Bu çalışma Mükemmeliyet Merkezleri Ontario ve Ontario Araştırma Fonundan JK hibe ile mümkün olmuştur. Biz çekimler sırasında teknik yardım için Sıddıka Pardhan Dr. Peter Ferguson teşekkür etmek istiyorum.

Not: Aşağıdaki protokol yapışık hücreler ile birlikte kullanılmak üzere tasarlanmıştır. Değişiklikler süspansiyon içinde yetiştirilmiş yapışmayan hücreler yöntemin uygulanması gerekmektedir. Protokolde tarif edilen TAT deneyleri, bir flüoresan işaretleyici (örn, GFP, TTT, vs.) ifade eden hücreler ile birlikte kullanılmak üzere tasarlanmıştır. Dokuz gün eski tavuk embriyoları CAM deneyleri için deney protokolünde 2 gününde gereklidir. 1. Hazırlık ve antisens oligonükleotidler ile tümör hücrelerinin transfeksiyonu (ASO&#39;lar) <ol><li> Çevrede hücreleri ihtiva eden T75 şişesinin (ler) aspire ortamı 1XPBS ile yıkayın ve% 0.25 tripsin / EDTA 2 ilave edin. Her bir şişeye, tam büyüme ortamında 10 ml ilave edilir ve 50 ml&#39;lik bir tüp çözelti içinde hücreleri aktarın. Hücreleri saymak ve nihai konsantrasyon ml başına 5 hücreleri 1.0x10 böylece ses düzeyini ayarlamak. </li><li> T25 şişe etiketi iki grup: bir grup 1-8 etiketli sekiz şişeler, içerecektir ve u olacakGerçek zamanlı metabolizması ölçüm deney için sed; ve ikinci grup da 8 şişeler içerecektir ve tavuk embriyo CAM deney için kullanılır. Inkübatör her şişeye ve yeri (37 ° C,% 5 CO2 O / N) çözelti içinde hücre 2 ml ilave edilir. </li><li> Ertesi sabah (Gün 0, gün 0), etiket üç adet 5 ml&#39;lik tüp şunlardır: kontrol (hedefleme ASO veya siRNA), &quot;ilgi konusu hedef &#39;(yani, hedef ASO veya siRNA) ve Lipofektamin 2000 (ya da benzer bir transfeksiyon tepkin maddesi). Uygun bir tüp içinde, serum içermeyen ortam ile uygun konsantrasyona hazır ASO çözüm seyreltin. <ol><li> Uygun bir tüpe, transfeksiyon tepkin maddesi gerekli miktarda ilave edilir ve 5 dakika boyunca, serum-içermeyen ortam içinde inkübe edilir. ASO tüplerine transfeksiyon reaktifi çözeltisi ilave edin ve 20 dakika boyunca inkübe edin. </li></ol></li><li> Her iki grupta da şişeler 1-4 her bir kontrol ASO transfeksiyon reaktifi çözeltisi 250 ul ekleyin ve 250Her gruptaki matara 5-8 her birine &#39;hedef ilgi&#39; ASO transfeksiyon reaktif çözeltisi ul. 4 saat (37 ᵒC,% 5 CO2) inkübe edin. <ol><li> İnkübasyon sırasında, bölüm 2.1&#39;de anlatılan adımları yürütmek. İnkübasyondan sonra, CAM deney grubunda, her şişeye tam ortam 3 ml ekleyin ve inkübatör O dönmek / K (37 ᵒC,% 5 CO2). Bölüm 2.2 açıklamaya göre metabolizma deney grubu işleyin. Bölüm 4 açıklamaya göre ayarlanır CAM deneyi işleyin. </li></ol></li></ol> 2. Biosensor Chip Hazırlama ve Hücre Tohumculuk <ol><li> Steril bir ortamda, dikkatli bir şekilde, PBS içinde 400 ul altı biyosensör çipleri yıkayın. 20 dakika boyunca% 70 etanol içinde 400 ul fiş ile sterilize edin. PBS içinde 400 ul ile üç kez yıkanır. <ol><li> Steril doku Kültür içindeki cips yerleştirinE yemekleri kontaminasyonu önlemek için. &#39;Kontrol&#39; etiketli bir tabak üç fiş yerleştirin ve &#39;ilgi hedef&#39; etiketli bir tabak üç. </li></ol></li><li> &#39;Kontrol&#39; ve &#39;ilgi hedef&#39; olarak iki 50 ml&#39;lik tüpler etiketleyin. Hücrelerin PBS ile yıkayın ve% 0.25 tripsin / EDTA, uygun bir hacim kazandırmak. Tek tabakalı ayrılana kadar bekleyin ve her şişeden hücreleri toplamak. Uygun tüpe çözüm yatırın. <ol><li> Hücreleri saymak ve nihai konsantrasyon 6.0x10 5 hücre / ml olacak şekilde ses seviyesini ayarlayın. Başlangıç ​​konsantrasyonu çok düşükse Santrifüj hücreleri tekrar süspansiyon ve. </li></ol></li><li> (Çip başına 1.25x10 5 hücre toplam), uygun grup, her biyo-algılayıcı çip, hücre çözeltisinin 250 ul ekle. Cips kafa karıştırıcı riskini en aza indirmek için bir defada bu görevi bir grup gerçekleştirin. Buharlaşmayı önlemek için bir nem odası içinde fiş içeren steril yemekler yerleştirin ve nem cha yermber inkübatör O / N (37 ᵒC,% 5 CO2). </li><li> Ertesi sabah (Gün 1), dikkatli bir şekilde her bir yonga için ortamın aspire ve% 0.2 fetal sığır serumu (FBS) ve 1 x penisilin ve streptomisin (P / S) ile desteklenmiş büyüme ortamında 250 ul ile değiştirin. 4 saat (37 ᵒC,% 5 CO2) inkübe edin. </li></ol> 3. Metabolizma Ölçüm Sistemi Hazırlama ve Çözüm Hazırlık <ol><li> İnkübasyon sırasında, gerekli ilaç çözümleri ve gelecek tahlil için metabolizma ölçüm sistemini hazırlamak. NOT: metabolizma ölçüm sistemi, altı modülden toplam içerir. Her modül deney başına bir çip barındırmaktadır. <ol><li> Aşağıdaki deneysel gruba tahlil bölmek: bir çip &#39;kontrol&#39; ve tahlil süresince araç almak için gruplar &#39;ilgi hedefin&#39; her birinden; Her grup, iki fiş a esnasında belirli bir zaman dönemi için ilaç tedavisi almakssay, arınma döneminde araç tarafından izledi. </li><li> İlaç sensitizasyon çalışmaları için, söz konusu özel bir ilaç uygun ilaç tedavisinin süresi, zamanlama ve konsantrasyon değiştirin. Not: Sisplatin için aşağıdaki adımları A549 hücreleri ile deneysel olarak tespit edildi ve hücre serisine bağlı olarak değişiklik gösterebilir. 4 ul / dakika, varsayılan akış oranı ile tüm aşamaları gerçekleştirir. Büyüme ortamı +% 0.2 FBS ve 1 x S / S, 6 saat Orta 6 mcM sisplatin 24 saat + 0.2% FBS 1x P / S Büyüme ortamı +% 0.2 FBS ve 1 x S / S, 24 saat Büyüme ortamı +% 0.2 FBS ve 1 x S / S 18 saat % 0.1 Triton-X 4 saat NOT: Bu adımları sapmalar istenilen debi ve deney süresine göre orta ve uyuşturucu çözümleri gerekli hacmi belirlemek için hesaplama gerektirir. Aşağıdaki bölümlerde, yukarıda tarif edilen adımlar dayanmaktadır. </li></ol></li><li> Etiket ve büyüme ortamı +% 0.2 FBS An 50 ml ondört 50 ml tüpler dolgud 1x P / S. Bir metabolizma ölçüm sistemi tüplü bir raf içerisindeki altı, başka altı ve ayrıca cisplatin ile tüpler içeren üçüncü bir tüplü bir raf içerisindeki kalan iki yerleştirin. Buharlaşmayı önlemek için hava geçirgen bir zar ile, ilk iki raf kapatın. </li><li> 1x P / S ortamı +% 0.2 FBS içinde (uygun hacim) 6 uM sisplatin içeren bir çözelti hazırlayın. Dört etiketli 50 ml tüpler içinde sisplatin çözeltisi gerekli hacmi koyun. <ol><li> Üçüncü metabolizma ölçüm tüpü rafta kalan dört yuvalarına tüpleri yerleştirin. Tüpler istenen biomodules karşılık uygun yuvalara yerleştirilir emin olun. Hava geçirgen bir zar ile tüpleri Seal. </li></ol></li><li> Hazırlama altı 50 ml tüpler etiket ve 20 ml ortam içinde% 0.1 Triton-X-çözeltisi ile doldurun. Triton-X çözümü kalan hücrelerin lize ve her çip için bir &#39;sıfır&#39; değer sağlayacaktır. Dördüncü metabolizma ölçüm birimi tüp rafa tüpleri yerleştirin ve zekâ mühürh aşırı buharlaşmasının engellenmesi için bir hava permable zar. </li><li> Biomodules içine cips yükleyin ve deney başlatmak. </li></ol> 4. CAM Deney İlaç Tedavisi ve Enjeksiyon NOT: Bir CAM deney için tavuk embriyo hazırlamak için adımlar ve prosedür başka 19 tarif edilmiştir <ol><li> CAM deneyi 48 saat sonrası transfeksiyon (Gün 2) işleme başlayın. İki araç için matara ve sisplatin ikiye &#39;kontrol&#39; ve grupların &#39;ilgi hedef&#39; Alt-bölün. Şişelerinden orta aspire ve 3 ml taze ortam veya 6 uM sisplatin ya doldurun. 6 saat (37 ᵒC,% 5 CO2) inkübe edin. </li><li> Yıkama, daha sonra orta aspire ve hücreleri trypsinize; Dört uygun şekilde etiketlenmiş 15 ml tüpler içinde çözelti içinde tripsinize hücreleri toplamak. <ol><li> Santrifüj ve PBS ile hücreler üç kez yıkayın. PBS, bir 5 ml hücre pelletini yeniden askıyahücreleri saymak d. </li><li> Nihai hücre konsantrasyonu 1.0x10 6 hücre / ml olacak şekilde ses seviyesini ayarlayın. Enjeksiyon için etiketli 5 ml tüpler içinde hücre çözeltisini, ve buz üzerine yerleştirin. Hücreler de karışık olmasını sağlamak için enjeksiyon yavaşça önce tüpleri ters çevirin. </li></ol></li><li> Enjeksiyon için (9 gün) 24 tavuk embriyo (grup başına 6) toplam koyun. 1 ml şırınga bağlanan esnek bir tüpe bağlı bir cam iğne kullanılarak enjeksiyon yapın. enjeksiyon yapılan bireysel tedavi grubu için kör olmaları gerekmektedir. <ol><li> Stereo mikroskop kullanılarak, CAM venöz dolaşıma 1.0x10 100 ul bir hacim içinde 5 hücre enjekte edilir. Hücrelerin tam hacmini enjekte etmek için yavaş, titreşimli tekniği kullanın. Yumuşak kan akışını kök ve herhangi bir sızıntıyı absorbe silin ile yavaşça enjeksiyon sitesini hafifçe sürün. Uygun her enjeksiyonu takiben her embriyo kabı etiketleyin. </li></ol></li><li> Varlığı ve distri OnayCAM damar flöresanlı hücre Katkı floresan mikroskop kullanarak görüntülenmesi ile enjeksiyonu takiben. Tümör hücrelerinin sayısı düşük görünüyor veya dağıtım zayıf olduğu herhangi embriyoların not alın. </li><li> Bir nemlilik bölmesi içinde tavuk embriyo yerleştirilir ve bir kuluçka makinesine (37 ° C,% 60 nem) muhafaza edin. Metastatik odaklar numaralandırma önce 7-9 gün bekleyin. </li></ol> 5. Metastatik Odak Sayım <ol><li> 7-9 günlük kuluçka döneminde, embriyoların izlemek ve herhangi bir ölü olanları atın. Nem odası kuluçka döneminde her zaman nemli kalmasını sağlayın. </li><li> 20X büyütmede bir floresan stereo mikroskop kullanarak, düzenli, ızgara gibi desen embriyo CAM tüm üst yüzeyini tarayın. </li><li> Sonra embriyo başına bir nihai toplam sayısını taksitli, görüş her alanda metastatik odaklarının sayısını. Her grupta altı embriyolar için bunu yaparken ortalama bir sayı o sağlayacakTedavi başına f metastatik odaklar. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Nedeniyle klinik deneylerle ilgili doğal maliyet ve risk, daha iyi ve uygun yeni anti-kanser tedavi rejimleri değerlendirmek için klinik öncesi test yöntemine daha sıkı geliştirmek için bir ihtiyaç vardır. Güncel sık kullanılan teknikler daha az etkili olabilir tüm sergi potansiyel umut verici tedavi hedefleri / ajanlar arasında ayrım kapasitelerini sınırlandırabilir zayıflıklar, ve bu. Biz geleneksel yöntemlerin eksiklikleri birçok adresleri yeni anti-kanser yaklaşımları değerlendirmek için...

Sitotoksik kanser tedavisi tedavisi başarısızlığı, nüks yol açabilir önemli bir klinik sorundur hedeflenen ve / veya karşı direnç kazanmış ve hasta mortalite 1 arttı. En tümörlerde farklılığının yüksek düzeyi dikkate alındığında, yeterince yüksek hücre sayısının bir tümör bu hücrelerin hayatta kalma 2,3 için bağlı olduğu moleküler yolları hedef tek veya kombine tedavilere dirençli hücrelerin bir alt kümesini içerecek bir matematiksel kesinlik. Bu tümör hücreleri pozitif olarak hastalığın tekrarlama yol, tedavi sırasında için seçilebilir. Aynı anda önce veya tedavi aracılı seçimden sonra ya farklı kanser hücresi hayatta kalma mekanizmalarını hedef yeni tedavilerin geliştirilmesi, böylece klinik açıdan önemlidir. Tümör genomları genom istikrarsızlık ve mutasyon yüksek düzeyde olmayan tümör konakçı hücrelerden 4 kanser hücrelerini ayıran temel özelliktir. Sonuç olarak, bir usefuDNA hasar, kemoterapinin etkisini arttırmak ve direnç gelişmesini önlemek için l stratejisi aktif tümör hücreleri 5 DNA onarımını inhibe edilmesidir. Bu, bir ön-klinik ortamda araştırılmaktadır soruşturma ve yeni DNA tamir hedeflerin çeşitli aktif bir alandır. Küçük molekül ya da bu hedeflerin antisens bazlı inhibitörlerin bazıları geliştirildi ve 6-8 test geçmektedir. objektif klinik çalışmalarda kendi güvenliğini ve etkinliğini en umut verici klinik öncesi adayları belirlemek ve değerlendirmektir. Klinik çalışmalarda yüksek maliyeti ve (sub-optimal klinik öncesi değerlendirme de dahil olmak üzere çeşitli nedenlerle için) başarısızlık riski, yeni tedavilerin 9 gelişiminde ilerleme zorlu engeller vardır. yeterince tedavi hedefleri ve aday ilaçlar yeni değerlendirmek için uygun ve klinik öncesi titiz modellerin kullanımı klinik çalışmalarda 10 yüksek başarısızlık oranı düşebilir </sus&gt;. In vitro (hücre çoğalma tahlilleri), tümör hücrelerinin kapasitesi için, b) terapiyle-uyarılmış azalma, tümör hücre proliferasyonunu azaltmak için kapasite) ölçüm Bazı yaygın olarak kullanılan, klinik öncesi yöntem yeni anti-kanser rejimleri etkinliğini değerlendirmek üzere bir şekilde doku kültürü koloniler (koloni oluşum analizleri), in vitro (redoks-boya dönüşüm), in vitro tümör hücre ölümü, d) terapiyle-uyarılmış indüksiyonu (apoptoz, nekrotik, otofajik ilişkili olarak tümör hücresi, metabolik etkinlikteki c) terapiyle-uyarılmış indirgeme in vivo olarak, mitoz ve diğerleri) 11 ve e) insan ve fare ksenograftları 12-14 büyümesi ya da ablasyon azalma tedavisi kaynaklı. Listelenen in vitro yöntemlerin önemli bir zayıflığı bunların hiçbiri aday tedavilerinin etkisi sürekli gerçek zamanlı değerlendirme sağlamak olduğunu. Daha ziyade, sadece seçilen, yaygın olarak ayrılmış zaman noktalarında bilgiTedavi sırasında. Bu ölçümler, kesin olarak, tümör hücre yanıtlarının büyüklüğünü ve zamanlamasını yansıtma kapasitesinin azalmıştır. İn vivo fare ksenograft modelleri aynı zamanda yüksek maliyet tamamlamak için zaman süresi ve alt-optimal dozaj ve tedavi zamanlaması (zamanlama) riski ile sınırlıdır. Buna ek olarak, kemirgen ksenograft modelleri primer insan tümör hücrelerinin yanıtların in vitro olarak değerlendirilmesi ile karşılaştırıldığında insanlarda klinik etkinliği sınırlı belirleyicileri ve aday terapötik müdahalelerin 15,16 belirlenen insan tümör hücre hatları olduğuna dair kanıtlar vardır. Biz yukarıda listelenen daha yaygın prosedürlerin zayıf yönlerini ele alan bir şekilde, ön-klinik yeni ilaç kombinasyonları değerlendirmek için yeni bir kombinasyon protokolü tasarladı. Çoğalma, koloni oluşumu, veya redoks-boya dönüştürme deneylerinde yerine, gerçek zamanlı olarak, hücre yapışmasını, solunum ve asitleştirmeyi analiz etmek için bir metabolizma ölçüm birimini kullanılanTüm tedavi dönemi boyunca 17. Aynı zamanda, bir tavuk embriyo istilası ve metastaz 18,19 koriyoallantoik membran (CAM) modeli kullanılarak in vivo tedavi kombinasyonunun etkileri araştırıldı. Bu yaygın olarak kullanılan kemoterapötik ilaç sisplatin etkinliğini güçlendirmek için BRCA2 hedefleyen bir antisens oligonükleotid (ASO) yeteneğinin değerlendirilmesi için bu yöntemleri kullanılır.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Nedeniyle heterojenite ve aynı yolu hedef insan kanserlerinin, tek ajan tedavileri, ya da kombinasyon rejimlerinde doğasında mutasyonların yüksek düzeyde, başarısız olma ihtimali vardır. Terapi için, doğuştan ve / veya edinilmiş direnç için sorumlu olan yollarının engellenmesi üzerine yerleştirilmelidir. Soruşturmanın aktif saha geliştirme ve yaygın olarak kemoterapi ve radyoterapi kullanılan, eylem teşvik ve direnç önlemek DNA onarım inhibitörlerinin test ediyor. Biz DNA hasar ilaç sisplatin tümör hücrelerini duyarlı bir araç olarak BRCA2 inhibisyonu etkinliğini değerlendirmek için yeni bir protokol kullanılır. Tümör hücrelerinin metabolizma (asitlenme ve solunum) dakika bazında bir dakika tedavi etkinliğini tanımlamak için 72 saat süreyle gerçek zamanlı olarak izlendi. Birlikte, bir tavuk embriyo koryoallantoik membran (CAM) ekstravazasyon ve işgali modeli kullanılarak metastatik frekansta bir değerlendirme yapılır. BuProtokol yeni kanser tedavi rejimleri değerlendirilmesi için in vitro ve in vivo yöntemlerinde kullanılan yaygın bir zayıf bazı problemlere yanıt vermektedir. Bu tür hücre çoğalma tahlilleri, hücre ölümü deneyleri gibi ortak yöntemlere ek olarak kullanılabilir ve in vivo murin ksenograft çalışmaları, daha yakından Aday hedeflerin ve maddeler arasında ayırım yapmak ve daha da geliştirilmesi için, sadece en ümit verici adaylar seçmek için kullanılır.

Sonuçlar ve rakamlar yayınlanan iş 22 izni ile uyarlanmıştır. BRCA2 inhibisyonu karşılık cisplatin ile tedavi, tümör hücrelerinde solunum azalması yaratmaktadır ASO BRCA2 hedefleme ve sisplatin, tek başına kontrol ASO ve sisplatin hücreleri ile karşılaştırıldığında, solunum erken ve geri dönüşü olmayan bir düşüş sergiledi ile muamele edilmiş insan A549 akciğer kanseri hücreleri; işlenen hücrelerde sisplati...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Kanser İlaç Duyarlılık Etkinliğinin Değerlendirilmesi<em&gt; İn Vitro</em&gt; Ve<em&gt; İn Vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K Görüntüleme.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Bir In Vitro</emMetastatik Büyüme Tümör Dormansi ve Switch Eğitim> Sistem

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Tıp

Multi-modal Imaging of Angiogenesis in a Nude Rat Model of Breast Cancer Bone Metastasis Using Magnetic Resonance Imaging, Volumetric Computed Tomography and Ultrasound

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell proliferation in the bone marrow cavity as well as for interaction of tumor and bone cells resulting in local bone destruction. Our aim was to develop a model of experimental bone metastasis that allows in vivo assessment of angiogenesis in skeletal lesions using non-invasive imaging techniques.
For this purpose, we injected 105 MDA-MB-231 human breast cancer cells into the superficial epigastric artery, which precludes the growth of metastases in body areas other than the respective hind leg1. Following 25-30 days after tumor cell inoculation, site-specific bone metastases develop, restricted to the distal femur, proximal tibia and proximal fibula1. Morphological and functional aspects of angiogenesis can be investigated longitudinally in bone metastases using magnetic resonance imaging (MRI), volumetric computed tomography (VCT) and ultrasound (US).
MRI displays morphologic information on the soft tissue part of bone metastases that is initially confined to the bone marrow cavity and subsequently exceeds cortical bone while progressing. Using dynamic contrast-enhanced MRI (DCE-MRI) functional data including regional blood volume, perfusion and vessel permeability can be obtained and quantified2-4. Bone destruction is captured in high resolution using morphological VCT imaging. Complementary to MRI findings, osteolytic lesions can be located adjacent to sites of intramedullary tumor growth. After contrast agent application, VCT angiography reveals the macrovessel architecture in bone metastases in high resolution, and DCE-VCT enables insight in the microcirculation of these lesions5,6. US is applicable to assess morphological and functional features from skeletal lesions due to local osteolysis of cortical bone. Using B-mode and Doppler techniques, structure and perfusion of the soft tissue metastases can be evaluated, respectively. DCE-US allows for real-time imaging of vascularization in bone metastases after injection of microbubbles7.
In conclusion, in a model of site-specific breast cancer bone metastases multi-modal imaging techniques including MRI, VCT and US offer complementary information on morphology and functional parameters of angiogenesis in these skeletal lesions.

In the pathogenesis of bone metastasis, angiogenesis is a crucial process and therefore represents a target for imaging and therapy. Here, we present a rat model of site-specific breast cancer bone metastasis and describe strategies to non-invasively image angiogenesis in vivo using magnetic resonance imaging, volumetric computed tomography and ultrasound.

Manyetik Rezonans Görüntüleme, Volumetrik Bilgisayarlı Tomografi ve Ultrason Kullanımı Meme Kanseri Kemik metastazı bir Nude Rat Model Angiogenezis Multi-modal Görüntüleme

Angiogenesis is an essential feature of cancer growth and metastasis formation. In bone metastasis, angiogenic factors are pivotal for tumor cell ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Meme Kanseri Fare Modelleri Tümör Mikroçevre İlaç Yanıtlarının Görüntüleme Canlı

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

Rat Retina için Elvax 40W ile yavaş salınımlı İlaç Dağıtım: Kronik Koşullar Tedavisinde Etkileri

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Farelerde Taksanlar Farmakokinetik ve Farmakodinamik Analiz Karotis Arter İnfüzyonlar

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

Vivo ve Ex Vivo Periton yağ içinde Samanyolu Nokta Yapıların Yumurtalık Kanseri Metastatik Kolonizasyon Eğitim Yaklaşımlar içinde

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

Pankreas Kanseri Yeni Tedavi Stratejileri Geliştirme Hücre Özellikleri Kök incelenmesi

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

İnsan Tümör ksenogratflarının gelen Fare Hücrelerinin tükenmesi Anlamlı Hedef Hücre Alt Analizi geliştirir

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin kaynaklı bağırsak Organoids şişme: Bir<em&gt; İn Vitro</em&gt; Deney Kistik Fibrozis Hastalarında İlaç Tepki değerlendirilmesi için

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Optimize Analizi<em&gt; İn Vivo</em&gt; ve<em&gt; İn Vitro</em&gt; Karaciğer Steatoz

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Kanser İlaç Duyarlılık Etkinliğinin Değerlendirilmesi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Bir In Vitro Sistem