The OPPF-UK is funded by the Medical Research Council, UK (grant MR/K018779/1) and the Membrane Protein Laboratory by the Wellcome Trust (grant 099165/Z/12/Z).

İfade Vektörler 1. İnşaatı <ol><li> Kullanım PCR İnfüzyon dizileri 13 sırasıyla ayrılabilen C-terminali ya da N-terminali GFP His6 füzyonlarının ya eklemek vektörleri pOPINE-3C-GFP ve POPIN-N-GFP ile paralel olarak 96 ekspresyon plazmidleri kadar oluşturmak için klonlama. Not: GFP sitozol içinde ifade edilmesi gerekir çünkü vektörün seçilmesi, bir sitosolik, N-terminal ve hücre dışı C-terminal biz POPIN-N-GFP ve için kullanmak bir proteini, proteinin topolojisi ile belirlenir hücre dışı N-terminali hem de sitosolik C-terminali biz pOPINE-3C-GFP kullanmak. Her iki Termini sitozolik nerede C-ucunu etiketlemek için değil fonksiyonel sebep olmadıkça biz pOPINE-3C-GFP kullanmak istiyorum. </li><li> Gösterilen aşağıdaki uzantıları içeren primerler ile zar proteinleri kodlayan DNA dizilerini çoğaltmak: pOPINE-3C-GFP (İleri primer - AGGAGATATACCATG; astar Ters - CAGAACTTCCAGTTT) ve POPIN-N-GFP (İleri primer - AAGTTCTGTTTCAGGGCCCG; - ATGGTCTAGAAAGCTTTA) astar Ters. </li><li> Agaroz jel elektroforezi ile, PCR reaksiyonu analiz edin. Bir kez temiz PCR ürünleri elde edilmiştir, (1x DpnI reaksiyon tamponu, 5 ul içinde telafi) her 5 u DpnI ekleyin. 96 oyuklu bir formatta manyetik boncuklar kullanılarak PCR ürünleri saflaştırılır. Not: DpnI şablon uzaklaştırmak üzere eklenir; Genomik DNA, şablon olarak kullanıldığında, bu adım gerekli değildir. </li><li> PCR, plakanın her oyuğuna uygun doğrusallaştırılmış vektörün 1 ul (100 ng) ekleyin. </li><li> Saflaştırılmış PCR ul bir çok kanallı pipet eklenti x kullanılarak PCR plakanın uygun kuyulara takın. Tüm ürünler 10-250 ng aralığında olduğundan emin olun. </li><li> Çukuruna su (9-x) ul ekleyin ve kuru aşağı-füzyon reaktifi ihtiva eden bir tübe tam 10 ul transfer. 30 saniye bekletin. </li><li> Yukarı ve aşağı pipetleme kısaca içeriğini karıştırın. Transferözgün PCR plaka ve conta tepkiler. </li><li> Bir PCR 42 ° C sıcaklıkta 30 dakika boyunca inkübe edin. </li><li> Hemen TE 40 ul reaksiyon tamamlanana kadar kısa bir süre buz tepkileri transferi ve ekleme (10 mM Tris, pH 8.0, 1 mM EDTA). </li><li> Kerede Freeze veya yetkili hücrelere dönüşümü. Dönüşüm için, yüksek yeterlilik 50 ul alikotundan (&gt; 5 x 10 9 transformant / mikrogram) yetkili E. başına seyreltilmiş reaksiyon 3 ul kullanın E. coli hücreleri. </li><li> LB agar 1 ml 50 ug / ml karbenisilin oyuk başına bir 24 oyuklu doku kültürü plakası ile takviye ekle (klonlanması için, yapıları 2 x sayıda kuyu hazırlama). </li><li> Çıkıntı levhanın ardından büyümesinin sonra: 25 ul, 24 oyuklu doku kültürü plakaları içeren agar üzerine bir kültür 1 5 seyreltme 25 ul. </li><li> Hafifçe eğerek plaka hücreleri yayılır. </li><li> 37 ° C&#39;de ya da bir flo 10-15 dakika için kapaklı plaka Kuruoda sıcaklığında w başlık. </li><li> Kapağı değiştirin ve baş aşağı çevirin ve plaka gece boyunca 37 ° C kuluçkaya yatmaktadır. </li><li> İki koloni ve mini-hazırlık vektörleri seçin. </li><li> PCR yapı belirli ters astar ve bir vektör özgü ileri primer (örn pOPIN_FOR GAC CGA AAT TAA TAC GAC TCA CTA TAG GG) kullanarak yapıları doğrulayın. </li></ol> E. 2. Dönüşüm coli E XPression suşlar Not: Bundan önce protokolü, E. gerçekleştirmeden E. coli yetkin hücreleri yapılan bölündü ve daha önce tarif edildiği gibi, 13 -80 ° C&#39;de donmuş olarak saklanır. Membran protein ifadesi rutin iki suşları taranır, Lemo21 (DE3) ve C41 (DE3) pLysS. Sonuçların yorumlanması yardımcı olmak için bu gibi bir pozitif kontrol, bir plasmid GFP veya eksprese etmesi için bilinen bir GFP ile kaynaşmış bir zar proteini ve boş vektör negatif kontrol dahil etmek yararlı olabilir. <ol><li> Ali çözülmequotted E. buz üzerinde coli. Seçkin hücrelerin ve her seferinde mini prepped ifade plazmidi 3 ul ekle. </li><li> 30 dakika boyunca buz üzerinde karışımı inkübe edin. </li><li> 42 ° C&#39;de 30 saniye için hücrelerin ısı şoku. </li><li> Hücreler 2 dakika boyunca buz üzerinde geri ve sonra da her tüpe güç suyu 300 ul ilave izin verin. </li><li> 37 ° C kuluçka makinesi içinde, statik, 1 saat süreyle inkübe edin. </li><li> 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ile takviye edilmiş, 24 oyuklu doku kültürü plakası, LB Agar hazırlayın. Lemo21 (DE3) ihtiva eden oyuklara 0.25 mM&#39;lik bir son konsantrasyona kadar ramnoz ekleyin. Not: ürün, C41 ihtiva eden kuyular toksik olma olasılığı ise (DE3) pLysS,% 1 (ağ / hac) glikoz ile takviye edilebilir. </li><li> Aktarım LB agar plakaları üzerine dönüşüm karışımı elde edilen hücreler, 30 ul. Yayılma ve 1,13-1,15 açıklandığı gibi plaka kurulayın. </li></ol> Gece Starter Kültürlerin 3. Hazırlık Not: Her zaman eski bir dönüşüm plakasından asla dönüşüm sonra gecede Kültürlerin gün hazırlar. <ol><li> 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ile takviye edilmiş 96 oyuklu bir derin oyuklu plakanın her bir oyuğuna 0.7 mi güç suyu ekleyin. 0.25 mM&#39;lik nihai bir konsantrasyona kadar Lemo21 (DE3) ihtiva eden oyuklara ramnoz ekleyin. İsteğe bağlı olarak,% 1 (ağ / hac) glikoz C41 (DE3) pLysS ek; Yukarıda (2.6 not) bkz. </li><li> Her kuyuya gecede dönüşüm plakaları bir koloni seçin. Bir gaz geçirgen conta ile blok Seal. </li><li> Gece boyunca 37 ° C &#39;de, küçük bir atış (örneğin 4.3 mm&#39;lik bir yörünge) ile bir inkübatör içerisinde büyük bir atış (örneğin, 25 mm kalınlığında bir yörünge) veya 600 rpm&#39;de bir kuluçka makinesi içinde 250 rpm&#39;de blok çalkalayın. </li></ol> 4. Büyüme ve Kültürlerin İndüksiyon <ol><li> Güç suyu 3 mi her 50 ug / ml karbenisilin ve 35 ug / ml kloramfenikol ağırlık ile takviye ekle24 gözlü derin gözlü plaka ell. Bölüm 3.1&#39;de tarif edildiği gibi, L-ramnoz (ve glikoz) ekleyin. Iki kez alımına olanak sağlamak kültür 3 ml kullanın ve gaz geçirgen conta içinden suyun bir kısmı buharlaştırma hareketliliği sağlar. </li><li> 24 gözlü derin gözlü bloklara her oyuğuna Lemo21 (DE3) ya da C41 (DE3) pLysS, gece boyunca kültürler 150 ul ekleyerek sentezleme kültürleri ayarlayın. </li><li> 595 nm&#39;de ortalama OD kadar 37 ° C &#39;de bloklar çalkalayın ~ plakası içinden 0.5. </li><li> 1.0 mM IPTG bir nihai konsantrasyona kadar kültürler IPTG eklenerek ifadesini teşvik eder. </li><li> 20 ° C de çalkalanarak kültürler, gece boyunca (18-20 saat) büyütün. </li></ol> In-jel Floresan tarafından İfade 5. Analizi <ol><li> Nüsha Hasat. Kare de, konik bir dip 96-iyice derin oyuklu bloğu her bir kuyudan kültür devri 1 mi. Not: Hasat iki kez blok veya kırılması durumunda alternatif akım test sağlamak içinİsterseniz deterjan ettik. </li><li> Blok kapatın ve 10 dakika boyunca 6000 x g&#39;de santrifüj ile hücreler hasat edilir. </li><li> Blok ters çevirin ve medya süzün. Kalan ortamı boşaltmak için kağıt havlu üzerine hafifçe blok dokunun. </li><li> 20 dakika içinde en az -80 ° C&#39;de plakalar ve mağaza kapatın. İsteğe bağlı olarak, bu noktada deney ve ne zaman uygun işlenmiş blok bırakın. </li><li> Oda sıcaklığında 20 dakika boyunca pelet de-don. </li><li> Liziz tamponu (50 mM NaH 2 PO 4, 300 mM NaCl, 10 mM imidazol,% 1 h, 200 ul tam hücreler tekrar süspansiyon, 4 ° C&#39;de, bir çok-kanallı bir pipet veya bir orbital çalkalayıcı (10 dakika süre ile 1000 rpm) ya kullanın / hac Tween 20), NaOH kullanılarak 8.0 pH ayarlanır. </li><li> (2 ml su içinde nihai hacimde 20 ul DNase (4.000 birim / ml), 20 mg lizozim ve 20 | il proteaz inhibitör kokteyli) 20 DLPI çözeltisi ul ekleyin. 4 ° C &#39;de (~ 1000 rpm) çalkalama ile 10 dakika süreyle inkübe edin. </li><li&gt;% 10 N -Dodecyl β-D-maltoside (DDİ) 25 ul ekle. </li><li> 4 ° C &#39;de (~ 1000 rpm), sallama ile 60 dakika boyunca inkübe edin. </li><li> Santrifüj 4 ° C&#39;de 30 dakika boyunca 6000 x g&#39;de kuyulu bloğu. </li><li> Bir mikro-titre plakasına temizlenir lizat 10 ul transferi ve SDS-PAGE jel yükleme tamponu (100 mM Tris, pH 6.8, ağ% 4, 10 ul / hac SDS,% 0.2 w Bromofenol mavisi,% 10 h / h β hac / mersaptoetanol ve% 20 hac / hac gliserol). DİKKAT NUMUNE kaynatın ETMEYİN. </li><li> Yük aşama 5.11&#39;den örnek 10 ul / gözenek SDS-PAGE jel (ler) üzerine ve boya cephesinin, dip (2-2.5 saat) ulaşana kadar soğuk bir odada 100-120 V (sabit voltaj) çalışır. </li><li> (GFP füzyon proteinleri tespit etmek için mavi ışık filtresi ile örneğin) bir görüntüleyici üzerine jel yerleştirin. pozlama süresi parlak bantlar doymuş değil emin olmak için seçilir. </li></ol> Hücre Kültürleri 6. Ölçek-up <ol><li> Yetkili bir kısım Dönüşümü <em&gt; E. E. coli gibi, bölüm 2&#39;de tarif edildiği. </li><li> (Bölüm 3 açıklandığı gibi takviye) güç suyu 10 ml bir koloni almak ve 37 ° C&#39;de gece boyunca büyür. </li><li> 500 mi güç suyu içine gece boyunca kültür 5 ml seyreltin. </li><li> 595 nm &#39;de OD kadar 37 ° C&#39;de 250 rpm&#39;de çalkalanarak büyütün ~ 0.5. </li><li> 1.0 mM&#39;lik nihai bir konsantrasyona kadar IPTG ilave edilerek ifadesini teşvik eder. </li><li> 20 ° C&#39;de, 250 rpm ile çalkalanarak bir gece boyunca büyütün. </li><li> Santrifüj Hasat hücreler 15 dakika boyunca 5.000 xg&#39;de. </li><li> Sil süpernatant. Hücre topakları -80 ° C&#39;de saklanabilir. </li></ol> Membranların 7. Hazırlık <ol><li> Hücre topağı gramı başına 5 ml&#39;lik bir hacimde 1x PBS pH 7.5 içinde, oda sıcaklığında ve tekrar süspansiyon ile çözülme hücreleri (eğer gerekli ise); Viskozite akıntısı kıvama düşene kadar gerekli ses düzeyini artırın. 10 ug / ml ve bir nihai konsantrasyon 1 mM, DNAz I nihai konsantrasyona MgCI2 eklemeHücre topağı gramı başına 20 proteaz inhibitörü tablet ambalajlı. 30 Kpsi&#39;de bir basınçta soğutulmuş bir hücre bozma kullanılarak açık hücre kırın. </li><li> 4 ° C&#39;de 15 dakika boyunca 30,000 g&#39;de bozulmamış hücreler ve artık taneleri. Ultra-santrifüj tüpüne süpernatant aktarın. </li><li> 4 ° C&#39;de 1 saat boyunca 200,000 x g hızında ultra santrifüj supernatant aşağı iplik toplam membran fraksiyonu toplamak. </li><li> Süpernatantı atın. </li><li> Hücre homojenleştirici kullanılarak buz gibi soğuk 10 mi, PBS pH 7.5 içinde membran topağı yeniden askıya. Membranlar yeniden süspansiyon haline getirildi, 1 ml her bir deterjan için gereklidir. İsteğe bağlı olarak, bu aşamada flaş -80 ° C&#39;de, sıvı azotun ve deposunda membran süspansiyonu dondurma. </li></ol> Membran Fraksiyon 8. Çözündürme ve Analizi <ol><li> Çözülme membran fraksiyonu (gerekirse), ve her bir deterjan için çözündürme için kullanılmak üzere, bir 1.5 ml zar süspansiyonu alikotu 900 ul poliallomer mikro Santrifüjge tüp. </li><li> Belirtilen bir 1.5 ml&#39;lik tübe% 1 bir son konsantrasyona kadar her bir yeni hazırlanmış bir deterjan 100 ul (% 10 w / DDM, DM h solüsyonlar, şimal-6 ve LDAO) ekleyin. Ökaryotik membran proteinleri, kolesterol hemisüksinat (% 0.2 son konsantrasyon) çözünürleştirme için deterjanlara ilave edilebilir. </li><li> Hafif çalkalanarak 1 saat boyunca 4 ° C&#39;de inkübe edin karışımları. </li><li> 45 dakika boyunca 4 ° C&#39;de 150,000 g, temin boruları, en az yarı dolu, bir tezgah üstü, ultra-santrifüj ile deterjan çözünmeyen payın taneleri hem süpematan saklayın. Not: Deterjan çözünme etkinliği ayni hacimde PBS içinde yeniden süspansiyon haline getirilmiş deterjan çözünmez kısma sahip çözündürülmüş membran GFP floresan ölçümü ile bir flüoresan plaka okuyucusu kullanılarak tahmin edilebilir. </li><li> Farklı bir deterjana mono-dağıtma özelliği analiz: Membran protein kompleksleri floresans tespit boyut dışlama kromatografisi kullanılarak (FSEC). </li><li> FSEC analizi için, / dakika 0.3 ml&#39;lik bir akış hızında tamponu (20 mM Tris, pH 7.5, 150 mM NaCI,% 0.03 DDM) çalışan, molekül ağırlığı 5,000,000 geniş bir fraksiyonlara ayırma aralığı bir ebat eksklüzyon kolonu, örneğin 5000 dengeye . Tüm numuneler için bu tampon kullanın, bu test her deterjan için değiştirilmez yani. </li><li> / Dakika 0.3 ml&#39;lik bir akış oranında sütun üzerine çözündürülmüş membran 100 ul enjekte edilir. Floresan optik (488 nm&#39;de uyarma ve emisyon 512 nm) ile elüsyon profilini izler. Bir satır içi floresan monitör mevcut değilse, fraksiyonlarım toplamak ve bir plaka okuyucusunda floresans okuyun. </li><li> Grafiksel gösterim için bir elektronik tablo programı içine İthalat elüsyon hacmi ve floresan yoğunluğu verileri. </li><li> Bölüm 5&#39;de tarif edildiği gibi in-jel floresan ile çözündürülmüş membran malzemesi kalan analiz eder. </li></ol>

<ol>
	<li>Wallin, E., von Heijne, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+integral+membrane+proteins+from+eubacterial,+archaean,+and+eukaryotic+organisms.">Genome-wide analysis of integral membrane proteins from eubacterial, archaean, and eukaryotic organisms.</a> Protein Sci. 7 (4), 1029-1038 (1998).</li><li>Fagerberg, L., Jonasson, K., von Heijne, G., Uhlen, M., Berglund, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prediction+of+the+human+membrane+proteome.">Prediction of the human membrane proteome.</a> Proteomics. 10 (6), 1141-1149 (2010).</li><li>Okada, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-Ray+diffraction+analysis+of+three-dimensional+crystals+of+bovine+rhodopsin+obtained+from+mixed+micelles.">X-Ray diffraction analysis of three-dimensional crystals of bovine rhodopsin obtained from mixed micelles.</a> J Struct Biol. 130 (1), 73-80 (2000).</li><li>Palczewski, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+rhodopsin:+A+G+protein-coupled+receptor.">Crystal structure of rhodopsin: A G protein-coupled receptor.</a> Science. 289 (5480), 739-745 (2000).</li><li>Miroux, B., Walker, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Over-production+of+proteins+in+Escherichia+coli:+mutant+hosts+that+allow+synthesis+of+some+membrane+proteins+and+globular+proteins+at+high+levels.">Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels.</a> J Mol Biol. 260 (3), 289-298 (1996).</li><li>Wagner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tuning+Escherichia+coli+for+membrane+protein+overexpression.">Tuning Escherichia coli for membrane protein overexpression.</a> Proc Natl Acad Sci U S A. 105 (38), 14371-14376 (2008).</li><li>Schlegel, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+membrane+protein+overexpression+in+the+Escherichia+coli+strain+Lemo21(DE3).">Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21(DE3).</a> J Mol Biol. 423 (4), 648-659 (2012).</li><li>Chun, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+partner+toolchest+for+the+stabilization+and+crystallization+of+G+protein-coupled+receptors.">Fusion partner toolchest for the stabilization and crystallization of G protein-coupled receptors.</a> Structure. 20 (6), 967-976 (2012).</li><li>Drew, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP-based+optimization+scheme+for+the+overexpression+and+purification+of+eukaryotic+membrane+proteins+in+Saccharomyces+cerevisiae.">GFP-based optimization scheme for the overexpression and purification of eukaryotic membrane proteins in Saccharomyces cerevisiae.</a> Nat Protoc. 3 (5), 784-798 (2008).</li><li>Drew, D. E., von Heijne, G., Nordlund, P., de Gier, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Green+fluorescent+protein+as+an+indicator+to+monitor+membrane+protein+overexpression+in+Escherichia+coli.">Green fluorescent protein as an indicator to monitor membrane protein overexpression in Escherichia coli.</a> FEBS Lett. 507 (2), 220-224 (2001).</li><li>Kawate, T., Gouaux, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-detection+size-exclusion+chromatography+for+precrystallization+screening+of+integral+membrane+proteins.">Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins.</a> Structure. 14 (4), 673-681 (2006).</li><li>Newstead, S., Kim, H., von Heijne, G., Iwata, S., Drew, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+fluorescent-based+optimization+of+eukaryotic+membrane+protein+overexpression+and+purification+in+Saccharomyces+cerevisiae.">High-throughput fluorescent-based optimization of eukaryotic membrane protein overexpression and purification in Saccharomyces cerevisiae.</a> Proc Natl Acad Sci U S A. 104 (35), 13936-13941 (2007).</li><li>Busso, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+protein+complexes+using+multiple+Escherichia+coli+protein+co-expression+systems:+a+benchmarking+study.">Expression of protein complexes using multiple Escherichia coli protein co-expression systems: a benchmarking study.</a> J Struct Biol. 175 (2), 159-170 (2011).</li><li>Sonoda, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Benchmarking+membrane+protein+detergent+stability+for+improving+throughput+of+high-resolution+X-ray+structures.">Benchmarking membrane protein detergent stability for improving throughput of high-resolution X-ray structures.</a> Structure. 19 (1), 17-25 (2011).</li><li>Low, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+analytical+gel+filtration+screening+of+integral+membrane+proteins+for+structural+studies.">High-throughput analytical gel filtration screening of integral membrane proteins for structural studies.</a> Biochim Biophys Acta. 1830 (6), 3497-3508 (2013).</li></ol>

The authors have nothing to disclose.

Bu makalede anlatılan protokolde, bir GFP raportör vektörü içine ligasyon bağımsız klonlama hızla E. birden fazla zar proteinlerinin nispi ifade taranması için floresan ile birleştirilir coli. Vektörler birincil ifade tarama bir hafta daha alarak dört iş günü içinde yapılabilir. Gelen jel bütün hücrelerin deterjan lizatlarının floresan ifadesi ikinci bir ekranda daha fazla analiz için tatmin edecek sıralamak için kullanılmaktadır. olduğu gibi primer sentezleme ekran dışında derin gözlü bloklara hücrelerin çoğaltılması için uygun olan bir sallanan kuluçka makinesi herhangi bir uzman ekipman gerektirmez. 96 oyuklu plakalar, SBS içeren tüm diğer sıvı taşıma çok kanallı pipet kullanılarak gerçekleştirilebilir. Protokol maddeler, farklı sentezleme koşulları (örneğin, daha düşük sıcaklık) altında yetiştirilir başka E. coli türleri içerecek şekilde modifiye edilebilir. Ramnoz seviyesini titre LEMO21 (DE3) durumunda (0 2.0 mM)Bazı membran proteinleri 7 ekspresyon seviyesini arttırabilir transkripsiyon hızını modüle etmek için ilave edildi. Sert deterjanlar, enklüzyon gövdelerinden elde proteinlerin çözündürülmesi ve bu yüzden yanlış pozitif vermesine rağmen DDM başka deterjanlar primer elemede çıkarılması için kullanılabilir. Açıkçası, daha ilk ekran haline ayrıntılı, daha zaman alıcı bir deney. İkincil ekran birincil ekranda tanımlanan ifade hit gelen toplam membran fraksiyonu hazırlanması içerir. Bu E. zara füzyon proteinlerinin lokalizasyonu doğrular olarak da önemli bir adımdır E. coli hücreleri. Değişik deterjanlar GFP füzyon proteininin sonraki ekstraksiyon deterjan-protein kompleksleri mono- dağıtma özelliği değerlendirmek için çözündürülmüş malzeme floresans tespit boyut dışlama kromatografi ile izlenir. Ne için en uygun deterjan tanımlar çünkü bu başka bir kritik adımsonraki sonraki işlemlerde membran proteini çözünürleşme. Bununla birlikte, deneyim deterjan (lar) ın seçimi daha fazla optimizasyon hala saflaştırma ve kristalleşme sırasında gerekli olabileceğini göstermektedir. Nispeten küçük bir misel boyutu (örneğin, LDAO) ile olanlar dahil olmak üzere çeşitli deterjanlar içinde homojen davranış kanıtlar en az prokaryotik membran proteinleri 14 kristaller kırılma de oluşturulması için bir eğilimi iyi bir göstergesi olduğu görülmektedir. Bu bağlamda, Şekil 2B&#39;de zar proteini için gösterilen profil son derece elverişli görünmektedir. GFP muhabiri kullanmanın ana avantajı un-saflaştırılmış örneklerde ifade hızlı okuma-out vermesidir. Bir dezavantajı, GFP füzyon proteini kristalizasyon için proteinin saflaştırılması sırasında kaldırılacak olmasıdır. Burada kullanılan vektörler durumunda, bir rinovirüs 3C proteaz bölgesi GFP bölünmesini sağlar. Seçenek olarak ise, bu basittirancak daha sonra saflaştırma için bir polihistidine veya başka bir afinite etiketi eklemek vektörlerine olarak belirlenen aday proteinleri,-klon yeniden. Bu GFP füzyon ekspresyonu için gerekli olduğunu varsayar. zar proteini ekspresyonu ve çözündürme tespiti için GFP füzyonu kullanılarak ana alternatif sadece bir histidin etiketi eklemektir. Bununla birlikte, bu yaklaşım, tipik olarak çok sayıda varyant değerlendirilmesi için çok zaman alan bir hale olan bir membran fraksiyonunun 15 ile başlayan gerektirir. Özet olarak, bu makalede tarif edilen protokol ana amacı, membran proteini dizisinin büyük bir sayısı hızla ifade ve deterjan çözünme açısından değerlendirildi ve daha derin bir analiz için öncelik varyantlarının sağlamaktır.

Bu zar proteinleri, insan genomu 2 dahil olmak üzere tüm dizilenmiştir genomları 1, kodlanmış genlerinin yaklaşık% 20-30 sorumlu olduğu tahmin edilmektedir. Ilaç hedefleri metabolitler, enerji üretimi, örneğin ulaşım ve birçok biyolojik süreçlerde kritik rolü göz önüne alındığında, onların üç boyutlu yapısını belirlemek yoğun ilgi var. Bununla birlikte, çözünür proteinler ile karşılaştırıldığında, zar proteinlerinin yüksek derecede yeterince temsil Protein Veri Bankası içindedir. Aslında, PDB (de 99.624 serbest yapıların <a href="http://www.rcsb.org/pdb/">http://www.rcsb.org/pdb/</a> ) Sadece 471 ( <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> ) zar proteinleri olarak sınıflandırılır. Bu da doğal olarak, nispeten düşük seviyelerde ifade edilmiştir zar proteinleri ile çalışan teknik zorluklar yansıtmaktadır; rodopsin, birkaç istisna dışında 3,4 biridir. Rekombinant sürümü Aşırı ifadesiheterolog hücrelerde ler genellikle üretim genel düzeyini sınırlayan zara hatalı katlanması ve yoksul hedefleme sonuçlanır. Bir kez eksprese eden bir membran proteinin ekstraksiyonu ve çözündürme için en iyi deterjan seçilmesi daha sonraki saflaştırma zorlaştırır ve dikkatli bir optimizasyon gerektirir. Escherichia coli% 72 (muhasebe zar proteinleri için en yaygın olarak kullanılan ekspresyon konak kalır <a href="http://blanco.biomol.uci.edu/mpstruc/">http://blanco.biomol.uci.edu/mpstruc/</a> bakteriyel kaynaklardan neredeyse sadece güncel çözülmüş yapılar). Belirli E. E. coli suşu C41 (DE3) ve C43 (DE3), zar proteinlerinin aşırı ifadesine neden olur ve bu nedenle, diğer BL21 için gözlenen toksiklik 5,6 suşları etkilerini önlemek etmeyen izole edilmiştir. Rekombinant zar proteini ekspresyonu seviyesini ayarlama üretimi 6,7 kalitesini optimize etmek için kritik olduğu görülmektedir. 6-8 yararlanmak için birden ortologlara de dahil olmak üzere birden çok alternatifler değerlendirilmesini gerektirmiştir. Bu nedenle, paralel bir çok zar proteinlerinin sentezlenmesi taranması için bir yöntem gereklidir. Bir yaygın kullanılan yaklaşım protein arındırmak gerek kalmadan izlenebilir yeşil floresan protein (GFP) sağlayan ifadeye protein kaynaştırmak için. Bu şekilde, farklı deterjanlarda ekspresyon düzeyi, kararlılık ve davranış hakkında bilgiler un saf malzeme 9-12 küçük miktarları ile değerlendirilebilir. Bu yazıda E. membran proteinlerinin klonlanması ve ifade taraması için bir aerodinamik protokol açıklar coli, üretim ve deterjan sonraki karakterizasyonu bir muhabir olarak GFP için füzyon kullanarak: Protein complexes (Şekil 1).

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Name of Material</td>
			<td>Company</td>
			<td>Catalog Number</td>
		</tr>
		<tr>
			<td>pOPIN-N-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>pOPINE-3C-GFP</td>
			<td>addgene (www.addgene.org)</td>
			<td></td>
		</tr>
		<tr>
			<td>C41(DE3)pLysS</td>
			<td>Lucigen (http://lucigen.com/</td>
			<td>60444-1</td>
		</tr>
		<tr>
			<td>LEMO21(DE3)</td>
			<td>New England Biolabs</td>
			<td>C2528H</td>
		</tr>
		<tr>
			<td>In-Fusion HD EcoDry Cloning System, 96 Rxns</td>
			<td>Clontech/Takara</td>
			<td>639688</td>
		</tr>
		<tr>
			<td>Power broth</td>
			<td>Molecular Dimensions (http://www.moleculardimensions.com/)</td>
			<td>MD12-106-1</td>
		</tr>
		<tr>
			<td>Protease Inhibitor tablets</td>
			<td>Roche</td>
			<td>11697498001</td>
		</tr>
		<tr>
			<td>cOmplete, Mini, EDTA-Free; Protease Inhibitor Cocktail&#160;</td>
			<td>Roche</td>
			<td>11836170001</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma-Aldrich</td>
			<td>83650</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P8849</td>
		</tr>
		<tr>
			<td>DNAse 1</td>
			<td>Sigma-Aldrich</td>
			<td>DN25</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>Sigma-Aldrich</td>
			<td>L7651</td>
		</tr>
		<tr>
			<td>Cholesterol hemisuccinate</td>
			<td>Sigma-Aldrich</td>
			<td>C6512</td>
		</tr>
		<tr>
			<td>CYMAL-6 ( 6-Cyclohexyl-1-Hexyl-&#946;-D-Maltoside)</td>
			<td>Anatrace</td>
			<td>C326</td>
		</tr>
		<tr>
			<td>DDM ( n-Dodecyl &#223;-maltoside )</td>
			<td>Generon</td>
			<td>D97002</td>
		</tr>
		<tr>
			<td>DM (n-Decyl &#223;-maltoside)</td>
			<td>Generon</td>
			<td>D99003</td>
		</tr>
		<tr>
			<td>LDAO ( N,N-Dimethyl-n-dodecylamine N-oxide)</td>
			<td>Generon</td>
			<td>D71111</td>
		</tr>
		<tr>
			<td>E1 ClipTip Eq384 8 channel 1-30 ul&#160;</td>
			<td>Thermo Scientific&#160;</td>
			<td>4672030</td>
		</tr>
		<tr>
			<td>Rainin Pipette Pipet-Lite XLS 6ch 100-1200&#181;L LTS Spacer</td>
			<td>Anachem</td>
			<td>LA6-300XLS</td>
		</tr>
		<tr>
			<td>Rainin Pipette Light XLS+ 8ch 2-20&#181;L LTS</td>
			<td>Anachem</td>
			<td>L8-20XLSPLUS</td>
		</tr>
		<tr>
			<td>Pipette Pipet-Lite XLS 8ch 100-1200&#181;L LTS Tip</td>
			<td>Anachem</td>
			<td>L8-1200XLS</td>
		</tr>
		<tr>
			<td>24 well V bottom deep well blocks</td>
			<td>Porvair sciences</td>
			<td>360115</td>
		</tr>
		<tr>
			<td>BenchMark Fluorescent Protein Standard</td>
			<td>Life Technologies</td>
			<td>LC5928</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 10% Bis-Tris Midi Protein Gels, 26 well</td>
			<td>Life Technologies</td>
			<td>WG1203BOX</td>
		</tr>
		<tr>
			<td>XCell4 SureLock Midi-Cell</td>
			<td>Life Technologies</td>
			<td>WR0100</td>
		</tr>
		<tr>
			<td>Vibramax 100</td>
			<td>Heidolph</td>
			<td>544-21200-00</td>
		</tr>
		<tr>
			<td>Tension rollers attachment</td>
			<td>Heidolph</td>
			<td>549-81000-00</td>
		</tr>
		<tr>
			<td>ptima L-100 Ultracentrifuge running 45-Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>393253</td>
		</tr>
		<tr>
			<td>Optima Max-XP ultracentrifuge running TLA-55 rotor</td>
			<td>Beckman Coulter</td>
			<td>393315</td>
		</tr>
		<tr>
			<td>Floor standing centrifuge, Avanti J-26S XPI running JA-17 and JS-5.3 rotors&#160;</td>
			<td>Beckman Coulter</td>
			<td>B14535</td>
		</tr>
		<tr>
			<td>Prominence UFLC with RF-20A Fluorescence detector</td>
			<td>Shimadzu</td>
			<td></td>
		</tr>
		<tr>
			<td>Sepharose 6 10/300 GL size exclusion column</td>
			<td>GE Healthcare</td>
			<td>17-5172-01&#160;</td>
		</tr>
		<tr>
			<td>SSI5R-HS SHEL LAB Floor Model Shaking Incubator, 5 Cu.Ft. (144 L), 30-850 RPMs</td>
			<td>Shel Lab&#160;</td>
			<td>SSI5R-HS</td>
		</tr>
		<tr>
			<td>Innova44R incubator</td>
			<td>New Brunswick /Eppendorf</td>
			<td>Innova44R</td>
		</tr>
		<tr>
			<td>TS SERIES 0.75KW DISRUPTER 230V 50HZ 1PH (40KPSI)</td>
			<td>Constant systems</td>
			<td>PL083016</td>
		</tr>
		<tr>
			<td>L-Rhamnose monohydrate</td>
			<td>Sigma</td>
			<td>83650</td>
		</tr>
	</tbody>
</table>

green fluorescent protein-based expression screening of membrane proteins in escherichia coli

yapısal ve fonksiyonel çalışmalar için yeniden birleştirici zar proteinlerinin üretimi nedeniyle düşük seviyeli dışavurumu ve bir kez deterjanlar içinde çözünür bir çok zar proteinlerinin tabiatında bulunan kararsızlık için teknik açıdan zor olmaya devam etmektedir. Bir protokol GFP floresan tespit Escherichia coli ekspresyon GFP füzyonları olarak zar proteinlerinin bağlama bağımsız klonlama birleştiren tarif edilmektedir. Bu çoklu membran proteini inşaat ve ifade tarama / zaman ve çaba daha fazla yatırım için uygun adayları tespit varyantları sağlar. GFP raportör SDS poliakrilamid jel elektroforezi (SDS-PAGE), aşağıdaki GFP floresan görselleştirerek ifade primer elemede kullanılır. Serbest GFP yokluğu ile gösterildiği gibi en az bozulma ile yüksek bir ifade seviyesi ortaya koymuştur Zar proteinleri, ikinci bir ekran için seçilir. Bu yapılar ölçekli ve toplam zar fraksiyonu hazırlanır ve çözünür vardırDört farklı deterjan d. Deterjan çözünmeyen malzemenin ayrılması için ultrasantrifüj sonra lizatlar floresans saptama boyut ayrımı kromatografisiyle (FSEC) ile analiz edilmiştir. GFP floresan boyut dışlama profili İzleme farklı deterjanlarda membran proteinlerinin mono-dispersiteleri ve bütünlüğü hakkında bilgi sağlar. Protein ya da çok az serbest GFP ve minimum agregasyonu ile simetrik bir zirve ile elüte deterjan kombinasyonu daha sonra saflaştırma için adaydırlar. Yukarıdaki metodoloji, E. heterolog ifade kullanma SED (şekil, uzama, bölünme ve sporülasyon) bakteri 47 farklı tür proteinlerin coli analiz edildi. Bu proteinler genellikle on transmembran ve hücre bölünmesi için gereklidir. Sonuçlar, E. coli &#39;de SED&#39;leri ortologlara üretimi coli GFP füzyon proteinlerinin ifade seviyelerine saygı ve dürüstlük son derece değişken. Deney Idaha fazla araştırma için bir alt dentified.

Proteinlerin (şekil, uzama, bölünme ve sporülasyon) olarak SEDS ailesi bakteriyel hücre bölünmesi için gereklidir. Bu tamamlayıcı proteinler tipik olarak hücre içinde hem de amino ve karboksi sonlarını on transmembran etki vardır. Yukarıda tarif edilen protokol örneklemek amacıyla, 47 SED&#39;leri ortologlara vektör pOPINE-3C-EGFP klonlanmıştır. Konstruktlarının bir küçük ölçekli ekspresyon ekranı iki D .coli suşları gerçekleştirildiği, 0.25 mM mevcudiyetinde büyütülen Lemo21 (DE3) rutin membran ekspresyonu için kullanılan sızan ifade ve C41 (DE3) pLysS, bloke etme ramnoz proteinler 5-8. İndüklenmiş kültürlerin deterjan çözünebilir lisatları, SDS-poliakrilamid elektroforez ile analiz edilmiştir. -Jel floresan kullanılarak ifade GFP füzyon proteinleri 47 SED&#39;ler yapıları üzerinden iki suşları arasında 38 üretilmiş olduğunu gösterdi görselleştirmek için. İlginçtir iki ifade suşları arasındaki farklar vardı. 38 yapıları ifade edilen, sadece 18, her iki soy, yalnızca C41 (DE3) pLysS içinde Lemo21 (DE3) &#39;e ve 6&#39;da ifade edilen, 14 üretildi. Genel olarak, C41 (DE3) pLysS (24 vs 38) ile karşılaştırıldığında Lemo21 (DE3) için daha yüksek bir başarı oranı oldu. Ancak, bazı proteinler, soy spesifik olduğu ortaya çıktı gözlem hem de tarama yararlı olduğu anlamına gelir. 47 SED&#39;ler ve 24 için temsili veri yapıları, Şekil 1 &#39;de gösterilmiştir. Bantların yoğunluğu, ancak her iki soy iyi ilave olarak ifade edilir, örneğin Şekil 1A ve 1 B&#39; de de C4 füzyon proteini ekspresyon seviyesinin bir göstergesini verir, düşük molekül ağırlıklı bant, protein olarak kısmen indirgenen olduğunu göstermektedir. Birçok şerit tek başına GFP boyutundaki gelen bir grup var. Protein bütünlüğünün kalite değerlendirmesi serbest GFP füzyon proteini nisbetle yoğunluğu bakarak gerçekleştirilebilir;Örneğin G4 ve H4 tamamen bazı Sağlam protein (Şekil 1A) bulunmaktadır Lemo21 (DE3&#39;ün) oysa C41 (DE3) pLysS (Şekil 1B) ücretsiz GFP aşağı kırılmış. 38 olarak ifade edilen proteinleri üzerinden 14 için serbest GFP bandının yoğunluğu (serbest GFP bir bandın şiddeti, füzyon proteini ve füzyon proteinlerinin bir kısmında daha büyük olan 21 için, 3 füzyon proteininin benzerdir / 38) ifade örneğin F6 ve Şekil 1A G6 füzyon proteinine kıyasla nispeten az serbest GFP var. Ve G6 (küçük ücretsiz GFP) ifade edildi ve 500 ml hücre kültüründen hazırlanan toplam membran fraksiyonunun (ücretsiz GFP ve füzyon proteinleri için yüksek yoğunluklu bantları) birincil ekran B5 iyi ifade yapıları iki. Tekrar süspansiyon haline getirilen zarlar kısma bölünmüştür ve floresan ile saptanan boyut ayrımı kromatografisiyle (FSEC) ile analiz edilmiştir. FSEC profilleri Figür sunulmuşture 2A ve 2B sırasıyla iki SED&#39;ler proteinler test dört deterjanlarda farklı davrandığını göstermektedir. Bir durumda (Şekil 2A: Örnek B5) proteini sadece bu nedenle daha sonraki saflaştırma için tercih edilen bir deterjan olacaktır DDM az agregasyonu ile simetrik bir tepe verdi. Aksine diğer füzyon proteini tarafından (Şekil 2B: Örnek G6) test edilen tüm deterjanlarda benzer bir profil verdi. <img alt="Şekil 1," src="/files/ftp_upload/52357/52357fig1highres.jpg" width="700px" /> Şekil 1: E. membran proteini ifade taranması için iş akışı şeması coli GFP muhabiri kullanarak. <img alt="Şekil 2," src="/files/ftp_upload/52357/52357fig2highres.jpg" /> Şekil 2:-jel floresan kullanılarak zar proteini ifade birincil ekranı. </strongE.&gt; Deterjan lizatları E. coli, SDS-PAGE ile analiz edildi hücreleri ve jeller Mavi Epi aydınlatma ve 530/28 filtre kullanılarak görüntülenmiştir. Sonuçlar (96 oyuklu bir plaka içerisinde pozisyonlarına göre A4 H6 etiketli) 24 yapıları için gösterilmiştir. serbest GFP ve GFP füzyon proteinleri için bantlarının pozisyonları gösterilir. Lemo21 (DE3). (B), C41 (DE3) pLysS ifade Proteinlerin ifade (A), proteinler. <img alt="Şekil 3," src="/files/ftp_upload/52357/52357fig3highres.jpg" /> Şekil 3:. Zar proteini ifade ikincil ekran Floresan tespit boyut dışlama kromatografisi (FSEC) kullanılarak toplam membran fraksiyonları dört farklı deterjanlarda ekstre edilmiş ve çözündürülmüş membran proteinleri bir floresan detektörüne bağlanmış bir FPLC sistemi kullanılarak boyut dışlama kromatografisi ile analiz edilmiştir. Için FSEC profiller (A), membran proteini B5 ve (B) </strong&gt; zar proteini G6. birleştirilmiş protein, çözündürülmüş, GFP füzyon proteini ve serbest GFP&#39;ye karşı gelen bir zirve konumu belirtilmiştir. Test deterjanlar profilleri aşağıda belirtilmiştir.

Watch this Scientific Journal Video about Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli at JoVE.com

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Yeşil floresan proteini füzyon göre, Escherichia coli içinde rekombinant zar proteinlerinin ifadesi için tarama için bir aerodinamik bir yaklaşım sunulmuştur.

Membran proteinlerinin Yeşil floresan proteini temelli Ekspresyon elemesinde<em&gt; Escherichia coli</em

The production of recombinant membrane proteins for structural and functional studies remains technically challenging due to low levels of expression and ...

green-fluorescent-protein-based-expression-screening-membrane

Research

JoVE Journal

Biology

Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

32.6K Görüntüleme.  Research Complex at Harwell.  Yeşil floresan proteini füzyon göre, Escherichia coli içinde rekombinant zar proteinlerinin ifadesi için tarama için bir aerodinamik bir yaklaşım sunulmuştur. 

Video: Green Fluorescent Protein-based Expression Screening of Membrane Proteins in Escherichia coli

Staining of Proteins in Gels with Coomassie G-250 without Organic Solvent and Acetic Acid

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents (Methanol, Ethanol or 2-Propanol) and acetic acid are used for fixation, staining and destaining of proteins in a gel after SDS-PAGE. To speed up the procedure, heating the staining solution in the microwave oven for a short time is frequently used. This usually results in evaporation of toxic or hazardous Methanol, Ethanol or 2-Propanol and a strong smell of acetic acid in the lab which should be avoided due to safety considerations. In a protocol originally published in two patent applications by E.M. Wondrak (US2001046709 (A1), US6319720 (B1)), an alternative composition of the staining solution is described in which no organic solvent or acid is used. The CBB is dissolved in bidistilled water (60-80mg of CBB G-250 per liter) and 35 mM HCl is added as the only other compound in the staining solution. The CBB staning of the gel is done after SDS-PAGE and thorough washing of the gel in bidistilled water. By heating the gel during the washing and staining steps, the process can be finished faster and no toxic or hazardous compunds are evaporating. The staining of proteins occurs already within 1 minute after heating the gel in staining solution and is fully developed after 15-30 min with a slightly blue background that is destained completely by prolonged washing of the stained gel in bidistilled water, without affecting the stained protein bands.

A short protocol for protein staining with Coomassie Brilliant Blue (CBB) G-250 in polyacrylamide gels is described without using organic solvents or acetic acid as in the classical staining procedures with CBB.

Organik Solvent ve Asetik Asit olmadan Jeller Coomassie G-250 ile Proteinlerin Boyama

In classical protein staining protocols using Coomassie Brilliant Blue (CBB), solutions with high contents of toxic and flammable organic solvents ...

Biyoloji

Crystallizing Membrane Proteins for Structure Determination using Lipidic Mesophases

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the lipidic cubic phase or in meso method. The method has been shown to be quite versatile in that it has been used to solve X-ray crystallographic structures of prokaryotic and eukaryotic proteins, proteins that are monomeric, homo- and hetero-multimeric, chromophore-containing and chromophore-free, and alpha-helical and beta-barrel proteins. Recent successes using in meso crystallization are the human engineered beta2-adrenergic and adenosine A2a G protein-coupled receptors. Protocols are presented for reconstituting the membrane protein into the monoolein-based mesophase, and for setting up crystallizations in the manual mode. Additional steps in the overall process, such as crystal harvesting, are to be addressed in future video articles. The time required to prepare the protein-loaded mesophase and to set up a crystallization plate manually is about one hour.

Herein is described the procedure implemented in the Caffrey Membrane Structural and Functional Biology Group to set up manually crystallization trials of membrane proteins in lipidic mesophases.

Lipidik Mesophases kullanarak Yapı Tayini için Membran Proteinleri Kristalize

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Lipidik Mesophases Membran Proteinleri Yüksek throughput Kristalizasyon için bir robot kullanımı

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Intravital Microscopy for Imaging Subcellular Structures in Live Mice Expressing Fluorescent Proteins

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, we use the salivary glands of live mice since they provide several advantages. First, they can be easily exposed to enable access to the optics, and stabilized to facilitate the reduction of the motion artifacts due to heartbeat and respiration. This significantly facilitates imaging and tracking small subcellular structures. Second, most of the cell populations of the salivary glands are accessible from the surface of the organ. This permits the use of confocal microscopy that has a higher spatial resolution than other techniques that have been used for in vivo imaging, such as two-photon microscopy. Finally, salivary glands can be easily manipulated pharmacologically and genetically, thus providing a robust system to investigate biological processes at a molecular level.
In this study we focus on a protocol designed to follow the kinetics of the exocytosis of secretory granules in acinar cells and the dynamics of the apical plasma membrane where the secretory granules fuse upon stimulation of the beta-adrenergic receptors. Specifically, we used a transgenic mouse that co-expresses cytosolic GFP and a membrane-targeted peptide fused with the fluorescent protein tandem-Tomato. However, the procedures that we used to stabilize and image the salivary glands can be extended to other mouse models and coupled to other approaches to label in vivo cellular components, enabling the visualization of various subcellular structures, such as endosomes, lysosomes, mitochondria, and the actin cytoskeleton.

Intravital microscopy is a powerful tool that enables imaging various biological processes in live animals. In this article, we present a detailed method for imaging the dynamics of subcellular structures, such as the secretory granules, in the salivary glands of live mice.

Floresan Proteinler ifade Canlı Farelerde Görüntüleme hücrealtı Yapıların Intravital Mikroskopi

Here we describe a procedure to image subcellular structures in live rodents that is based on the use of confocal intravital microscopy. As a model organ, ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Bir uygulama için Protokoller<em&gt; Escherichia coli</emSentetik Biyoloji&gt; Tabanlı TX-TL Hücre-Özgür İfade Sistemi

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

Üretilen Rekombinant Disülfid zengin Venom Proteinler Uygulanan Yüksek Randımanlı Sayısal Anlatım Tarama ve Arıtma<em&gt; E. coli</em

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble unimers below a characteristic transition temperature and aggregating into micron-scale coacervates above their transition temperature. The design of elastin-like polypeptides at the genetic level permits precise control of their sequence and length, which dictates their thermal properties. Elastin-like polypeptides are used in a variety of applications including biosensing, tissue engineering, and drug delivery, where the transition temperature and biopolymer architecture of the ELP can be tuned for the specific application of interest. Furthermore, the lower critical solution temperature phase transition behavior of elastin-like polypeptides allows their purification by their thermal response, such that their selective coacervation and resolubilization allows the removal of both soluble and insoluble contaminants following expression in Escherichia coli. This approach can be used for the purification of elastin-like polypeptides alone or as a purification tool for peptide or protein fusions where recombinant peptides or proteins genetically appended to elastin-like polypeptide tags can be purified without chromatography. This protocol describes the purification of elastin-like polypeptides and their peptide or protein fusions and discusses basic characterization techniques to assess the thermal behavior of pure elastin-like polypeptide products.

Non-chromatographic Purification of Recombinant Elastin-like Polypeptides and their Fusions with Peptides and Proteins from Escherichia coli

Elastin-like polypeptides are stimulus-responsive biopolymers with applications ranging from recombinant protein purification to drug delivery. This protocol describes the purification and characterization of elastin-like polypeptides and their peptide or protein fusions from Escherichia coli using their lower critical solution temperature phase transition behavior as a simple alternative to chromatography.

Peptidler ve proteinler ile rekombinant Elastin gibi Polipeptitlerin ve Fusions olmayan kromatografik saflaştırma<em&gt; Escherichia coli</em

Elastin-like polypeptides are repetitive biopolymers that exhibit a lower critical solution temperature phase transition behavior, existing as soluble ...

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in vitro. In particular, we show that the poor solubility of Escherichia coli DNA polymerase III &#949; subunit (featuring 3&#8217;-5&#8217; exonuclease activity) is highly improved when the same protein is co-expressed with the &#945; and &#952; subunits (featuring DNA polymerase activity and stabilizing &#949;, respectively). We also show that protein co-expression in E. coli can be used to efficiently test the competence of subunits from different bacterial species to associate in a functional protein complex. We indeed show that the &#945; subunit of Deinococcus radiodurans DNA polymerase III can be co-expressed in vivo with the &#949; subunit of E. coli. In addition, we report on the use of protein co-expression to modulate mutation frequency in E. coli. By expressing the wild-type &#949; subunit under the control of the araBAD promoter (arabinose-inducible), and co-expressing the mutagenic D12A variant of the same protein, under the control of the lac promoter (inducible by isopropyl-thio-&#946;-D-galactopyranoside, IPTG), we were able to alter the E. coli mutation frequency using appropriate concentrations of the inducers arabinose and IPTG. Finally, we discuss recent advances and future challenges of protein co-expression in E. coli.

The Multifaceted Benefits of Protein Co-expression in Escherichia coli

Protein co-expression is a powerful alternative to the reconstitution in vitro of protein complexes, and is of help in performing biochemical and genetic tests in vivo. Here we report on the use of protein co-expression in Escherichia coli to obtain protein complexes, and to tune the mutation frequency of cells.

Protein birlikte-ifade edilme yönlü Faydalar<em&gt; Escherichia coli</em

We report here that the expression of protein complexes in vivo in Escherichia coli can be more convenient than traditional reconstitution experiments in ...

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

The canonical set of amino acids leads to an exceptionally wide range of protein functionality. Nevertheless, the set of residues still imposes limitations on potential protein applications. The incorporation of noncanonical amino acids can enlarge this scope. There are two complementary approaches for the incorporation of noncanonical amino acids. For site-specific incorporation, in addition to the endogenous canonical translational machineries, an orthogonal aminoacyl-tRNA-synthetase-tRNA pair must be provided that does not interact with the canonical ones. Consequently, a codon that is not assigned to a canonical amino acid, usually a stop codon, is also required. This genetic code expansion enables the incorporation of a noncanonical amino acid at a single, given site within the protein. The here presented work describes residue-specific incorporation where the genetic code is reassigned within the endogenous translational system. The translation machinery accepts the noncanonical amino acid as a surrogate to incorporate it at canonically prescribed locations, i.e., all occurrences of a canonical amino acid in the protein are replaced by the noncanonical one. The incorporation of noncanonical amino acids can change the protein structure, causing considerably modified physical and chemical properties. Noncanonical amino acid analogs often act as cell growth inhibitors for expression hosts since they modify endogenous proteins, limiting in vivo protein production. In vivo incorporation of toxic noncanonical amino acids into proteins remains particularly challenging. Here, a cell-free approach for a complete replacement of L-arginine by the noncanonical amino acid L-canavanine is presented. It circumvents the inherent difficulties of in vivo expression. Additionally, a protocol to prepare target proteins for mass spectral analysis is included. It is shown that L-lysine can be replaced by L-hydroxy-lysine, albeit with lower efficiency. In principle, any noncanonical amino acid analog can be incorporated using the presented method as long as the endogenous in vitro translation system recognizes it.

Residue-specific Incorporation of Noncanonical Amino Acids into Model Proteins Using an Escherichia coli Cell-free Transcription-translation System

An easy-to-use, cell-free expression protocol for the residue-specific incorporation of noncanonical amino acid analogs into proteins, including downstream analysis, is presented for medical, pharmaceutic, structural and functional studies.

Bir Kullanarak Modeli Proteinler içine Kuralsız Amino Asit kalıntı özgü Ortaklığın<em&gt; Escherichia coli</em&gt; Hücre içermeyen Transkripsiyon-çeviri Sistemi

The canonical set of amino acids leads to an exceptionally wide range of protein functionality. Nevertheless, the set of residues still imposes ...

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived inheritance encoded in protein conformation (rather than sequence) has long been viewed as paradigm-shifting but rare. The best characterized examples of such epigenetic elements are prions, which possess a self-assembling behavior that can drive the heritable manifestation of new phenotypes. Many archetypal prions display a striking N/Q-rich sequence bias and assemble into an amyloid fold. These unusual features have informed most screening efforts to identify new prion proteins. However, at least three known prions (including the founding prion, PrPSc) do not harbor these biochemical characteristics. We therefore developed an alternative method to probe the scope of protein-based inheritance based on a property of mass action: the transient overexpression of prion proteins increases the frequency at which they acquire a self-templating conformation. This paper describes a method for analyzing the capacity of the yeast ORFeome to elicit protein-based inheritance. Using this strategy, we previously found that &gt;1% of yeast proteins could fuel the emergence of biological traits that were long-lived, stable, and arose more frequently than genetic mutation. This approach can be employed in high throughput across entire ORFeomes or as a targeted screening paradigm for specific genetic networks or environmental stimuli. Just as forward genetic screens define numerous developmental and signaling pathways, these techniques provide a methodology to investigate the influence of protein-based inheritance in biological processes.

High-throughput Screening for Protein-based Inheritance in S. cerevisiae

This protocol describes a high-throughput methodology to functionally screen for protein-based inheritance in S. cerevisiae.