Wir würden gerne die finanzielle Unterstützung von der Monash Larkins Programm sowie aus einer NHMRC CDF und NHMRC Projektförderung anzuerkennen. Darüber hinaus möchten wir Sue Mei Lim für ihre konstruktive Vorschläge für ihre Unterstützung und die Monash flow Team (insbesondere Adam Dinsdale) für ihre Hilfe bei der Produktion des Videos danken, Edwina McGlinn.

1. Geräteeinstellungen / Reagenz-Vorbereitung / Genotypisierung <ol><li> Bereiten iPS-Zellmedium: Nachtrag 500 ml Knockout DMEM-Medium mit 75 ml fetales Rinderserum (FBS), 5 ml L-Glutamin, 5 ml Nicht-essentielle Aminosäuren, 500 ul β-Mercaptoethanol, 5 x 10 5 Einheiten Leukämie-hemmenden Faktor ( LIF). Bitte beachten Sie Materialliste für die Produktinformationen und Kaufhinweise für Reagenzien im Rahmen dieser Handschrift verwendet. </li><li> Bereiten MEF Medium: Nachtrag 500 ml DMEM-Medium mit 50 ml FBS, 5 ml L-Glutamin, 5 ml Nicht-essentielle Aminosäuren, 5 ml Natrium Pyruvat, 500 ul β-Mercaptoethanol. </li><li> Bereiten Gefriermedium: Für 10 ml, kombinieren 9 ml FBS mit 1 ml DMSO. </li><li> Vorbereitung Gelatine beschichteten Schalen In 3-5 ml 0,1% Schweine-Gelatine-Lösung in eine T75-Flasche, Inkubieren bei Raumtemperatur für mindestens 10 min und saugen unmittelbar vor Gebrauch. </li><li> Bereiten FACS Markierungsmedium: Für 10 ml, 9,9 ml kombinieren PBS mit 0,1 ml FBS. </li><li> Ausführeneine PCR zur Genotypisierung Rosa26 m2rtTA locus: Führen Reaktionen mit Taq-DNA-Polymerase gemäß den Anweisungen des Herstellers. Verwenden Sie eine modifizierte MgCl 2 -Konzentration von 3,5 mm und die folgenden 3 Primer: oIMR8052: 5 &#39;GCG AAG AGT TTG TCC TCA ACC 3&#39;, oIMR8545: 5&#39;AAA GTC GCT CTG AGT TGT TAT 3 &#39;, oIMR8546: 5&#39; GGA GCG GGA GAA GAT ATG ATG 3 &#39;. Zyklusbedingungen: 94 ° C für 3 min; 35 Zyklen (94 ° C für 30 sec, 65 ° C für 1 min, 72 ° C für 1 min); 72 ° C für 2 min; halten bei 12 ° C. Erwartete Produktgröße: 650 bp für Wildtyp-Allel und 340 bp für die mutierte Allel. </li><li> Führen Sie eine Genotypisierung PCR für die Kollagen-StemCa / OKSM Ort: Führen Reaktionen mit Taq DNA Polymerase, wie pro Anweisungen. Verwenden Sie eine modifizierte MgCl 2 -Konzentration von 2,5 mm und die folgenden 3 Primer: col / FRT-B: 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, col / frtA1: 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, col / frtC1: 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. Zyklusbedingungen: 95 ° C für 1 min: 2 Zyklen (94 ° C für 30 sec, 70 ° C für 45 sec), 6 Zyklen (94 ° C für 30 sec, 68 ° C für 45 sec) und 30 Zyklen von (94 ° C für 20 sec, 60 ° C für 1 min); 72 ° C für 5 min; halten bei 12 ° C. Erwartete Produktgröße: 331 bp für Wildtyp-Allel und 551 bp für mutierte Allel. </li><li> Führen Sie alle Schritte Zentrifugation bei 400 g für 3 min bei 4 ° C. </li></ol> 2. Erzeugung von embryonalen Maus-Fibroblasten <ol><li> Führen Sie eine Zeitüberschreitung Paarung zwischen einem Tier der OKSM Stamm mit einem Mitglied des anderen Geschlechts des m2rtTA Belastung. Ernte Embryonen embryonale Tag 13.5 durch Keulung, die Mutter und das Entfernen des Uterushorn. Vor dem Entfernen des Uterushorns, sprühen die Bauchregion mit einer 80% igen Ethanollösung, um eine mikrobielle Kontamination zu vermeiden. </li><li> Übertragen des Uterushorns in eine 10 cm-Gewebekulturschale mit 10 ml steriler phosphatgepufferter Salzlösung (PBS). Verwendung sterilisiert chirurgischer Qualität Schere, um die Uterushorn in Stücke geschnitten, die einen Embryo (siehe 3A, B). </li><li> Verwenden Sie ein Dissektionsmikroskop (idealerweise innerhalb einer Gewebekultur Haube platziert) und sterilisiert Pinzette vorsichtig die Gebärmutterhülle und die extraembryonalen Membranen jedem Embryo umgibt. Übertragen Sie jede Embryo zu einem separaten 10-cm-Schale mit 10 ml PBS. </li><li> Gehen Sie durch das Embryonen Kopf, Gliedmaßen, Schwanz und inneren Organen (Herz, Leber, Darm etc.) mit der Pinzette zu entfernen (siehe Abbildung 3C). Übertragen Kopf des Embryos in ein 1,5-ml-Röhrchen und frieren unten, damit es für die Genotypisierung verwendet werden, wenn nötig. </li><li> Transfer des Embryos Oberkörper in ein leeres 10cm Platte und mit zwei chirurgische Messer, um den Embryo für 2 min Blatt vor den Mund. Gib 200 ul Trypsin / EDTA-Lösung auf die Oberseite des zerkleinerten Embryo und Inkubation für 3-5 min bei RT. Weiter Hacken für weitere 2 min, 2 ml MEF Medien in<html> aktivieren Trypsin, und dann in einem 15-ml-Tube übertragen. </li><li> Verwenden Sie ein 1.000 ul Pipette, um das Gewebe durch vorsichtiges Pipettieren weiter mechanisch zu trennen. Transfer zu einem Gelatine beschichtete 10 cm Schüssel und fügen Sie eine zusätzliche 10 ml MEF-Medien. Hinweis: Beide normoxischen und hypoxischen Inkubatoren für die Kultur verwendet werden, beziehen sich auf Diskussion für weitere Informationen. </li><li> Nach 24-48 Stunden sollte die Platte dicht mit MEFs abgedeckt werden. </li><li> Alternativ können die Zellen dann weiter vermehrt oder eingefroren werden nach unten. Für das Einfrieren von Zellen, entfernen Sie den Kulturmedien, spülen Sie die Schale mit 10 ml PBS, um Spuren von Medien und Overlay mit 3 ml Trypsin / EDTA-Lösung zu entfernen. Inkubation für 3-5 min bei 37 ° C, Inaktivierung von Trypsin-Verdau durch Zugabe von 5 ml MEF Medien und in ein 15 ml Zentrifugenröhrchen. Spin-Down und das Pellet in 3 ml Einfrieren Medien. Transfer zum 3 Kryoröhrchen und frieren in einer Zelle Gefrierbehälter. </li></ol> 3. Reprogrammierung von MEFs ove_content &quot;&gt; Hinweis: Pellet-Zellen durch Zentrifugation bei 200 g für 5 min bei 4 ° C und verwenden Sie normoxic Gewebekultur-Inkubatoren für eine Neuprogrammierung Es kann von Vorteil sein, ableiten und erweitern MEFs unter hypoxischen Bedingungen (5% Sauerstoff, siehe Diskussion für weitere Informationen. ). <ol><li> Tauen schnell einen niedrigen Durchgang Kryoröhrchen (P0-P1, 2-3 Mio Zellen) in einem Wasserbad (37 ° C) und den Inhalt zu übertragen in eine Röhre mit 10 ml vorgewärmten MEF Medien. Pellet-Zellen resuspendieren in 12 ml frischem MEF Medien, übertragen in eine Gelatine beschichtete T75 Kulturgefäß und lassen Zellen für 24-48 Stunden, bevor Sie fortfahren erholen. Hinweis: MEFs kann auch direkt nach der Ableitung verwendet werden. </li><li> Nach der Entfernung des Kulturmediums, Waschen mit PBS und MEFs cellularize durch Überlagerung mit einer Trypsin / EDTA-Lösung (3 ml für 3-5 min bei 37 ° C). Quench Trypsin durch Zugabe von 5 ml MEF Medien und weiteren distanzieren Zellen durch vorsichtiges Mischen mit einer 10 ml Pipette. Bestimmen die Zellzahlen mit einer Zählkammer. </li><li> Für reprogrammierung Experimenten Saatgut MEFs auf mit Gelatine beschichteten T75-Kolben mit Dichten von 6,7 x 10 3 Zellen / cm 2 (~ 0,5 Mio Zellen pro Kolben) in iPSC Medien, enthaltend 2 ug / ml Doxycyclin. Siehe Tabelle 1 bezüglich der Aussaat Empfehlungen auf rund 2 Mio Umprogrammierung Zwischenprodukte für jeden Zeitpunkt zu erhalten. Anmerkung: Die Neuprogrammierung beginnt mit der Zugabe von Doxycyclin (2 ug / ml) ergänztem Medium </li><li> Für die ersten 6 Tage ersetzen Medien jeden zweiten Tag mit frischen Doxycyclin ergänzt iPSC Medien (12 ml Medium pro T75-Flasche). Über diesen Punkt hinaus zu verlängern Medien täglich, wenn es hohen Zellzahlen. Verdoppeln Sie die Lautstärke, wenn Kultur Medien Änderungen können nur jeden zweiten Tag durchgeführt werden. </li><li> Ernte Umprogrammierung Zwischenprodukte bei den erforderlichen Zeitpunkten (Vorschlag: Tag 3, 6, 9, 12) durch Entfernen Medien, Spülen mit geeigneten Volumen PBS (10 ml für eine T75-Flasche) und Überlagerung mit Trypsin-EDTA-Lösung (3 ml für eine T75-Kolben). Bebrütenfür 3-5 min bei 37 ° C und Abschrecken durch Zugabe von 5 ml iPSC Medien gefolgt von vorsichtiges Pipettieren. </li><li> Zählen Zellsuspension mit einem Hämozytometer (siehe oben), ein Pellet durch Zentrifugation absaugen Überstand und Zellen in 10 ml PBS, um alle Spuren von Trypsin zu entfernen. Pellet-Zellen wieder absaugen Überstand und fahren Sie mit Schritt 4.1, um die Neuprogrammierung Zwischenprodukte zu isolieren. Hinweis: Zellen, die eine Umprogrammierung können kryokonserviert und für die FACS-Isolierung aufgetaut zu einem späteren Zeitpunkt sein. </li><li> Vollständig neu programmiert iPS-Kulturen zu schaffen, wachsen Zellen im DOX frei iPSC Medien für weitere 4-7 Tage. Hinweis: Erfolgreich Umprogrammierung Kulturen wird eine große Anzahl von Kolonien, die von Tag 12 enthalten (siehe Abbildung 4). Während dieser Zeit werden abweichende iPS-Zellen, die noch OKSM Ausdruck erfordern verschwinden. </li><li> Zunächst Saatgut bestrahlten MEFs bei einer Dichte von 15 x 10 3 Zellen / cm 2: Alternativ kann die verbleibenden vollständig reprogrammiert iPS Kulturen ausbreiten </sbis&gt; in 12 ml iPSC Medien auf einen mit Gelatine beschichteten T75-Kolben einen Tag oder 6 Stunden vor den Experimenten. </li><li> Als nächstes cellularize iPS Zellkulturen durch Entfernen von Medien, Spülen der T75-Kolben mit 10 ml PBS, Überschichten mit 3 ml Trypsin-EDTA-Lösung und Inkubation für 3-5 min bei 37 ° C aufweist. Stillen Trypsin durch Zugabe von 5 ml iPSC Medien, gefolgt von leichtem Mischen, Transfer zu einem 15 ml konischen Röhrchen, Spin-down und dann in 10 ml iPS Medien suspendiert. </li><li> Übertragen 500 ul dieser Zellsuspension auf den bestrahlten MEFs (T75-Kolben) und ermöglichen die Kulturen für 4-5 Tage wachsen. Hinweis: Gegründet iPS Kulturen kryokonserviert oder für Experimente genutzt werden. Klonalen Zelllinien können durch Aufnehmen einzelner iPSC Kolonien unter einem Binokular 22 abgeleitet werden. </li><li> Cryo bewahren konfluenten iPSC Kulturen wie in 2.8 für MEFs beschrieben. </li></ol> 4. Antikörpermarkierung <ol><li> Resuspendieren Zellpellets der Reprogrammierung Kulturen, wie in Abschnitt 3 hergestellt, inFACS Etikettenmedium mit Antikörpern ergänzt (anti-Thy-1.2 pacific blue 1: 400, anti-SSEA-1-Biotin-1: 400 und anti-EpCAM Fitc 1: 400). Verwenden Sie 200 ul ergänzt Markierungsmischung pro 5 Millionen Zellen und Inkubation auf Eis. </li><li> Nach 10 Minuten vorsichtig auf die Tube, um die Zellen für weitere 10 min auf Eis inkubiert und erneut zu suspendieren. 10 ml kaltem PBS pro Röhrchen und Spin-Down. </li><li> Für jedes Röhrchen zu färbenden vorzubereiten 200 ul Etikettenmedium mit 1 ul Streptavidin-PeCy7 (1: 200) ergänzt werden, je 5 Millionen Zellen. Wenn Zellen wurden pelletiert, der Überstand vorsichtig absaugen und resuspendieren in einem geeigneten Volumen von Etikettenmedium mit Streptavidin-PeCy7 ergänzt. </li><li> Halten Zellen auf Eis für 10 min, tippen, um wieder zu suspendieren, Inkubation für weitere 10 min auf Eis, 10 ml kaltem PBS pro Röhrchen, Spin-down und saugen Stand. </li><li> Resuspendieren Zellpellets in Etikettenmedium mit Propidiumiodid (PI) (2 ug / ml) ergänzt war, bei etwa 1 x 10 7 Zellen / ml. Zellklumpen zu entfernen, indem die Suspension durch ein 70 um Sieb. Transferzellen zu einem geeigneten FACS-Röhrchen und halten sie auf dem Eis. </li><li> Bereiten getrennte Proben mit einzelnen Antikörper (anti-Thy-1.2, Anti-SSea-1 und anti-EpCAM). HINWEIS: Diese sind erforderlich, um die Farbkompensation in den drei Kanälen in der Analyse verwendet werden, vornehmen. Darüber hinaus werden nicht-markierten Zellen benötigt, um Spannungen und Toren für die Sortierung eingestellt. Idealer iPS-Zellen sind für die Entschädigung verwendet: Aktien von 0,5-1 x 10 6 iPS-Zellen an bestrahlten MEFs gehalten werden in Kryoröhrchen in flüssigem Stickstoff gelagert. Die Anwesenheit von MEF ist unerlässlich, um ein Signal in der Thy-1.2 Kanal. </li><li> Tauwetter ein Kryoröhrchen von iPS-Zellen wie für MEFs (Abschnitt 3) beschrieben. Nach der Zentrifugation wird Zellen in 800 ul Markierungspuffer und 200 ul dieser Probe zur Seite, als dem unmarkierten Steuerung eingestellt. </li><li> Verwenden Sie die restlichen Zellen als Entschädigung Kontrollen. Kluft zwischen Zellen drei 15-ml-Röhrchen und fügen Antikörperwie folgt: Pacific Blue Entschädigung Kontrolle: 0,5 ul der Anti-Thy-1.2 Pacific Blue-Antikörper. Fitc Ausgleichsrohr: add 0,5 ul des anti-EpCAM-Antikörper Fitc. Pe-Cy7 Kompensationssteuerung: 0,5 ul der Anti SSea-1-Biotin-Antikörper. </li><li> Halten Zell-Antikörperproben auf Eis für 10 min, mischen, indem Sie und Inkubation für 10 min auf Eis. </li><li> Wasch Proben mit 10 ml kaltem PBS, um ungebundene Antikörper zu entfernen, drehen Zellen nach unten und saugen Sie den Überstand. Resuspendieren Zellpellets in 200 ul FACS-Markierungsmittel. </li><li> Für anti-SSEA-1-Biotin markierten Proben, fügen Sie ein Streptavidin-Konjugat PeCy7 (1 ul pro 200 ul Zellen). Label-Zellen wie für primäre Antikörper (SSEA-1-Biotin) beschrieben. </li><li> Geben Sie alle Proben, einschließlich der unmarkierten Kontrolle durch eine 70 um Sieb und fügen PI (2 pg / ml). Übertragen Zellen FACS-Röhrchen und auf Eis zu halten, bis sie benötigt. </li></ol> 5. FACS Isolierung von Zwischenprodukten Hinweis:Zellen werden unter Verwendung eines Fluoreszenz-aktivierten Zellsortierer mit 405 nm, 488 nm und 560 nm Anregungslaser und einer 100 um Düsen sortiert. <ol><li> Eingerichtet Spannungen für vorne und Seitenstreuung, so dass die Zellpopulation richtig sichtbar wird. Ziehung einer Gate um die Zellen, wie in 5A gezeigt, um Verschmutzungen auszuschließen. Hinweis: Der korrekte Aufbau von Spannungen auf der Zellsortierer kann komplex sein und erfordert einen erfahrenen FACS-Operator. </li><li> Verwendung Vorwärtsstreuung (FSC) Höhe gegen die FSC-Bereich, um Aggregate (5B) auszuschließen. </li><li> Visualisieren Sie die PI-Kanal im Vergleich zu FSC Tor in auf den negativen PI lebenden Zellen (5C). </li><li> Verwenden Sie die nicht-markierten Zellen, um die Spannungen für die Fluoreszenzkanäle von PB, Fitc / GFP, Pe-Cy7 einzustellen. Idealer positionieren Zellpopulation an dem unteren Ende des jeweiligen Kanals. </li><li> Eingestellt Gates mit dem unmarkierten Kontrollzellen, wie in 6A, B sub Fraktion der Umprogrammierung gezeigt Kultnahmen in Tag 3, 6 und 9 Populationen: SSea-1 / Thy-1.2 +-Zellen; SSea-1 / Thy-1.2-Zellen; und die Neuprogrammierung Zwischenprodukte SSEA-1 + / Thy-1.2-Zellen. </li><li> Weiter unterteilen den Tag 9 SSEA-1 + / Thy-1.2-Fraktion mit der Pe-Cy7 gegen Fitc Blot; ziehen Toren um SSE-a1 + / EpCAM + Zellen und die SSEA-1 + / Epcam- Zellen. Eingestellt Gates mit dem unmarkierten Kontrollzellen, wie in 6C, D dargestellt. </li><li> Vor dem Sortieren die gewünschten Subpopulationen (siehe Abbildung 7 für repräsentative FACS-Profile für MEFs, Tag 3 / Tag 6 / Tag 9 / Tag 12 Kulturen und iPS-Zellen) prefill geeignete Sammelrohre mit iPS-Zellmedien (1-2 ml). </li><li> Führen FACS-Sortierung nach Hersteller-Protokoll. </li><li> Nach FACS Isolierung einreichen Zellen, molekulare Profilierung (RNA / Protein-Extraktion, Chromatinimmunpräzipitation, DNA-Analyse Methylom etc.). Alternativ können die verschiedenen Zellfraktionen kultiviert werden. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

Die Autoren haben nichts zu offenbaren.

Um erfolgreich zu reprogrammieren MEFs in iPS-Zellen und Reprogrammierung Zwischenprodukte bei hohen Menge zu reinigen ist es wichtig, sich bewusst von Faktoren, die einen Einfluss auf die Gesamteffizienz haben. Insbesondere die Reihe der FBS verwendet, um iPS-Medien ergänzen können einen nachteiligen Effekt haben. Im Allgemeinen wurden positive Erfahrungen mit embryonalen Stammzellen (ES) Zell qualifizierte FBS aber Chargenprüfung von Seren aus einer Vielzahl von Anbietern könnte eine billigere Alternative zu identifizieren gemacht. Ein weiterer Faktor, der Auswirkungen auf die Umprogrammierung Effizienz ist der Genotyp des MEFs 15,20. Obwohl MEFs von Mäusen, die heterozygot (Het) für sowohl die OKSM und m2rtTA Locus keine Umprogrammierung homozygousity an einem oder beiden Loci führt zu einer höheren Effizienz Umprogrammierung abgeleitet. Tatsächlich MEFs von den Nachkommen von OKSM und m2rtTA Kreuze abgeleiteten zeigen einen Anstieg der Neuprogrammierung Effizienz in der folgenden Reihenfolge (OKSM / m2rtTA): het / het &lt;homo / het &lt;het / homo &lt;homo /Homo (bitte beachten Sie, dass die Zahlen in Tabelle 1 angegeben sind het / het Tiere). In den seltenen Fällen eine männliche Homo / homo Tier festgestellt, kann ein Harem Paarung mit mehreren Weibchen m2rtTA eingerichtet werden. Alle Nachkommen dieser Kreuzungen wird het werden / homo für die OKSM / m2rtTA Loci auf. Darüber hinaus ist die schnelle Genotypisierung von Würfen empfohlen, da größere Würfe bei Verwendung jüngere Mäuse zur Züchtung (6-15 Wochen alt) erhalten. Darüber hinaus ist die Verwendung von niedrigen Passage MEFs für Reprogrammierung unterstrichen 23. Wenn MEFs wurden in einer Gewebekultur-Inkubator normoxic abgeleitet und erweitert empfehlen wir dringend, nur diese Zellen bis zu Durchgang 2. Allerdings, wenn der Experimentator hat Zugang zu einem niedrigen Sauerstoff Inkubator (5% Sauerstoff) für die Ableitung und Erweiterung des MEF, Durchgang Zahlen so hoch wie 3 noch gut 23 Ergebnisse ergeben. Bei Begegnungen der Experimentator Probleme mit Umprogrammierung verbunden sind,<html> Wie beschrieben sind die wahrscheinlichsten Erklärungen hohe Zahl von Passagen zum Zeitpunkt des DOX hinaus falschen Genotyp der Mäuse oder die Verwendung von FBS, die nicht förderlich für IPS Zellgeneration. In seltenen Fällen haben wir festgestellt, dass MEFs waren nicht in der Lage, selbst unter idealen Bedingungen neu zu programmieren. In diesen Fällen wurde eine spontane de novo Deletion innerhalb des offenen Leserahmen m2rtTA als der eigentliche Grund identifiziert. Diese Methodik wurde erfolgreich angepasst, um SSea-1 + Zwischenprodukte über magnetische Zelltrennung (MACS) zu extrahieren. Es gibt einen klaren Zeitvorteil bei Verwendung von MACS jedoch die SSea-1 + Zellpopulationen &#39;Reinheit wird auf 80-90%, statt mehr als 95%, die abhängig von der Art des Experiments werden die Zellen könnten Pose bestimmt reduziert ein Problem. Somit besteht eine Möglichkeit, MACS verwenden, um für SSEA-1 +-Zellen, gefolgt von FACS, um die Reinheit und / oder eine Fraktion davon in SSEA-1 + / EpCAM + und SSEA-1 + / Epcam- Zellen erhöhen bereichern. &quot;&gt; Während die iPS-Zellen von der skizzierten Protokoll und Maus-Modell produziert haben gezeigt worden, um pluripotent und effektiv dazu beitragen, allen Geweben von chimären Tiere 15,20, eine reduzierte Kapazität von Embryonen ausschließlich aus diesen iPS-Zellen über tetraploiden Komplementierung zusammen produzieren ist 24 gezeigt. Aberrant Methylierungsmuster in der Dlk-Dio3 Gencluster wurden als Ursache 24 identifiziert. jedoch Zugabe von Ascorbinsäure in einer Konzentration von 50 ug / ml in den Medien während der Umprogrammierung tetraploiden Komplementierung zuständigen iPS 24 zu erzeugen. Bitte wählen Sie aus dieser Sorte umprogrammieren zu deutlich niedrigeren Frequenz im Vergleich darauf hingewiesen werden, dass eine alternative reprogrammierbare Mausmodell entwickelt, um die Neuprogrammierung Faktoren an einer anderen Stöchiometrie ausdrücken kann tetraploiden zuständigen iPS-Zellen auch in Abwesenheit von Ascorbinsäure Behandlung 25 zu produzieren. jedoch in unseren Händen Zellen der hierin verwendete Mausmodusl. Die in dieser Handschrift beschriebene Methode ermöglicht die Trennung der Reprogrammierung Zwischenprodukte aus der feuerfesten Masse der Bevölkerung und sollten als wertvolles Werkzeug, um zu sezieren und zu verstehen, die Reprogrammierung, die Beseitigung der bisherigen Einschränkungen der mit unfraktioniertem Bevölkerung, um eine für die Profilerstellung (zB zu sehen ist, hohe Signal Lärm von den feuerfesten Zellen). Die hierin beschriebenen Antikörper-Kombination erlaubt die Isolierung von Zwischenprodukten aus Mauszellen mit hoher Reinheit, jedoch ist es möglich, dass zusätzliche Zelloberflächenmarker in der Zukunft, mit denen Zwischenprodukte mit noch höherer Reinheit zu erhalten, wird freigelegt. Bitte beachten Sie, dass SSea-1-Expression ist nicht ein Kennzeichen der menschlichen induzierten pluripotenten Stammzellen und als solcher diesem Protokoll kann nicht auf die Neuprogrammierung Zellen menschlichen Ursprungs verwendet werden. Abschließend kann Umprogrammierung Zwischen einmal mit der beschriebenen Methode isoliert für molekulare Analysen einschließlich der Expression Profilin verwendet werdeng, Chromatinimmunpräzipitation, Methylom Analyse und Protein-Assays.

Embryonale Stammzellen (ES-Zellen) von der inneren Zellmasse des Blastozysten Embryonen 1 abgeleitet. Unter geeigneten Kulturbedingungen sie selbst zu erneuern und bleiben pluripotent. Im Jahr 2006 Yamanaka und Kollegen gezeigt, dass reife Zellen kann durch Zwangs Expression des Transkriptions in sogenannte induzierte pluripotente Stammzellen (iPS-Zellen) umprogrammiert werden Faktoren Oct-4, Klf-4, Sox-2, c-Myc (OKSM) 2. iPS-Zellen, wie ES-Zellen, die zu allen Zelltypen des Körpers geben kann, jedoch sind sie frei von den ethischen Einschränkungen rund um die Erzeugung von ES-Zellen 3. Außerdem iPS-Zellen tragen das Versprechen der personalisierten regenerativen Medizin und halten ein enormes Potenzial für Anwendungen wie Krankheitsmodelle und in vitro Wirkstoff-Screening 4,5. Um zum Umprogrammieren Technologie, um dieses Potenzial zu erfüllen, der grundlegende Mechanismus der Kern Neuprogrammierung muss vollständig verstanden werden. Die Bemühungen um die Neuprogrammierung pat sezierenHWAY durch die Tatsache, dass nur eine sehr kleine Anzahl von Zellen umzuprogrammieren (0,1-1%) behindert. Umprogrammierung erfolgreich Fibroblasten wurde berichtet, dass eine deutliche Reihe von Veranstaltungen, darunter eine epitheliale mesenchymale Übergang 6-10, und in der letzten Phase der Reprogrammierung, die Aktivierung des endogenen Kern Pluripotenz Netzwerk 11-14 zu unterziehen. Wir und andere 12,13,15-17 haben kürzlich eine Reihe von Zelloberflächenmarkern, die für die Trennung von seltenen Zwischenprodukte aus dem feuerfesten Massenpopulation ermöglicht identifiziert. Reprogrammierung embryonalen Maus-Fibroblasten (MEF) unterzogen werden Veränderungen in der Expression von Thy-1.2, Ssea1 und EpCAM (unter anderem) in der 2-wöchigen Umprogrammierung 15. Früh während Umprogrammierung eine Teilmenge von MEFs nach unten regulieren die Expression von Fibroblasten-Identitätsmarker (Thy-1.2) und starten Sie dann die Pluripotenz-assoziierten Marker SSEA-1-12 abzugeben. Während der letzten Phase der Reprogrammierung Ssea1-positiven Zellen reACTIVaß endogenen Pluripotenz-Gene wie Oct-4 10-13,15. Dieser letzte Übergang ist an der Zelloberfläche durch eine nachweisbare Expression von EpCAM (siehe Abbildung 1) oder in einem späteren Stadium PECAM 15 gekennzeichnet. Kürzlich, O&#39;Malley et al. Berichteten über die Verwendung von CD44 und ICAM-1 als Alternative oder Ergänzung zu Thy-1.2 und SSEA-1 zur Identifizierung von Umprogrammierung Zwischenprodukte. Wir haben bereits FACS extrahiert Umprogrammierung Zwischenprodukte von Tag 0, Tag 3, Tag 6, Tag 9 und Tag 12 Umprogrammierung Kulturen, als auch von etablierten iPS-Zelllinien auf der Grundlage dieser Zelloberflächenmarker 15,18. Für die unten beschriebene Umprogrammierung System und Bedingungen haben wir auf Einzelzellebene, dass, obwohl die Bevölkerung sind ruhig homogen, es gibt eine gewisse Heterogenität in den identifizierten Zwischen Populationen gezeigt. Es ist zu beachten, dass nur eine Untergruppe von Zellen innerhalb dieser Populationen kann in die jeweils nächste STA Fortschrittge der Umprogrammierung und führen zu iPS-Zellkolonien an verschiedenen Wirkungsgrade, die zuvor ausgiebig 15,19 geprägt haben. Darüber hinaus wird die Neuprogrammierung Effizienz dieser Populationen sowie auf die Re-Beschichtung und Kulturbedingungen ab. Experimentelle Reproduzierbarkeit zu erhöhen verwenden wir eine wiederprogrammierbare Mausstamm, die konstruiert wurde, um einen Transkriptions Transaktivator (m2rtTA) unter der Kontrolle des Rosa26 Locus und einer polycistronischen OKSM Kassette unter der Kontrolle eines Doxycyclin ansprechenden Promotor 20,21 auszudrücken. Unter Verwendung dieses Maus-Modell umgeht die unerwünschten Nebenwirkungen der traditionellen viralen Methoden der iPS Zellbildung, dh, einer heterogenen Ausgangspopulation mit Zelle zu Zelle Schwankungen in der Anzahl und Lage der Integrationsstellen von viralen Inserts. Zwei transgene Mausstämme (OKSM, m2rtTA), als Gründer homozygote Tiere am Jackson Laboratory zur Verfügung haben, um das zu schaffen reprogra überquert werdenmmable Maus-Modell (siehe Abbildung 2). In dieser Handschrift beschreiben wir im Detail, wie MEFs ableiten, iPS-Zellen zu generieren, und isolieren die Umprogrammierung Zwischenprodukte in den verschiedenen Stadien des Umwandlungsprozesses durch FACS.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

Nach der Präparation, Zerlegung und Galvanisieren eines E13.5 Mausembryo wird ein 10 cm Schüssel erwartet Konfluenz in ca. 1 bis 2 Tagen erreichen. In diesem Stadium ist es normal, dass die Kultur einige anhaftenden Gewebestücke, die nicht richtig zellularen wurden enthalten. Diese werden nach der Passage verschwinden. Nach Doxycyclin Induktion, Neuprogrammierung MEFs unterziehen deutliche morphologische Veränderungen. Um Tag 6, sollte früh Kolonie artigen Flecken beginnen zu entstehen (4C). Diese werden weiter an Größe bei weiterer Kultur wachsen (siehe Abbildung 4D, E). Eine gute Anpassung Experiment ist in&gt; 500 Kolonien pro T75, die zunächst mit 5 x 10 5 Zellen (4E) ausgesät wurde führen. Gegründet iPS Kulturen besitzen charakteristische Kuppel geformt Kolonien und sollte vor allem frei von differenzierten Zellen (4F) sein. Gelegentlich zusätzlichen Passagieren von iPS cultures erforderlich, um undifferenzierte / teilweise neu programmiert Zellen zu entfernen; eine konfluente Kolben von Zellen bei einem Verhältnis von 1:10 auf einer Feeder-Schicht von bestrahlten MEFs aufgeteilt werden. Wie oben erwähnt, sind morphologischen und molekularen Veränderungen während der Umprogrammierung durch Änderungen in den FACS Profile für Thy-1.2, SSEA-1 und schließlich EpCAM (siehe 7A-F) reflektiert. Wie bereits berichtet, 12,15, während MEFs sind überwiegend positiv für Thy-1.2 und negativ für die anderen Markern, Tag 3 Kulturen schauen schon deutlich anders. Ein großer Teil der Zellen begonnen haben, nach unten zu regulieren die Expression von Thy-1.2 und eine sehr kleine Teilmenge dieser Thy-1.2-negativen Zellen haben sich positiv für SSea-1, dem eigentlichen Umprogrammierung Zwischenprodukt für diesem Zeitpunkt. Die Anzahl der Zwischenprodukte, die Neuprogrammierung von Tag extrahiert werden können 3 Kulturen ist sehr unberechenbar wie der Prozentsatz der SSEA-1 + / Thy-1.2-liegt üblicherweise in einem Bereich zwischen 1-10% viablE-Zellen. An den Tagen 6 und 9 ein erhöhter Prozentsatz von SSEA-1 +-Zellen, in der Regel deutlich über 10% festgestellt werden. Um Tag 12 eine Teilmenge von SSea-1-positiven Zellen nachgewiesen werden kann, die auch beschriften positiv für EpCAM. Tag 12 Kulturen, wie Tag 3 Kulturen, stellt einen Engpass bei der Reinigung von Zwischenprodukten, als der Prozentsatz von SSEA-1.2 + / EpCAM + Zellen ist variabel und liegt in der Regel im Bereich von nur 2-4% aller lebenden Zellen. Die erwartete Anzahl der Reprogrammierung Zwischenprodukte in Tabelle 1 dargestellt dient nur als grobe Annäherung. Gegründet bona fide iPS-Zellkulturen für SSea-1 und EpCAM stark positiv sein. <img alt="Figur 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> Abbildung 1. Oberflächenmarker Änderungen während der Umprogrammierung Weg: Die Herunterregulierung von Fibroblasten Identitätsmarker Thy-1.2 wird durch Hochregulation der gefolgtSSea-1. Der Übergang von einer Teilmenge von SSea-1-positiven Zellen zu einer pluripotenten Zustand wird durch Übernahme von EpCAM um Tag 12 angedeutet. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> Abbildung 2. Schematische Darstellung der wiederprogrammierbaren Mausmodell. M2rtTA Ausdruck ist unter der Kontrolle des ubiquitär aktiven Rosa26 Locus in Gegenwart von Doxycyclin (DOX) die m2rtTA Protein bindet an ein Tetracyclin abhängigen Promotor (tetOP) an der Collagen 1a1 (COL1A1) locus, was zur Expression des Faktor vier Kassetten. Zwei bicistronischen Kassetten werden durch eine interne Ribosomen-Eintrittsstelle (IRES) verbunden ist. Offene Leserahmen für Oct-4 / Klf-4 und Sox-2 / c-Myc sind fu<html> durch selbstspalt F2A und E2A-Sequenzen sed sind. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> Abbildung 3. Embryo Dissektion: (A) Transfer Uterushorn in eine 10 cm-Schale mit 10 ml PBS und (B) gefüllt in Stücke, die einen Embryo zu schneiden. (C) Mit einer Pinzette befreien die Embryonen von zusätzlichen embryonalem Gewebe und entfernen Sie den Kopf, Gliedmaßen, Schwanz und der inneren Organe. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> les / ftp_upload / 51728 / 51728fig4highres.jpg &quot;width =&quot; 500 &quot;/&gt; Abbildung 4. Morphologische Veränderungen während der Umprogrammierung. Colony-Patches wie offensichtlich in den Kulturen von Tag 6 ab. Bona-fide-iPS-Zellen werden von einem gewölbten förmige Morphologie gekennzeichnet. (A) Tag 0 / MEFs, (B) Tag 3, (C) Tag 6, (D) Tag 9, (E) Tag 12, (F), iPS-Zellkultur. Maßstab:. 200 um <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> Abbildung 5. Grund FACS-Setup. (A) ausschließen Trümmer mit Side Scatter gegen Forward Scatter-Blot-Gebiet. (B)Aggregate aus Nicht-Trümmer auszuschließen durch Gating auf Einzelzellpopulation mit Forward Scatter Bereich gegenüber Forward Scatter Hohe Blot. (C) ausschließen toten Zellen von der Einzelzellpopulation durch Gating auf PI niedrigen Veranstaltungen mit PI-Kanal im Vergleich Forward Scatter Bereich abklopfen. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> Abbildung 6. Gating. (A, B) Mit den unmarkierten Kontrollzellen bis Tore-Set für Thy-1.2 + /-1-Zellen SSea, Thy-1.2-/ SSea-1-Zellen und Thy-1.2-/ SSea-1 + Zellen. (C) Verwenden Sie die nicht-markierten Kontrollzellen, um Tore für EpCAM positiven und EpCAM-negativen Zellen gesetzt. (D) SSEA-1 + / Thy-1.2-Zellen können getrennt werdenin eine EpCAM positiven und negativen in eine EpCAM Bevölkerung. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> Abbildung 7. Thy-1.2-1 gegenüber SSea FACS-Blots in verschiedenen Stadien der Umprogrammierung. (A) Tag 0 / MEFs, (B) Tag 3, (C) Tag 6, (D) Tag 9, (E)-Tag 12, (F) iPS Zellkultur. Tabelle 1. Empfohlene Aussaatdichte, Anzahl Kolben und die erwarteten Ergebnisse für P1 MEFs eines Embryos heterozygot für OKSM und m2rtTA. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">Bitte klicken h</a>ere, um eine größere Version dieser Figur zu sehen. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Tag </td><td> Anzahl der T75-Kolben ausgesät am Tag 0 </td><td> Gesamtzahl der Ssea1 +-Zellen nach FACS </td><td> Gesamtzahl der Ssea1 + / EpCAM + Zellen nach FACS </td></tr><tr><td> 3 </td><td> 8 </td><td> 2 Millionen </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2 Millionen </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2 Millionen </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10 Millionen </td><td> 2 Millionen </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Zelloberflächenmarker vermittelte Reinigung von iPS-Zellen aus einer Zwischen Reprogrammierbare Maus-Modell

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K Aufrufe.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Serie: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Chromatographische Reinigung von hoch aktiven Hefe Ribosomen

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Forschung

Biologie

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Isolierung und Reinigung von Kinesin aus Drosophila Embryonen

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

Avidität-basierte extrazelluläre Wechselwirkung Screening (AVEXIS) für die Erkennung von Scalable Low-Affinität extrazellulären Rezeptor-Ligand-Wechselwirkungen

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

Generation der Mäuse aus induzierten pluripotenten Stammzellen

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Glycopeptide Capture for Cell Surface Proteomics

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, differentiation, and proliferation. A comprehensive characterization of these proteins provides rich information for biomarker discovery, cell-type identification, and drug-target selection, as well as helping to advance our understanding of cellular biology and physiology. Surface proteins, however, pose significant analytical challenges, because of their inherently low abundance, high hydrophobicity, and heavy post-translational modifications. Taking advantage of the prevalent glycosylation on surface proteins, we introduce here a high-throughput glycopeptide-capture approach that integrates the advantages of several existing N-glycoproteomics means. Our method can enrich the glycopeptides derived from surface proteins and remove their glycans for facile proteomics using LC-MS. The resolved N-glycoproteome comprises the information of protein identity and quantity as well as their sites of glycosylation. This method has been applied to a series of studies in areas including cancer, stem cells, and drug toxicity. The limitation of the method lies in the low abundance of surface membrane proteins, such that a relatively large quantity of samples is required for this analysis compared to studies centered on cytosolic proteins.

Cell surface proteins are biologically important and widely glycosylated. We introduce here a glycopeptide-capture approach to solubilize, enrich, and deglycosylate these proteins for facile LC-MS based proteomic analyses.

Glycopeptid-Capture für Zelloberflächen Proteomics

Cell surface proteins, including extracellular matrix proteins, participate in all major cellular processes and functions, such as growth, ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

MicroRNA Expressionsprofile der Menschen iPS-Zellen, Retinapigmentepithel Abgeleitet aus iPS und Fetal Retinapigmentepithel

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

Effiziente iPS Zellgeneration aus Blut Mit Episomen und HDAC-Inhibitoren

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Light Sheet Fluorescence Microscopy of Plant Roots Growing on the Surface of a Gel

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the observation of the whole organ with a high spatial- as well as temporal resolution over prolonged periods of time, which may cause photo-toxic effects. This protocol shows a plant sample preparation method for light-sheet microscopy, which is characterized by mounting the plant vertically on the surface of a gel. The plant is mounted in such a way that the roots are submerged in a liquid medium while the leaves remain in the air. In order to ensure photosynthetic activity of the plant, a custom-made lighting system illuminates the leaves. To keep the roots in darkness the water surface is covered with sheets of black plastic foil. This method allows long-term imaging of plant organ development in standardized conditions.

This protocol shows a plant sample preparation method for light-sheet microscopy. The setup is characterized by mounting the plant vertically on the surface of a gel and letting it grow in controlled bright conditions. This allows long-term observation of plant organ development in standardized conditions.

Lichtblatt Fluoreszenzmikroskopie von Pflanzenwurzeln wachsen auf der Oberfläche eines Gel

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

Trans-innere Zelle Masse Injektion von embryonalen Stammzellen führt zu höheren Chimerism Raten

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

Primären Zellkulturen aus das retinale Pigmentepithel Maus

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...