래밍 문화 프로그램을 다시 중간체뿐만 아니라에서 설립 된 만능 줄기 세포주를 추출했다. 아래에 설명 된 리 프로그래밍 시스템 및 조건을 위해 우리는 인구가 균일 조용하지만, 확인 된 중간 집단의 이질성 어느 정도의가 있음을 단일 세포 수준에서 나타났습니다. 이들 개체군 내의 셀의 서브 세트는 각각 다음 STA에 진출 할 수 있다는 점에 유의재 프로그래밍 과정의 GE와 광범위 이전에 15,19을 특징으로 한 다른 효율성에서 유도 만능 줄기 세포 식민지에 상승을 제공합니다. 또한, 이러한 인구의 재 프로그래밍 효율은 재 도금과 문화 조건에뿐만 아니라 따라 달라집니다. 실험 재현성을 높이기 위해 우리는 Rosa26 궤적의 제어 및 독시사이클린 반응 촉진제 (20, 21)의 제어하에있는 polycistronic OKSM 카세트에서 transcriptional transactivator로 (m2rtTA)를 표현하기 위해 설계되었습니다 재 프로그래밍 가능한 마우스 변형을 사용합니다. 이 마우스 모델을 사용하여 만능 줄기 세포의 발생, 즉, 숫자와 바이러스 인서트의 삽입 부위의 위치에서 전지 셀과 변동 이종 초기 모집단의 전통적인 방법의 바이러스 성 부작용을 우회. 두 유전자 변형 마우스 변종 (OKSM, m2rtTA), 잭슨 연구소의 동형 접합체 (homozygote) 설립자 동물로 사용할 수는 reprogra를 확립하기 위해 교차되어야한다mmable 마우스 모델 (도 2 참조). 이 논문에서는, MEFs를 유도 만능 줄기 세포를 생성하고, FACS에 의해 변환 과정의 여러 단계에서 리 프로그래밍 중간체를 분리하는 방법에 대해 상세히 설명한다.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

E13.5 마우스 태아의 박리, 세분화 및 도금 후 10cm 접시 약 1~2일 포화 상태에 도달 할 것으로 예상된다. 문화가 제대로 cellularized되지 않은 조직의 일부 부착 조각을 포함하는이 단계에서, 그것은 정상입니다. 이러한 계대 후 사라집니다. 독시 싸이클린 유도되면, 재 프로그래밍 MEFs는 별개의 형태 학적 변화를 겪는다. 일 6 주위에, 초기 식민지 같은 패치 (그림 4C)를 등장하기 시작해야한다. 이들은 또한 문화에 따라 크기가 계속 증가 할 것이다 (그림 4D, E 참조). 좋은 프로그램을 다시 실험은 처음에 5 × 10 5 세포 (그림 4E) 글로리 T75 500&gt;에서 식민지를 발생한다. 설립 만능 문화 특성 돔 모양의 식민지를 소유하고 대부분은 분화 된 세포 (그림 4 층)의 결여해야한다. 유도 만능 줄기 cultu의 경우에 추가 계대입술은 미분화 / 부분적으로 재 프로그램 세포를 제거해야 할 수 있습니다; 세포의 합류 플라스크 조사 MEFs의 피더 레이어 상 1:10 비율로 분할 될 수있다. 전술 한 바와 같이, 재 프로그래밍 동안 형태 학적 및 분자 변화는 네-1.2, SSEA-1, 궁극적으로는 EpCAM (도 7A-F 참조) FACS 프로필의 변화에 의해 반영된다. MEFs가 네 - 1.2 주로 긍정적 인 다른 마커에 대한 부정적인 반면, 이전에 12,15 보도 된 바와 같이, 3 일 문화는 이미 크게 다를. 세포의 큰 비율은 네-1.2의 표현이 네 - 1.2 음성 세포의 아주 작은 부분 집합 SSEA-1,이 시점에 대한 중간 실제 재 프로그래밍 양성되고있다을 통제하기 시작했다. 일에서 3 문화를 추출 할 수 있습니다 재 프로그래밍 중간체의 수의 비율이 매우 예측할 수 SSEA-1 + / 네 - 1.2 ~ 일반적으로 viabl 1-10 % 사이의 범위에있다전자 셀. 6 및 9 일간 SSEA-1 + 세포의 증가 된 백분율에서, 보통 10 % 이상으로 잘 검출 할 수있다. 일 12도는 EpCAM 양성 라벨을 감지 할 수 SSEA-1 양성 세포의 부분 집합 주위. 가변적이며 대개 모든 생균만을 2~4%의 범위에 빠진다 SSEA-1.2 + /는 EpCAM + 세포의 비율로 12 일째 배양, 3 일 배양 같이, 중간체의 정제에 병목 현상을 나타낸다. 표 1에 제시된 리 프로그래밍 중간체 예상 수가 단지 거친 근사치로서 기능한다. 설립 선의의 유도 만능 줄기 세포 배양은 SSEA-1과는 EpCAM 강력하게 긍정적 인 것입니다. <img alt="그림 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> 재 프로그래밍 경로 동안 그림 1 표면 마커의 변화 : 섬유 아세포의 정체성 마커 네-1.2의 다운 규제의 업 규정에 의해 다음에SSEA-1. 능성 상태를 향해 SSEA-1 양성 세포의 부분 집합의 전환은 하루 12 주위는 EpCAM의 인수로 표시됩니다. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림이" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> 그림 2 재 프로그래밍 마우스 모델의 도식 표현은 :. m2rtTA 표현이 재하 활성 Rosa26 궤적의 제어하에 독시사이클린 (doxycycline)의 존재에서 (DOX)가 m2rtTA 단백질은 콜라겐 1A1에서 테트라 사이클린 의존성 프로모터 (tetOP)에 결합 (Col1a1) 네 가지 요인 카세트의 발현을 초래 궤적. 두 개의 시스 트론 카세트는 내부 리보솜 항목 사이트 (IRES)에 의해 연결되어있다. 월 4 / KLF-4와 삭스-2 / C-Myc와 오픈 읽기 프레임 푸 아르<html> 자기 절단 F2A 및 E2A 시퀀스가 나오지였다. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> 그림 3 배아 해부 : 10 ml의 PBS와 (B)로 채워진 10cm 접시에 (A) 전송 자궁 뿔은 한 배아를 포함하는 조각으로 잘라. (C) 집게 추가 배아 조직에서 배아를 해제하고 머리, 사지, 꼬리와 내장을 제거 사용. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 레 / ftp_upload / 51,728 / 51728fig4highres.jpg &quot;너비 =&quot;500 &quot;/&gt; 그림 리 프로그래밍 동안 4 형태 학적 변화. 식민지 같은 패치 이후 일 6에서 문화 명백해질. 타고난 iPSCs는 돔 모양의 형태를 특징으로한다. (A)의 날 0 / MEFs, (B) 3 일, (C) 6 일, (D)의 날 (9), (E)의 날 (12), (F)는 세포 배양을 유도 만능 줄기. 스케일 바 :. 200 μm의 <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> 그림 5 기본 FACS 설정은. (A) 앞으로 분산 형 지역 오점 대 사이드 분산과 파편을 제외합니다. (B)앞으로 분산 높은 오점 대 앞으로 분산 형 지역 단일 세포 인구에 게이팅에 의해 비 파편에서 집계를 제외합니다. (C). 얼룩 앞으로 분산 형 지역 대 PI 채널과 PI 낮은 사건에 게이팅에 의해 단일 세포 인구에서 죽은 세포를 제외 <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> 그림 6 게이팅. 네 - 1.2 + / SSEA-1 세포, 네 - 1.2 ~ / SSEA-1 세포에 대한 게이트를 설정 레이블이없는 대조군 세포를 사용하여 (A, B) 네 - 1.2 ~ / SSEA-1 + 세포. (C)는 EpCAM 긍정적는 EpCAM 부정적인 세포 게이트를 설정하는 레이블이없는 대조군 세포를 사용합니다. + / - 1.2 ~ 네 세포를 분리 할 수 SSEA-1 (D)긍정적는 EpCAM 부정적인 인구로는 EpCAM로. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> 그림 7 네 - 1.2 재 프로그래밍 과정의 여러 단계에서 SSEA-1 FACS의 말 대. (A)의 날 0 / MEFs, (B) 3 일, (C) 6 일, (D)의 날 (9), (E)의 날 12 (F) 만능 줄기 세포 배양. 표 1은 OKSM 및 m2rtTA에 대한 배아 이형의 P1 MEFs에 파종 밀도, 플라스크 번호와 예상 결과를 제시했다. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">시간을 클릭 해주세요</a>감수는이 그림의 더 큰 버전을 볼 수 있습니다. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 일 </td><td> T75 플라스크의 수 일 0에 시드 </td><td> FACS 후 Ssea1 + 세포의 총 수 </td><td> FACS 후 Ssea1 + /는 EpCAM + 세포의 총 수 </td></tr><tr><td> 3 </td><td> 8 </td><td> 2000000 </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2000000 </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2000000 </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10000000 </td><td> 2000000 </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

재 프로그래밍 가능한 마우스 모델에서 유도 만능 줄기 세포 중간체의 세포 표면 마커 중재 정화

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K 조회수.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

비디오: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

높은 활성 효모 변이의 색층 정화

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

연구

생물학

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Kinesin의 분리 및 정제에서 Drosophila 태아

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

낮은 친화력 세포 수용체 - 리간드 상호 작용의 확장 가능한 감지를위한 욕망 기반의 세포 상호 작용 검사 (AVEXIS)

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

유도 만능의 줄기 세포에서 파생 마우스의 생성

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Glycopeptide Capture for Cell Surface Proteomics

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, differentiation, and proliferation. A comprehensive characterization of these proteins provides rich information for biomarker discovery, cell-type identification, and drug-target selection, as well as helping to advance our understanding of cellular biology and physiology. Surface proteins, however, pose significant analytical challenges, because of their inherently low abundance, high hydrophobicity, and heavy post-translational modifications. Taking advantage of the prevalent glycosylation on surface proteins, we introduce here a high-throughput glycopeptide-capture approach that integrates the advantages of several existing N-glycoproteomics means. Our method can enrich the glycopeptides derived from surface proteins and remove their glycans for facile proteomics using LC-MS. The resolved N-glycoproteome comprises the information of protein identity and quantity as well as their sites of glycosylation. This method has been applied to a series of studies in areas including cancer, stem cells, and drug toxicity. The limitation of the method lies in the low abundance of surface membrane proteins, such that a relatively large quantity of samples is required for this analysis compared to studies centered on cytosolic proteins.

Cell surface proteins are biologically important and widely glycosylated. We introduce here a glycopeptide-capture approach to solubilize, enrich, and deglycosylate these proteins for facile LC-MS based proteomic analyses.

세포 표면 단백질 체학 (Proteomics)에 대한 글리코 펩타이드 캡처

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

인간 iPS 세포의 마이크로 RNA 발현 프로파일, IP의 유래 망막 색소 상피 세포, 태아의 망막 색소 상피

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

에피 솜과 HDAC 억제제를 사용하여 혈액에서 효율적인 유도 만능 줄기 세포 생성

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Light Sheet Fluorescence Microscopy of Plant Roots Growing on the Surface of a Gel

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the observation of the whole organ with a high spatial- as well as temporal resolution over prolonged periods of time, which may cause photo-toxic effects. This protocol shows a plant sample preparation method for light-sheet microscopy, which is characterized by mounting the plant vertically on the surface of a gel. The plant is mounted in such a way that the roots are submerged in a liquid medium while the leaves remain in the air. In order to ensure photosynthetic activity of the plant, a custom-made lighting system illuminates the leaves. To keep the roots in darkness the water surface is covered with sheets of black plastic foil. This method allows long-term imaging of plant organ development in standardized conditions.

This protocol shows a plant sample preparation method for light-sheet microscopy. The setup is characterized by mounting the plant vertically on the surface of a gel and letting it grow in controlled bright conditions. This allows long-term observation of plant organ development in standardized conditions.

겔의 표면에 성장 식물 뿌리의 가벼운 시트 형광 현미경

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

트랜스-내부 세포 배아 줄기 세포의 대량 주입 리드 더 높은 Chimerism 요금

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

마우스 망막 안료 상피에서 1 차 셀 문화

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...