The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

İfade Vektörler 1. İnşaatı <ol><li> Kullanım PCR İnfüzyon dizileri 13 sırasıyla ayrılabilen C-terminali ya da N-terminali GFP His6 füzyonlarının ya eklemek vektörleri pOPINE-3C-GFP ve POPIN-N-GFP ile paralel olarak 96 ekspresyon plazmidleri kadar oluşturmak için klonlama. Not: GFP sitozol içinde ifade edilmesi gerekir çünkü vektörün seçilmesi, bir sitosolik, N-terminal ve hücre dışı C-terminal biz POPIN-N-GFP ve için kullanmak bir proteini, proteinin topolojisi ile belirlenir hücre dışı N-terminali hem de sitosolik C-terminali biz pOPINE-3C-GFP kullanmak. Her iki Termini sitozolik nerede C-ucunu etiketlemek için değil fonksiyonel sebep olmadıkça biz pOPINE-3C-GFP kullanmak istiyorum. </li><li> Gösterilen aşağıdaki uzantıları içeren primerler ile zar proteinleri kodlayan DNA dizilerini çoğaltmak: pOPINE-3C-GFP (İleri primer - AGGAGATATACCATG; astar Ters - CAGAACTTCCAGTTT) ve POPIN-N-GFP (İleri primer - AAGTTCTGTTTCAGGGCCCG; - ATGGTCTAGAAAGCTTTA) astar Ters. </li><li> Agaroz jel elektroforezi ile, PCR reaksiyonu analiz edin. Bir kez temiz PCR ürünleri elde edilmiştir, (1x DpnI reaksiyon tamponu, 5 ul içinde telafi) her 5 u DpnI ekleyin. 96 oyuklu bir formatta manyetik boncuklar kullanılarak PCR ürünleri saflaştırılır. Not: DpnI şablon uzaklaştırmak üzere eklenir; Genomik DNA, şablon olarak kullanıldığında, bu adım gerekli değildir. </li><li> PCR, plakanın her oyuğuna uygun doğrusallaştırılmış vektörün 1 ul (100 ng) ekleyin. </li><li> Saflaştırılmış PCR ul bir çok kanallı pipet eklenti x kullanılarak PCR plakanın uygun kuyulara takın. Tüm ürünler 10-250 ng aralığında olduğundan emin olun. </li><li> Çukuruna su (9-x) ul ekleyin ve kuru aşağı-füzyon reaktifi ihtiva eden bir tübe tam 10 ul transfer. 30 saniye bekletin. </li><li> Yukarı ve aşağı pipetleme kısaca içeriğini karıştırın. Transferözgün PCR plaka ve conta tepkiler. </li><li> Bir PCR 42 ° C sıcaklıkta 30 dakika boyunca inkübe edin. </li><li> Hemen TE 40 ul reaksiyon tamamlanana kadar kısa bir süre buz tepkileri transferi ve ekleme (10 mM Tris, pH 8.0, 1 mM EDTA). </li><li> Kerede Freeze veya yetkili hücrelere dönüşümü. Dönüşüm için, yüksek yeterlilik 50 ul alikotundan (&gt; 5 x 10 9 transformant / mikrogram) yetkili E. başına seyreltilmiş reaksiyon 3 ul kullanın E. coli hücreleri. </li><li> LB agar 1 ml 50 ug / ml karbenisilin oyuk başına bir 24 oyuklu doku kültürü plakası ile takviye ekle (klonlanması için, yapıları 2 x sayıda kuyu hazırlama). </li><li> Çıkıntı levhanın ardından büyümesinin sonra: 25 ul, 24 oyuklu doku kültürü plakaları içeren agar üzerine bir kültür 1 5 seyreltme 25 ul. </li><li> Hafifçe eğerek plaka hücreleri yayılır. </li><li> 37 ° C&#39;de ya da bir flo 10-15 dakika için kapaklı plaka Kuruoda sıcaklığında w başlık. </li><li> Kapağı değiştirin ve baş aşağı çevirin ve plaka gece boyunca 37 ° C kuluçkaya yatmaktadır. </li><li> İki koloni ve mini-hazırlık vektörleri seçin. </li><li> PCR yapı belirli ters astar ve bir vektör özgü ileri primer (örn pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG) kullanarak yapıları doğrulayın. </li></ol> E. 2. Dönüşüm coli E XPression suşlar Not: Bundan önce protokolü, E. gerçekleştirmeden E. coli yetkin hücreleri yapılan bölündü ve daha önce tarif edildiği gibi, 13 -80 ° C&#39;de donmuş olarak saklanır. Membran protein ifadesi rutin iki suşları taranır, Lemo21 (DE3) ve C41 (DE3) pLysS. Sonuçların yorumlanması yardımcı olmak için bu gibi bir pozitif kontrol, bir plasmid GFP veya eksprese etmesi için bilinen bir GFP ile kaynaşmış bir zar proteini ve boş vektör negatif kontrol dahil etmek yararlı olabilir. <ol><li> Ali çözülmequotted E. buz üzerinde coli. Seçkin hücrelerin ve her seferinde mini prepped ifade plazmidi 3 ul ekle. </li><li> 30 dakika boyunca buz üzerinde karışımı inkübe edin. </li><li> 42 ° C&#39;de 30 saniye için hücrelerin ısı şoku. </li><li> Hücreler 2 dakika boyunca buz üzerinde geri ve sonra da her tüpe güç suyu 300 ul ilave izin verin. </li><li> 37 ° C kuluçka makinesi içinde, statik, 1 saat süreyle inkübe edin. </li><li> 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ile takviye edilmiş, 24 oyuklu doku kültürü plakası, LB Agar hazırlayın. Lemo21 (DE3) ihtiva eden oyuklara 0.25 mM&#39;lik bir son konsantrasyona kadar ramnoz ekleyin. Not: ürün, C41 ihtiva eden kuyular toksik olma olasılığı ise (DE3) pLysS,% 1 (ağ / hac) glikoz ile takviye edilebilir. </li><li> Aktarım LB agar plakaları üzerine dönüşüm karışımı elde edilen hücreler, 30 ul. Yayılma ve 1,13-1,15 açıklandığı gibi plaka kurulayın. </li></ol> Gece Starter Kültürlerin 3. Hazırlık Not: Her zaman eski bir dönüşüm plakasından asla dönüşüm sonra gecede Kültürlerin gün hazırlar. <ol><li> 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ile takviye edilmiş 96 oyuklu bir derin oyuklu plakanın her bir oyuğuna 0.7 mi güç suyu ekleyin. 0.25 mM&#39;lik nihai bir konsantrasyona kadar Lemo21 (DE3) ihtiva eden oyuklara ramnoz ekleyin. İsteğe bağlı olarak,% 1 (ağ / hac) glikoz C41 (DE3) pLysS ek; Yukarıda (2.6 not) bkz. </li><li> Her kuyuya gecede dönüşüm plakaları bir koloni seçin. Bir gaz geçirgen conta ile blok Seal. </li><li> Gece boyunca 37 ° C &#39;de, küçük bir atış (örneğin 4.3 mm&#39;lik bir yörünge) ile bir inkübatör içerisinde büyük bir atış (örneğin, 25 mm kalınlığında bir yörünge) veya 600 rpm&#39;de bir kuluçka makinesi içinde 250 rpm&#39;de blok çalkalayın. </li></ol> 4. Büyüme ve Kültürlerin İndüksiyon <ol><li> Güç suyu 3 mi her 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ağırlık ile takviye ekle24 gözlü derin gözlü plaka ell. Bölüm 3.1&#39;de tarif edildiği gibi, L-ramnoz (ve glikoz) ekleyin. Iki kez alımına olanak sağlamak kültür 3 ml kullanın ve gaz geçirgen conta içinden suyun bir kısmı buharlaştırma hareketliliği sağlar. </li><li> 24 gözlü derin gözlü bloklara her oyuğuna Lemo21 (DE3) ya da C41 (DE3) pLysS, gece boyunca kültürler 150 ul ekleyerek sentezleme kültürleri ayarlayın. </li><li> 595 nm&#39;de ortalama OD kadar 37 ° C &#39;de bloklar çalkalayın ~ plakası içinden 0.5. </li><li> 1.0 mM IPTG bir nihai konsantrasyona kadar kültürler IPTG eklenerek ifadesini teşvik eder. </li><li> 20 ° C de çalkalanarak kültürler, gece boyunca (18-20 saat) büyütün. </li></ol> In-jel Floresan tarafından İfade 5. Analizi <ol><li> Nüsha Hasat. Kare de, konik bir dip 96-iyice derin oyuklu bloğu her bir kuyudan kültür devri 1 mi. Not: Hasat iki kez blok veya kırılması durumunda alternatif akım test sağlamak içinİsterseniz deterjan ettik. </li><li> Blok kapatın ve 10 dakika boyunca 6000 x g&#39;de santrifüj ile hücreler hasat edilir. </li><li> Blok ters çevirin ve medya süzün. Kalan ortamı boşaltmak için kağıt havlu üzerine hafifçe blok dokunun. </li><li> 20 dakika içinde en az -80 ° C&#39;de plakalar ve mağaza kapatın. İsteğe bağlı olarak, bu noktada deney ve ne zaman uygun işlenmiş blok bırakın. </li><li> Oda sıcaklığında 20 dakika boyunca pelet de-don. </li><li> Liziz tamponu (50 mM NaH 2 PO 4, 300 mM NaCl, 10 mM imidazol,% 1 h, 200 ul tam hücreler tekrar süspansiyon, 4 ° C&#39;de, bir çok-kanallı bir pipet veya bir orbital çalkalayıcı (10 dakika süre ile 1000 rpm) ya kullanın / hac Tween 20), NaOH kullanılarak 8.0 pH ayarlanır. </li><li> (2 ml su içinde nihai hacimde 20 ul DNase (4.000 birim / ml), 20 mg lizozim ve 20 | il proteaz inhibitör kokteyli) 20 DLPI çözeltisi ul ekleyin. 4 ° C &#39;de (~ 1000 rpm) çalkalama ile 10 dakika süreyle inkübe edin. </li><li&gt;% 10 N -Dodecyl β-D-maltoside (DDİ) 25 ul ekle. </li><li> 4 ° C &#39;de (~ 1000 rpm), sallama ile 60 dakika boyunca inkübe edin. </li><li> Santrifüj 4 ° C&#39;de 30 dakika boyunca 6000 x g&#39;de kuyulu bloğu. </li><li> Bir mikro-titre plakasına temizlenir lizat 10 ul transferi ve SDS-PAGE jel yükleme tamponu (100 mM Tris, pH 6.8, ağ% 4, 10 ul / hac SDS,% 0.2 w Bromofenol mavisi,% 10 h / h β hac / mersaptoetanol ve% 20 hac / hac gliserol). DİKKAT NUMUNE kaynatın ETMEYİN. </li><li> Yük aşama 5.11&#39;den örnek 10 ul / gözenek SDS-PAGE jel (ler) üzerine ve boya cephesinin, dip (2-2.5 saat) ulaşana kadar soğuk bir odada 100-120 V (sabit voltaj) çalışır. </li><li> (GFP füzyon proteinleri tespit etmek için mavi ışık filtresi ile örneğin) bir görüntüleyici üzerine jel yerleştirin. pozlama süresi parlak bantlar doymuş değil emin olmak için seçilir. </li></ol> Hücre Kültürleri 6. Ölçek-up <ol><li> Yetkili bir kısım Dönüşümü <em&gt; E. E. coli gibi, bölüm 2&#39;de tarif edildiği. </li><li> (Bölüm 3 açıklandığı gibi takviye) güç suyu 10 ml bir koloni almak ve 37 ° C&#39;de gece boyunca büyür. </li><li> 500 mi güç suyu içine gece boyunca kültür 5 ml seyreltin. </li><li> 595 nm &#39;de OD kadar 37 ° C&#39;de 250 rpm&#39;de çalkalanarak büyütün ~ 0.5. </li><li> 1.0 mM&#39;lik nihai bir konsantrasyona kadar IPTG ilave edilerek ifadesini teşvik eder. </li><li> 20 ° C&#39;de, 250 rpm ile çalkalanarak bir gece boyunca büyütün. </li><li> Santrifüj Hasat hücreler 15 dakika boyunca 5.000 xg&#39;de. </li><li> Sil süpernatant. Hücre topakları -80 ° C&#39;de saklanabilir. </li></ol> Membranların 7. Hazırlık <ol><li> Hücre topağı gramı başına 5 ml&#39;lik bir hacimde 1x PBS pH 7.5 içinde, oda sıcaklığında ve tekrar süspansiyon ile çözülme hücreleri (eğer gerekli ise); Viskozite akıntısı kıvama düşene kadar gerekli ses düzeyini artırın. 10 ug / ml ve bir nihai konsantrasyon 1 mM, DNAz I nihai konsantrasyona MgCI2 eklemeHücre topağı gramı başına 20 proteaz inhibitörü tablet ambalajlı. 30 Kpsi&#39;de bir basınçta soğutulmuş bir hücre bozma kullanılarak açık hücre kırın. </li><li> 4 ° C&#39;de 15 dakika boyunca 30,000 g&#39;de bozulmamış hücreler ve artık taneleri. Ultra-santrifüj tüpüne süpernatant aktarın. </li><li> 4 ° C&#39;de 1 saat boyunca 200,000 x g hızında ultra santrifüj supernatant aşağı iplik toplam membran fraksiyonu toplamak. </li><li> Süpernatantı atın. </li><li> Hücre homojenleştirici kullanılarak buz gibi soğuk 10 mi, PBS pH 7.5 içinde membran topağı yeniden askıya. Membranlar yeniden süspansiyon haline getirildi, 1 ml her bir deterjan için gereklidir. İsteğe bağlı olarak, bu aşamada flaş -80 ° C&#39;de, sıvı azotun ve deposunda membran süspansiyonu dondurma. </li></ol> Membran Fraksiyon 8. Çözündürme ve Analizi <ol><li> Çözülme membran fraksiyonu (gerekirse), ve her bir deterjan için çözündürme için kullanılmak üzere, bir 1.5 ml zar süspansiyonu alikotu 900 ul poliallomer mikro Santrifüjge tüp. </li><li> Belirtilen bir 1.5 ml&#39;lik tübe% 1 bir son konsantrasyona kadar her bir yeni hazırlanmış bir deterjan 100 ul (% 10 w / DDM, DM h solüsyonlar, şimal-6 ve LDAO) ekleyin. Ökaryotik membran proteinleri, kolesterol hemisüksinat (% 0.2 son konsantrasyon) çözünürleştirme için deterjanlara ilave edilebilir. </li><li> Hafif çalkalanarak 1 saat boyunca 4 ° C&#39;de inkübe edin karışımları. </li><li> 45 dakika boyunca 4 ° C&#39;de 150,000 g, temin boruları, en az yarı dolu, bir tezgah üstü, ultra-santrifüj ile deterjan çözünmeyen payın taneleri hem süpematan saklayın. Not: Deterjan çözünme etkinliği ayni hacimde PBS içinde yeniden süspansiyon haline getirilmiş deterjan çözünmez kısma sahip çözündürülmüş membran GFP floresan ölçümü ile bir flüoresan plaka okuyucusu kullanılarak tahmin edilebilir. </li><li> Farklı bir deterjana mono-dağıtma özelliği analiz: Membran protein kompleksleri floresans tespit boyut dışlama kromatografisi kullanılarak (FSEC). </li><li> FSEC analizi için, / dakika 0.3 ml&#39;lik bir akış hızında tamponu (20 mM Tris, pH 7.5, 150 mM NaCI,% 0.03 DDM) çalışan, molekül ağırlığı 5,000,000 geniş bir fraksiyonlara ayırma aralığı bir ebat eksklüzyon kolonu, örneğin 5000 dengeye . Tüm numuneler için bu tampon kullanın, bu test her deterjan için değiştirilmez yani. </li><li> / Dakika 0.3 ml&#39;lik bir akış oranında sütun üzerine çözündürülmüş membran 100 ul enjekte edilir. Floresan optik (488 nm&#39;de uyarma ve emisyon 512 nm) ile elüsyon profilini izler. Bir satır içi floresan monitör mevcut değilse, fraksiyonlarım toplamak ve bir plaka okuyucusunda floresans okuyun. </li><li> Grafiksel gösterim için bir elektronik tablo programı içine İthalat elüsyon hacmi ve floresan yoğunluğu verileri. </li><li> Bölüm 5&#39;de tarif edildiği gibi in-jel floresan ile çözündürülmüş membran malzemesi kalan analiz eder. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

Bu makalede anlatılan protokolde, bir GFP raportör vektörü içine ligasyon bağımsız klonlama hızla E. birden fazla zar proteinlerinin nispi ifade taranması için floresan ile birleştirilir coli. Vektörler birincil ifade tarama bir hafta daha alarak dört iş günü içinde yapılabilir. Gelen jel bütün hücrelerin deterjan lizatlarının floresan ifadesi ikinci bir ekranda daha fazla analiz için tatmin edecek sıralamak için kullanılmaktadır. olduğu gibi primer sentezleme ekran dışında derin gözlü bloklara hücrelerin çoğaltılması için uygun olan bir sallanan kuluçka makinesi herhangi bir uzman ekipman gerektirmez. 96 oyuklu plakalar, SBS içeren tüm diğer sıvı taşıma çok kanallı pipet kullanılarak gerçekleştirilebilir. Protokol maddeler, farklı sentezleme koşulları (örneğin, daha düşük sıcaklık) altında yetiştirilir başka E. coli türleri içerecek şekilde modifiye edilebilir. Ramnoz seviyesini titre LEMO21 (DE3) durumunda (0 2.0 mM)Bazı membran proteinleri 7 ekspresyon seviyesini arttırabilir transkripsiyon hızını modüle etmek için ilave edildi. Sert deterjanlar, enklüzyon gövdelerinden elde proteinlerin çözündürülmesi ve bu yüzden yanlış pozitif vermesine rağmen DDM başka deterjanlar primer elemede çıkarılması için kullanılabilir. Açıkçası, daha ilk ekran haline ayrıntılı, daha zaman alıcı bir deney. İkincil ekran birincil ekranda tanımlanan ifade hit gelen toplam membran fraksiyonu hazırlanması içerir. Bu E. zara füzyon proteinlerinin lokalizasyonu doğrular olarak da önemli bir adımdır E. coli hücreleri. Değişik deterjanlar GFP füzyon proteininin sonraki ekstraksiyon deterjan-protein kompleksleri mono- dağıtma özelliği değerlendirmek için çözündürülmüş malzeme floresans tespit boyut dışlama kromatografi ile izlenir. Ne için en uygun deterjan tanımlar çünkü bu başka bir kritik adımsonraki sonraki işlemlerde membran proteini çözünürleşme. Bununla birlikte, deneyim deterjan (lar) ın seçimi daha fazla optimizasyon hala saflaştırma ve kristalleşme sırasında gerekli olabileceğini göstermektedir. Nispeten küçük bir misel boyutu (örneğin, LDAO) ile olanlar dahil olmak üzere çeşitli deterjanlar içinde homojen davranış kanıtlar en az prokaryotik membran proteinleri 14 kristaller kırılma de oluşturulması için bir eğilimi iyi bir göstergesi olduğu görülmektedir. Bu bağlamda, Şekil 2B&#39;de zar proteini için gösterilen profil son derece elverişli görünmektedir. GFP muhabiri kullanmanın ana avantajı un-saflaştırılmış örneklerde ifade hızlı okuma-out vermesidir. Bir dezavantajı, GFP füzyon proteini kristalizasyon için proteinin saflaştırılması sırasında kaldırılacak olmasıdır. Burada kullanılan vektörler durumunda, bir rinovirüs 3C proteaz bölgesi GFP bölünmesini sağlar. Seçenek olarak ise, bu basittirancak daha sonra saflaştırma için bir polihistidine veya başka bir afinite etiketi eklemek vektörlerine olarak belirlenen aday proteinleri,-klon yeniden. Bu GFP füzyon ekspresyonu için gerekli olduğunu varsayar. zar proteini ekspresyonu ve çözündürme tespiti için GFP füzyonu kullanılarak ana alternatif sadece bir histidin etiketi eklemektir. Bununla birlikte, bu yaklaşım, tipik olarak çok sayıda varyant değerlendirilmesi için çok zaman alan bir hale olan bir membran fraksiyonunun 15 ile başlayan gerektirir. Özet olarak, bu makalede tarif edilen protokol ana amacı, membran proteini dizisinin büyük bir sayısı hızla ifade ve deterjan çözünme açısından değerlendirildi ve daha derin bir analiz için öncelik varyantlarının sağlamaktır.

Bu zar proteinleri, insan genomu 2 dahil olmak üzere tüm dizilenmiştir genomları 1, kodlanmış genlerinin yaklaşık% 20-30 sorumlu olduğu tahmin edilmektedir. Ilaç hedefleri metabolitler, enerji üretimi, örneğin ulaşım ve birçok biyolojik süreçlerde kritik rolü göz önüne alındığında, onların üç boyutlu yapısını belirlemek yoğun ilgi var. Bununla birlikte, çözünür proteinler ile karşılaştırıldığında, zar proteinlerinin yüksek derecede yeterince temsil Protein Veri Bankası içindedir. Aslında, PDB (de 99.624 serbest yapıların <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) Sadece 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) zar proteinleri olarak sınıflandırılır. Bu da doğal olarak, nispeten düşük seviyelerde ifade edilmiştir zar proteinleri ile çalışan teknik zorluklar yansıtmaktadır; rodopsin, birkaç istisna dışında 3,4 biridir. Rekombinant sürümü Aşırı ifadesiheterolog hücrelerde ler genellikle üretim genel düzeyini sınırlayan zara hatalı katlanması ve yoksul hedefleme sonuçlanır. Bir kez eksprese eden bir membran proteinin ekstraksiyonu ve çözündürme için en iyi deterjan seçilmesi daha sonraki saflaştırma zorlaştırır ve dikkatli bir optimizasyon gerektirir. Escherichia coli% 72 (muhasebe zar proteinleri için en yaygın olarak kullanılan ekspresyon konak kalır <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> bakteriyel kaynaklardan neredeyse sadece güncel çözülmüş yapılar). Belirli E. E. coli suşu C41 (DE3) ve C43 (DE3), zar proteinlerinin aşırı ifadesine neden olur ve bu nedenle, diğer BL21 için gözlenen toksiklik 5,6 suşları etkilerini önlemek etmeyen izole edilmiştir. Rekombinant zar proteini ekspresyonu seviyesini ayarlama üretimi 6,7 kalitesini optimize etmek için kritik olduğu görülmektedir. 6-8 yararlanmak için birden ortologlara de dahil olmak üzere birden çok alternatifler değerlendirilmesini gerektirmiştir. Bu nedenle, paralel bir çok zar proteinlerinin sentezlenmesi taranması için bir yöntem gereklidir. Bir yaygın kullanılan yaklaşım protein arındırmak gerek kalmadan izlenebilir yeşil floresan protein (GFP) sağlayan ifadeye protein kaynaştırmak için. Bu şekilde, farklı deterjanlarda ekspresyon düzeyi, kararlılık ve davranış hakkında bilgiler un saf malzeme 9-12 küçük miktarları ile değerlendirilebilir. Bu yazıda E. membran proteinlerinin klonlanması ve ifade taraması için bir aerodinamik protokol açıklar coli, üretim ve deterjan sonraki karakterizasyonu bir muhabir olarak GFP için füzyon kullanarak: Protein complexes (Şekil 1).

<table><tbody><tr><td>pOPIN-N-GFP</td><td>addgene (www.addgene.org)</td><td></td><td></td></tr><tr><td>pOPINE-3C-GFP</td><td>addgene (www.addgene.org)</td><td></td><td></td></tr><tr><td>C41(DE3)pLysS</td><td>Lucigen (http://lucigen.com/)</td><td>60444-1</td><td></td></tr><tr><td>LEMO21(DE3)</td><td>New England Biolabs</td><td>C2528H</td><td></td></tr><tr><td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td><td>Clontech/Takara</td><td>639688</td><td></td></tr><tr><td>Power broth</td><td>Molecular Dimensions (http://www.moleculardimensions.com/)</td><td>MD12-106-1</td><td></td></tr><tr><td>Protease Inhibitor tablets</td><td>Roche</td><td>11697498001</td><td></td></tr><tr><td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&amp;nbsp;</td><td>Roche</td><td>11836170001</td><td></td></tr><tr><td>L-Rhamnose monohydrate</td><td>Sigma-Aldrich</td><td>83650</td><td></td></tr><tr><td>Protease Inhibitor Cocktail&amp;nbsp;</td><td>Sigma-Aldrich</td><td>P8849</td><td></td></tr><tr><td>DNAse 1</td><td>Sigma-Aldrich</td><td>DN25</td><td></td></tr><tr><td>Lysozyme</td><td>Sigma-Aldrich</td><td>L7651</td><td></td></tr><tr><td>Cholesterol hemisuccinate</td><td>Sigma-Aldrich</td><td>C6512</td><td></td></tr><tr><td>CYMAL-6 (6-Cyclohexyl-1-Hexyl-&amp;beta;-D-Maltoside)</td><td>Anatrace</td><td>C326</td><td></td></tr><tr><td>DDM (n-Dodecyl &amp;beta;-maltoside)</td><td>Generon</td><td>D97002</td><td></td></tr><tr><td>DM (n-Decyl &amp;beta;-maltoside)</td><td>Generon</td><td>D99003</td><td></td></tr><tr><td>LDAO (&lt;em&gt;N,N&lt;/em&gt;-Dimethyl-n-dodecylamine &lt;em&gt;N&lt;/em&gt;-oxide)</td><td>Generon</td><td>D71111</td><td></td></tr><tr><td>E1 ClipTip Eq384 8&amp;nbsp;channel 1-30 &amp;micro;l</td><td>Thermo Scientific&amp;nbsp;</td><td>4672030</td><td></td></tr><tr><td>Rainin Pipette Pipet-Lite XLS 6ch 100-1,200 &amp;micro;l LTS Spacer</td><td>Anachem</td><td>LA6-300XLS</td><td></td></tr><tr><td>Rainin Pipette Light XLS+ 8ch 2-20 &amp;micro;l LTS</td><td>Anachem</td><td>L8-20XLSPLUS</td><td></td></tr><tr><td>Pipette Pipet-Lite XLS 8ch 100-1,200 &amp;micro;l LTS Tip</td><td>Anachem</td><td>L8-1200XLS</td><td></td></tr><tr><td>24 well V bottom deep well blocks</td><td>Porvair sciences</td><td>360115</td><td></td></tr><tr><td>BenchMark Fluorescent Protein Standard</td><td>Life Technologies</td><td>LC5928</td><td></td></tr><tr><td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td><td>Life Technologies</td><td>WG1203BOX</td><td></td></tr><tr><td>XCell4 SureLock Midi-Cell</td><td>Life Technologies</td><td>WR0100</td><td></td></tr><tr><td>Vibramax 100</td><td>Heidolph</td><td>544-21200-00</td><td></td></tr><tr><td>Tension rollers attachment</td><td>Heidolph</td><td>549-81000-00</td><td></td></tr><tr><td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td><td>Beckman Coulter</td><td>393253</td><td></td></tr><tr><td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td><td>Beckman Coulter</td><td>393315</td><td></td></tr><tr><td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&amp;nbsp;</td><td>Beckman Coulter</td><td>B14535</td><td></td></tr><tr><td>Prominence UFLC with RF-20A Fluorescence detector</td><td>Shimadzu</td><td></td><td></td></tr><tr><td>Sepharose 6 10/300 GL size exclusion column</td><td>GE Healthcare</td><td>17-5172-01&amp;nbsp;</td><td></td></tr><tr><td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144&amp;nbsp;L), 30-850 rpm</td><td>Shel Lab&amp;nbsp;</td><td>SSI5R-HS</td><td></td></tr><tr><td>Innova44R incubator</td><td>New Brunswick /Eppendorf</td><td>Innova44R</td><td></td></tr><tr><td>TS Series 0.75 kW Disrupter 230 V 50 Hz 1&amp;nbsp;PH (40 kpsi)</td><td>Constant systems</td><td>PL083016</td><td></td></tr><tr><td>L-Rhamnose monohydrate</td><td>Sigma</td><td>83650</td><td></td></tr></tbody></table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

yapısal ve fonksiyonel çalışmalar için yeniden birleştirici zar proteinlerinin üretimi nedeniyle düşük seviyeli dışavurumu ve bir kez deterjanlar içinde çözünür bir çok zar proteinlerinin tabiatında bulunan kararsızlık için teknik açıdan zor olmaya devam etmektedir. Bir protokol GFP floresan tespit Escherichia coli ekspresyon GFP füzyonları olarak zar proteinlerinin bağlama bağımsız klonlama birleştiren tarif edilmektedir. Bu çoklu membran proteini inşaat ve ifade tarama / zaman ve çaba daha fazla yatırım için uygun adayları tespit varyantları sağlar. GFP raportör SDS poliakrilamid jel elektroforezi (SDS-PAGE), aşağıdaki GFP floresan görselleştirerek ifade primer elemede kullanılır. Serbest GFP yokluğu ile gösterildiği gibi en az bozulma ile yüksek bir ifade seviyesi ortaya koymuştur Zar proteinleri, ikinci bir ekran için seçilir. Bu yapılar ölçekli ve toplam zar fraksiyonu hazırlanır ve çözünür vardırDört farklı deterjan d. Deterjan çözünmeyen malzemenin ayrılması için ultrasantrifüj sonra lizatlar floresans saptama boyut ayrımı kromatografisiyle (FSEC) ile analiz edilmiştir. GFP floresan boyut dışlama profili İzleme farklı deterjanlarda membran proteinlerinin mono-dispersiteleri ve bütünlüğü hakkında bilgi sağlar. Protein ya da çok az serbest GFP ve minimum agregasyonu ile simetrik bir zirve ile elüte deterjan kombinasyonu daha sonra saflaştırma için adaydırlar. Yukarıdaki metodoloji, E. heterolog ifade kullanma SED (şekil, uzama, bölünme ve sporülasyon) bakteri 47 farklı tür proteinlerin coli analiz edildi. Bu proteinler genellikle on transmembran ve hücre bölünmesi için gereklidir. Sonuçlar, E. coli &#39;de SED&#39;leri ortologlara üretimi coli GFP füzyon proteinlerinin ifade seviyelerine saygı ve dürüstlük son derece değişken. Deney Idaha fazla araştırma için bir alt dentified.

Proteinlerin (şekil, uzama, bölünme ve sporülasyon) olarak SEDS ailesi bakteriyel hücre bölünmesi için gereklidir. Bu tamamlayıcı proteinler tipik olarak hücre içinde hem de amino ve karboksi sonlarını on transmembran etki vardır. Yukarıda tarif edilen protokol örneklemek amacıyla, 47 SED&#39;leri ortologlara vektör pOPINE-3C-EGFP klonlanmıştır. Konstruktlarının bir küçük ölçekli ekspresyon ekranı iki D .coli suşları gerçekleştirildiği, 0.25 mM mevcudiyetinde büyütülen Lemo21 (DE3) rutin membran ekspresyonu için kullanılan sızan ifade ve C41 (DE3) pLysS, bloke etme ramnoz proteinler 5-8. İndüklenmiş kültürlerin deterjan çözünebilir lisatları, SDS-poliakrilamid elektroforez ile analiz edilmiştir. -Jel floresan kullanılarak ifade GFP füzyon proteinleri 47 SED&#39;ler yapıları üzerinden iki suşları arasında 38 üretilmiş olduğunu gösterdi görselleştirmek için. İlginçtir iki ifade suşları arasındaki farklar vardı. 38 yapıları ifade edilen, sadece 18, her iki soy, yalnızca C41 (DE3) pLysS içinde Lemo21 (DE3) &#39;e ve 6&#39;da ifade edilen, 14 üretildi. Genel olarak, C41 (DE3) pLysS (24 vs 38) ile karşılaştırıldığında Lemo21 (DE3) için daha yüksek bir başarı oranı oldu. Ancak, bazı proteinler, soy spesifik olduğu ortaya çıktı gözlem hem de tarama yararlı olduğu anlamına gelir. 47 SED&#39;ler ve 24 için temsili veri yapıları, Şekil 1 &#39;de gösterilmiştir. Bantların yoğunluğu, ancak her iki soy iyi ilave olarak ifade edilir, örneğin Şekil 1A ve 1 B&#39; de de C4 füzyon proteini ekspresyon seviyesinin bir göstergesini verir, düşük molekül ağırlıklı bant, protein olarak kısmen indirgenen olduğunu göstermektedir. Birçok şerit tek başına GFP boyutundaki gelen bir grup var. Protein bütünlüğünün kalite değerlendirmesi serbest GFP füzyon proteini nisbetle yoğunluğu bakarak gerçekleştirilebilir;Örneğin G4 ve H4 tamamen bazı Sağlam protein (Şekil 1A) bulunmaktadır Lemo21 (DE3&#39;ün) oysa C41 (DE3) pLysS (Şekil 1B) ücretsiz GFP aşağı kırılmış. 38 olarak ifade edilen proteinleri üzerinden 14 için serbest GFP bandının yoğunluğu (serbest GFP bir bandın şiddeti, füzyon proteini ve füzyon proteinlerinin bir kısmında daha büyük olan 21 için, 3 füzyon proteininin benzerdir / 38) ifade örneğin F6 ve Şekil 1A G6 füzyon proteinine kıyasla nispeten az serbest GFP var. Ve G6 (küçük ücretsiz GFP) ifade edildi ve 500 ml hücre kültüründen hazırlanan toplam membran fraksiyonunun (ücretsiz GFP ve füzyon proteinleri için yüksek yoğunluklu bantları) birincil ekran B5 iyi ifade yapıları iki. Tekrar süspansiyon haline getirilen zarlar kısma bölünmüştür ve floresan ile saptanan boyut ayrımı kromatografisiyle (FSEC) ile analiz edilmiştir. FSEC profilleri Figür sunulmuşture 2A ve 2B sırasıyla iki SED&#39;ler proteinler test dört deterjanlarda farklı davrandığını göstermektedir. Bir durumda (Şekil 2A: Örnek B5) proteini sadece bu nedenle daha sonraki saflaştırma için tercih edilen bir deterjan olacaktır DDM az agregasyonu ile simetrik bir tepe verdi. Aksine diğer füzyon proteini tarafından (Şekil 2B: Örnek G6) test edilen tüm deterjanlarda benzer bir profil verdi. <img alt="Şekil 1," src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> Şekil 1: E. membran proteini ifade taranması için iş akışı şeması coli GFP muhabiri kullanarak. <img alt="Şekil 2," src="/files/ftp_upload/52357/52357fig2highres.jpg" /> Şekil 2:-jel floresan kullanılarak zar proteini ifade birincil ekranı. </strongE.&gt; Deterjan lizatları E. coli, SDS-PAGE ile analiz edildi hücreleri ve jeller Mavi Epi aydınlatma ve 530/28 filtre kullanılarak görüntülenmiştir. Sonuçlar (96 oyuklu bir plaka içerisinde pozisyonlarına göre A4 H6 etiketli) 24 yapıları için gösterilmiştir. serbest GFP ve GFP füzyon proteinleri için bantlarının pozisyonları gösterilir. Lemo21 (DE3). (B), C41 (DE3) pLysS ifade Proteinlerin ifade (A), proteinler. <img alt="Şekil 3," src="/files/ftp_upload/52357/52357fig3highres.jpg" /> Şekil 3:. Zar proteini ifade ikincil ekran Floresan tespit boyut dışlama kromatografisi (FSEC) kullanılarak toplam membran fraksiyonları dört farklı deterjanlarda ekstre edilmiş ve çözündürülmüş membran proteinleri bir floresan detektörüne bağlanmış bir FPLC sistemi kullanılarak boyut dışlama kromatografisi ile analiz edilmiştir. Için FSEC profiller (A), membran proteini B5 ve (B) </strong&gt; zar proteini G6. birleştirilmiş protein, çözündürülmüş, GFP füzyon proteini ve serbest GFP&#39;ye karşı gelen bir zirve konumu belirtilmiştir. Test deterjanlar profilleri aşağıda belirtilmiştir.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Yeşil floresan proteini füzyon göre, Escherichia coli içinde rekombinant zar proteinlerinin ifadesi için tarama için bir aerodinamik bir yaklaşım sunulmuştur.

Membran proteinlerinin Yeşil floresan proteini temelli Ekspresyon elemesinde<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.6K Görüntüleme.  Research Complex at Harwell.  Yeşil floresan proteini füzyon göre, Escherichia coli içinde rekombinant zar proteinlerinin ifadesi için tarama için bir aerodinamik bir yaklaşım sunulmuştur. 

Video: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Bacterial Inner-membrane Display for Screening a Library of Antibody Fragments

Antibodies engineered for intracellular function must not only have affinity for their target antigen, but must also be soluble and correctly folded in the cytoplasm. Commonly used methods for the display and screening of recombinant antibody libraries do not incorporate intracellular protein folding quality control, and, thus, the antigen-binding capability and cytoplasmic folding and solubility of antibodies engineered using these methods often must be engineered separately. Here, we describe a protocol to screen a recombinant library of single-chain variable fragment (scFv) antibodies for antigen-binding and proper cytoplasmic folding simultaneously. The method harnesses the intrinsic intracellular folding quality control mechanism of the Escherichia coli twin-arginine translocation (Tat) pathway to display an scFv library on the E. coli inner membrane. The Tat pathway ensures that only soluble, well-folded proteins are transported out of the cytoplasm and displayed on the inner membrane, thereby eliminating poorly folded scFvs prior to interrogation for antigen-binding. Following removal of the outer membrane, the scFvs displayed on the inner membrane are panned against a target antigen immobilized on magnetic beads to isolate scFvs that bind to the target antigen. An enzyme-linked immunosorbent assay (ELISA)-based secondary screen is used to identify the most promising scFvs for additional characterization. Antigen-binding and cytoplasmic solubility can be improved with subsequent rounds of mutagenesis and screening to engineer antibodies with high affinity and high cytoplasmic solubility for intracellular applications.

We provide a method to simultaneously screen a library of antibody fragments for binding affinity and cytoplasmic solubility by using the Escherichia coli twin-arginine translocation pathway, which has an inherent quality control mechanism for intracellular protein folding, to display the antibody fragments on the inner membrane.

Antikor parçalarının bir kütüphanenin taranması için bakteriyel iç zar görüntü

Antibodies engineered for intracellular function must not only have affinity for their target antigen, but must also be soluble and correctly folded in ...

Biyokimya

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies against specific peptides within the predicted sequence allow some localization experiments. However, other possible interactions with the antibodies often cannot be excluded. This situation provided an opportunity to develop a set of assays dependent on the protein sequence. Specifically, a construct containing the gene sequence coupled to the GFP coding sequence at the C-terminal end of the protein was obtained and employed for these purposes. Experiments to characterize localization, ligand affinity, and gain of function were originally designed and carried out to confirm the identification of TMEM184A as a heparin receptor1. In addition, the construct can be employed for studies addressing membrane topology questions and detailed protein-ligand interactions. The present report presents a range of experimental protocols based on the GFP-TMEM184A construct expressed in vascular cells that could easily be adapted for other novel proteins.

A construct encoding TMEM184A with a GFP tag at the carboxy-terminus designed for eukaryotic expression, was employed in assays designed to confirm the identification of TMEM184A as a heparin receptor in vascular cells.

Bir GFP etiketli TMEM184A kullanarak Heparin Reseptör Kimliğinin Onay için Construct

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Genetik

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine exchangers in plants have not been identified. Here, we outline a method to characterize polyamine antiporters using membrane vesicles generated from the lysis of Escherichia coli cells heterologously expressing a plant antiporter. First, we heterologously expressed AtBAT1 in an E. coli strain deficient in polyamine and arginine exchange transporters. Vesicles were produced using a French press, purified by ultracentrifugation and utilized in a membrane filtration assay of labeled substrates to demonstrate the substrate specificity of the transporter. These assays demonstrated that AtBAT1 is a proton-mediated transporter of arginine, &#947;-aminobutyric acid (GABA), putrescine and spermidine. The mutant strain that was developed for the assay of AtBAT1 may be useful for the functional analysis of other families of plant and animal polyamine exchangers. We also hypothesize that this approach can be used to characterize many other types of antiporters, as long as these proteins can be expressed in the bacterial cell membrane. E. coli is a good system for the characterization of novel transporters, since there are multiple methods that can be employed to mutagenize native transporters.

Characterization of Membrane Transporters by Heterologous Expression in E. coli and Production of Membrane Vesicles

We describe a method for the characterization of proton-driven membrane transporters in membrane vesicle preparations produced by heterologous expression in E. coli and lysis of cells using a French press.

E. coli'de Heterolog Ekspresyon ile Membran Taşıyıcılarının Karakterizasyonu ve Membran Veziküllerinin Üretimi

Several methods have been developed to functionally characterize novel membrane transporters. Polyamines are ubiquitous in all organisms, but polyamine ...

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity of cells within a test tube. By obviating the need to maintain the viability of the cell, and by eliminating the cellular barrier, CFPS has been foundational to emerging applications in biomanufacturing of traditionally challenging proteins, as well as applications in rapid prototyping for metabolic engineering, and functional genomics. Our methods for implementing an E. coli-based CFPS platform allow new users to access many of these applications. Here, we describe methods to prepare extract through the use of enriched media, baffled flasks, and a reproducible method of tunable sonication-based cell lysis. This extract can then be used for protein expression capable of producing 900 &#181;g/mL or more of super folder green fluorescent protein (sfGFP) in just 5 h from experimental setup to data analysis, given that appropriate reagent stocks have been prepared beforehand. The estimated startup cost of obtaining reagents is $4,500 which will sustain thousands of reactions at an estimated cost of $0.021 per &#181;g of protein produced or $0.019 per &#181;L of reaction. Additionally, the protein expression methods mirror the ease of the reaction setup seen in commercially available systems due to optimization of reagent pre-mixes, at a fraction of the cost. In order to enable the user to leverage the flexible nature of the CFPS platform for broad applications, we have identified a variety of aspects of the platform that can be tuned and optimized depending on the resources available and the protein expression outcomes desired.

Escherichia coli-Based Cell-Free Protein Synthesis: Protocols for a robust, flexible, and accessible platform technology

This protocol details the steps, costs, and equipment necessary to generate E. coli-based cell extracts and implement in vitro protein synthesis reactions within 4 days or less. To leverage the flexible nature of this platform for broad applications, we discuss reaction conditions that can be adapted and optimized.

Escherichia coli-boş hücre Protein sentezi dayalı: sağlam, esnek ve erişilebilir platform teknolojisi için iletişim kuralları

Over the last 50 years, Cell-Free Protein Synthesis (CFPS) has emerged as a powerful technology to harness the transcriptional and translational capacity ...

Kimya

Rapid Assessment of Membrane Protein Quality by Fluorescent Size Exclusion Chromatography

During membrane protein structural elucidation and biophysical characterization, it is common to trial numerous protein constructs containing different tags, truncations, deletions, fusion partner insertions, and stabilizing mutations to find one that is not aggregated after extraction from the membrane. Furthermore, buffer screening to determine the detergent, additive, ligand, or polymer that provides the most stabilizing condition for the membrane protein is an important practice. The early characterization of membrane protein quality by fluorescent size exclusion chromatography provides a powerful tool to assess and rank different constructs or conditions without the requirement for protein purification, and this tool also minimizes the sample requirement. The membrane proteins must be fluorescently tagged, commonly by expressing them with a GFP tag or similar. The protein can be solubilized directly from whole cells and then crudely clarified by centrifugation; subsequently, the protein is passed down a size exclusion column, and a fluorescent trace is collected. Here, a method for running FSEC and representative FSEC data on the GPCR targets sphingosine-1-phosphate receptor (S1PR1) and serotonin receptor (5HT2AR) are presented.

The present protocol describes a procedure to perform fluorescent size exclusion chromatography (FSEC) on membrane proteins to assess their quality for downstream functional and structural analysis. Representative FSEC results collected for several G-protein coupled receptors (GPCRs) under detergent-solubilized and detergent-free conditions are presented.

Floresan Boyut Dışlama Kromatografisi ile Membran Protein Kalitesinin Hızlı Değerlendirilmesi

During membrane protein structural elucidation and biophysical characterization, it is common to trial numerous protein constructs containing different ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and engineered variants of the green fluorescent protein from Aequorea victoria (avGFP) as well as homologs from other species already cover large parts of the optical spectrum, a spectral gap remains in the near-infrared region, for which avGFP-based fluorophores are not available. Red-shifted fluorescent protein (FP) variants would substantially expand the toolkit for spectral unmixing of multiple molecular species, but the naturally occurring red-shifted FPs derived from corals or sea anemones have lower fluorescence quantum yield and inferior photo-stability compared to the avGFP variants. Further manipulation and possible expansion of the chromophore&#39;s conjugated system towards the far-red spectral region is also limited by the repertoire of 20 canonical amino acids prescribed by the genetic code. To overcome these limitations, synthetic biology can achieve further spectral red-shifting via insertion of non-canonical amino acids into the chromophore triad. We describe the application of SPI to engineer avGFP variants with novel spectral properties. Protein expression is performed in a tryptophan-auxotrophic E. coli strain and by supplementing growth media with suitable indole precursors. Inside the cells, these precursors are converted to the corresponding tryptophan analogs and incorporated into proteins by the ribosomal machinery in response to UGG codons. The replacement of Trp-66 in the enhanced &#34;cyan&#34; variant of avGFP (ECFP) by an electron-donating 4-aminotryptophan results in GdFP featuring a 108 nm Stokes shift and a strongly red-shifted emission maximum (574 nm), while being thermodynamically more stable than its predecessor ECFP. Residue-specific incorporation of the non-canonical amino acid is analyzed by mass spectrometry. The spectroscopic properties of GdFP are characterized by time-resolved fluorescence spectroscopy as one of the valuable applications of genetically encoded FPs in life sciences.

Synthetic biology enables the engineering of proteins with unprecedented properties using the co-translational insertion of non-canonical amino acids. Here, we presented how a spectrally red-shifted variant of a GFP-type fluorophore with novel fluorescence spectroscopic properties, termed &#34;gold&#34; fluorescent protein (GdFP), is produced in E. coli via selective pressure incorporation (SPI).

Mühendislik kanonik olmayan Amino asitler ve seçici basınç eklenmesi tarafından 'Altın' floresan ve kütle spektrometresi ve floresan göre Protein analizi

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Biyomühendislik

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

Floresan ile yüksek verim Tarama ve Biyoalgılayıcı C. elegans Suşlarının

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Biyoloji

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a pET-SUMO-EGFP vector (SUMO = small ubiquitin-like modifier) and expressing enhanced green fluorescence protein (EGFP) in Escherichia coli (BL21DE). EGFP-expressing E. coli is coincubated with macrophages for 1 h at 37 &#176;C; the negative control group is incubated on ice for the same amount of time. Then, the macrophages are ready for assessment. The advantages of this technique include its simple and straightforward steps, and phagocytosis can be measured by both flow cytometer and fluorescence microscope. The EGFP-expressing E. coli are stable and display a strong fluorescence signal even after the macrophages are fixed with paraformaldehyde. This method is not only suitable for the assessment of macrophage cell lines or primary macrophages in vitro but also suitable for the evaluation of granulocyte and monocyte phagocytosis in peripheral blood mononuclear cells. The results show that the phagocytic capability of peritoneal macrophages from young (eight-week-old) mice is higher than that of macrophages from aged (16-month-old) mice. In summary, this method measures macrophage phagocytosis and is suitable for studying the innate immune system function.

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Here, we present a protocol to assess mouse peritoneal macrophage phagocytosis using enhanced green fluorescence protein-expressing Escherichia coli.

Yeşil floresans Protein-ifade gelişmiş kullanma fare Peritoneal makrofaj fagositoz değerlendirmek için Escherichia Coli

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...

İmmünoloji ve Enfeksiyon

Determining Membrane Protein Topology Using Fluorescence Protease Protection (FPP)

The correct topology and orientation of integral membrane proteins are essential for their proper function, yet such information has not been established for many membrane proteins. A simple technique called fluorescence protease protection (FPP) is presented, which permits the determination of membrane protein topology in living cells. This technique has numerous advantages over other methods for determining protein topology, in that it does not require the availability of multiple antibodies against various domains of the membrane protein, does not require large amounts of protein, and can be performed on living cells. The FPP method employs the spatially confined actions of proteases on the degradation of green fluorescent protein (GFP) tagged membrane proteins to determine their membrane topology and orientation. This simple approach is applicable to a wide variety of cell types, and can be used to determine membrane protein orientation in various subcellular organelles such as the mitochondria, Golgi, endoplasmic reticulum and components of the endosomal/recycling system. Membrane proteins, tagged on either the N-termini or C-termini with a GFP fusion, are expressed in a cell of interest, which is subject to selective permeabilization using the detergent digitonin. Digitonin has the ability to permeabilize the plasma membrane, while leaving intracellular organelles intact. GFP moieties exposed to the cytosol can be selectively degraded through the application of protease, whereas GFP moieties present in the lumen of organelles are protected from the protease and remain intact. The FPP assay is straightforward, and results can be obtained rapidly.

Determining Membrane Protein Topology Using Fluorescence Protease Protection FPP

Here, we present a protocol to determine the orientation and topology of integral membrane proteins in living cells. This simple protocol relies on selective protease sensitivity of chimeras between the protein of interest and GFP.

Floresan Proteaz Koruma Kullanma Membran Protein topolojisini belirlenmesi (FPP)

The correct topology and orientation of integral membrane proteins are essential for their proper function, yet such information has not been established ...

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

The canonical set of amino acids leads to an exceptionally wide range of protein functionality. Nevertheless, the set of residues still imposes limitations on potential protein applications. The incorporation of noncanonical amino acids can enlarge this scope. There are two complementary approaches for the incorporation of noncanonical amino acids. For site-specific incorporation, in addition to the endogenous canonical translational machineries, an orthogonal aminoacyl-tRNA-synthetase-tRNA pair must be provided that does not interact with the canonical ones. Consequently, a codon that is not assigned to a canonical amino acid, usually a stop codon, is also required. This genetic code expansion enables the incorporation of a noncanonical amino acid at a single, given site within the protein. The here presented work describes residue-specific incorporation where the genetic code is reassigned within the endogenous translational system. The translation machinery accepts the noncanonical amino acid as a surrogate to incorporate it at canonically prescribed locations, i.e., all occurrences of a canonical amino acid in the protein are replaced by the noncanonical one. The incorporation of noncanonical amino acids can change the protein structure, causing considerably modified physical and chemical properties. Noncanonical amino acid analogs often act as cell growth inhibitors for expression hosts since they modify endogenous proteins, limiting in vivo protein production. In vivo incorporation of toxic noncanonical amino acids into proteins remains particularly challenging. Here, a cell-free approach for a complete replacement of L-arginine by the noncanonical amino acid L-canavanine is presented. It circumvents the inherent difficulties of in vivo expression. Additionally, a protocol to prepare target proteins for mass spectral analysis is included. It is shown that L-lysine can be replaced by L-hydroxy-lysine, albeit with lower efficiency. In principle, any noncanonical amino acid analog can be incorporated using the presented method as long as the endogenous in vitro translation system recognizes it.

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

An easy-to-use, cell-free expression protocol for the residue-specific incorporation of noncanonical amino acid analogs into proteins, including downstream analysis, is presented for medical, pharmaceutic, structural and functional studies.

Bir Kullanarak Modeli Proteinler içine Kuralsız Amino Asit kalıntı özgü Ortaklığın<em&gt; Escherichia coli</em&gt; Hücre içermeyen Transkripsiyon-çeviri Sistemi

Membran proteinlerinin Yeşil floresan proteini temelli Ekspresyon elemesinde

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler