Bu eser Kore hükümeti (MSIP) (NMK-2014K1A4A7A01074642) ve Ulusal Araştırma Vakfı, Kore (NMG) bireysel bilim adamı destek programı (NMK-2013M3A9B5076486/NMG-2015R1D1A1A09057239) tarafından finanse edilen bir hibe tarafından desteklenmiştir.

1. lentivirus üretim Not: üretim ve işleme lentiviral vektörlerin gerçekleştirildiği rekombinant içeren araştırma için Ulusal Enstitüsü Sağlık (NIH) esaslarına göre DNA'SI. Gelişmiş YFP (SOD1WT-YFP ve SOD1A4V-YFP) ile A4V mutant SOD1 ve vahşi-türü öğesini plazmid kodlama Kim ark içinde açıklanmıştır. 11 PCR astar çifti 5 kullanarak her iki gen füzyon ürün güçlendirilmiş &#8242; - ATCGTCTAGACACCATGGCGACGAAGGTCGTGTGC - 3 &#8242; ve 5 &#8242;-TAGCGG CCGCTACTTGTACAGCTCGTCCATGCC-3 &#8242; ve pTRIP-delta U3 CMV eklenmiş Plazmid 19 XhoI ve BsrGI kısıtlama siteleri kullanarak. Önceki deneyler, iki günde 1:4 1:6 oranında HEK-293T hücreleri ayrılmış. 20'den fazla geçit ve bakım hücre iyi transfection verimliliği sağlamak için daha az % 60 confluency yardımcı olur, kaçınma.
<ol><li>Gün hücre kültür orta (%10 FBS ve 4 mM L-glutamin ile yüksek glikoz DMEM) virüs üretim için 10 ml % 30-40 izdiham bir 10 cm çapında doku kültürü plaka (3 x 10 6 hücreler/çanak), HEK-293T hücreleri bölme 1 tarihinde,.</li>
	<li>10 cm çapında doku kültürü plaka (37 ° C, % 5 CO 2) bir CO 2 kuluçka makinesine gecede devam.</li>
	<li>On gün 2, 10 µg lentiviral vektörlerin içeren bir DNA transfection çözüm hazırlamak (pTRIP-delta U3 CMV - SOD1WT-YFP ya da - SOD1A4V-YFP) lentiviral ile birlikte ambalaj plazmid (5 µg pVSVg; pCMV-dR8.71 10 µg) () şekil 2A) 20. 1 M CaCl 2 125 µL ekleyebilir ve 500 µL distile su kullanarak birime ayarlayabilirsiniz. Yavaşça 0,05 M HEPES 500 µL karışımı ekleyin ve oda sıcaklığında 10 dakika için kuluçkaya.</li>
	<li>Değiştir HEK-293T 1 mL DNA transfection solüsyon ile karışık orta 10 mL Önceden ısıtılmış taze kültür orta ile antibiyotik içermeyen hücreleri ve gecede 37 ° C, % 5 CO 2 kuluçkaya.</li>
	<li>3 günde, hücrenin süpernatant ile taze kültür orta yerine.</li>
	<li>Gün 4, üzerinde 15 mL tüp ve ölü hücreleri ve enkaz kaldırmak için 500 x g de 5 dk santrifüj süpernatant hasat. Daha fazla süpernatant büyük 60 mL şırınga kullanarak 0,45 µm filtreden geçirerek arındırmak. Hemen tek kullanımlık aliquots (300 µL) dağıtmak ve-80 ° C'de depolayın En fazla ürün etkinliğini korumak için donma-çözülme döngüsü önlemek.</li>
</ol> 2. Lentiviral iletim <ol><li>bölünmüş % 60 izdiham bulaşması için hücre kültürünü (HEK-293 hücreleri ve SH-SY5Y; de başına 5 x 10 5 hücre ve U2OS; iyi başına 1 x 10 5 hücre) 6-iyi doku kültürü plaka DMEM medya ile takıma 2 ml % 10 FBS.</li>
	<li>6-iyi doku kültürü plaka 37 ° C kuluçka makinesine %5 CO 2 adlı gecede devam.</li>
	<li>Donmuş lentivirus-80 ° C dondurucudan kaldır ve bir aliquot her kullanımdan önce buz çözme; değil refreeze.</li>
	Virüs çözdürme iken, <li>sıcak ilgi hücre satırı ile uyumlu serum içeren hücre kültür orta. Bir kez virüs tamamen çözdürülen, dilutions bir dizi hazırlamak (1:3, 1:10, 1:30 ve 1: 100) içinde bir taze 1.5 mL microfuge tüp DMEM.</li>
	<li>Düşük serum medya ile 1 ml tüpler hacmindeki getirmek.</li>
	<li>Polybrene (adlı bir hazır 4 µg/µL) eklemek 2 µL virüs/medya 1 ml. De pipetting tarafından mix ve hücrelere 1 mL karışımı ekleyin. Virüs 24 h için hücrelerle kuluçkaya</li>
	<li>Virüs medyayı çıkarın ve normal DMEM medya % 10 ile desteklenmiş yerine FBS. 37 ° c, % 5 CO 2 hücreleri korumak.</li>
	<li>Hücrelerinin büyümesini izlemek ve her iki günde kültür ortamı değiştirin. İzdiham 6-iyi çanak 10 cm çapında doku kültürü plaka genişletin.</li>
	Hücreleri yeterince genişletilmiş oldu bir kez <li>, 50 µL DMEM medya 384-iyi tahlil plakaları YFP ifade düzeyini denetlemek için bir kuyu başına tohum 1.5 x 10 4 hücre protein mikroskobu ile etiketledi. YFP etiketli protein hücre ifade bir sinyal-gürültü oranı gösterir &#8805; 3, hücre hisse senedi karşılık gelen hücre satırı için hazır olun.</li>
</ol> 3. Zaman bağımlı proteasome önleyici etkisi protein toplama Not: otomatik bir mikroskop kullanarak resim alma gerçekleştirmek (malzemeleri görmek).
<ol><li>% 100 DMSO (ALLN, 2 mM) 384-şey düz dipli Tabaklarda çözünmüş DMSO veya proteasome inhibitörü 0,25 µL dağıtmak.</li>
	<li>El ile DMEM 50 µL kuyuda başına tohum 1.5 x 10 4 hücre medya aynı plaka tahlil. Proteasome inhibitörü (ALLN) son konsantrasyonu 10 µM olmalıdır.</li>
	<li>37 ° C ve % 5 CO 2 mikroskop sistem çevre kontrol birimine ayarlayın. Deneysel kurulumunun bir ekran görüntüsü şekil 3 ' te gösterilen.</li>
	<li>Mikroskop yazılımı aşağıdaki ayarlarla kullanarak geniş alan Floresans modunda çalışır: LWD 20 X amaç, confocal modu, 4 alanları/iyi, bir saat yakalama aralığı ile. Her çalışma sonunda, çektiğiniz resimleri otomatik olarak sunucuya karşıya.</li>
</ol> 4. Canlı hücreler YFP ifade için atlamalı görüntüleme süresi ve görüntü analizi (tek kanal) Not: Aşağıdaki adımlarda, belgili tanımlık bilgisayar yazılımı (örneğin, Columbus) uygulanması açıklanmaktadır.
<ol><li>Seçin uygun algoritması (sitozol ve toplamları) birincil nesneleri segmentlere ayırmak için. Gerekirse, arka plan eşik ve kontrast parametreleri ( şekil 4) ayarlamak.</li>
	<li>Hücreleri hesaplama kullanarak &#39; hücreleri bulma &#39; 0.1 YFP yoğunluk kanal için bireysel bir eşik değeri ile. Kullanarak toplamları belirlemek bir &#39; noktalar bulmak &#39; algoritması bir göreli YFP nokta yoğunluğu ile &#62; 0.2 ve 1.0 yarma katsayısı.</li>
</ol> 5. Doz yanıt etkisi proteasome inhibitörleri protein toplama onların çekirdek (iki kanal) lekeli canlı hücreler üzerinde Not: otomatik bir mikroskop kullanarak resim alma gerçekleştirmek. Proteasome inhibitörleri (ALLN, Epoxomicin ve MG132) bir optimum eğri uyum sağlamak için beklenen ŞA 50 değeri üzerinde dayalı konsantrasyon aralığı belirlemek.
<ol><li>Hazırla seri dilutions 384-iyi depolama polipropilen bileşikler standart tarafından 1:3 seyreltme serisi plaka. Bileşik dilutions mix emin olun de bileşik konsantrasyonları doğru olduğundan emin olmak için.</li>
	<li>Proteasome inhibitörleri boş düz-alt siyah 384-iyi tahlil plakalar üzerinde 0,25 µL dağıtmak. Biz bir 384-kılcal kafa birimleri aktarma yeteneğine sahip ile donatılmış bir sıvı işleyicisi kullanmak.</li>
	<li>Tohum 1.5 x 50 bir kuyu başına 10 4 hücre µL tahlil plakaları DMEM medya. 37 ° C ve % 5 CO 2 24 h için tahlil plakaları kuluçkaya</li>
	<li>DMEM (37 ° C'de önceden ısındı) medya çözüm (Höchst 33342 adlı bir hisse senedi olarak 10 mg/mL) boyama ile 10 µL ekleyin ve 10 dakika süreyle oda sıcaklığında kuluçkaya</li>
	Mikro <li>başlatmakyazılımı çalışan baş. Deneysel kurulumunun bir ekran görüntüsü şekil 6 ' da gösterilmiştir. Seçin &#34; yapılandırma &#34; tab ve 20 X amaç ve doğru plaka türü seçin. Emin olmak &#34; yaka &#34; uygun odak farklı plaka türleriyle izin amaç üzerinde doğru değere ayarlanır.</li>
	<li>Select &#34; mikroskop &#34; sekmesini tanımla pozlama 1 olarak YFP (488 lazer) ve pozlama 2 Höchst olarak (405 laser). Her iki pozlama üzerinde filtre etkinleştirin ve pozlama 1 kamera 1 ve kamera 2 2 maruz atayabilirsiniz. ~ 800 ms pozlama 1 için pozlama süreleri ayarlıysa ve ~ 40 ms maruz kalma 2.</li>
	<li>Select pozlama 1. Ayarlayın odak yüksekliği 0 µm. için Select &#34; odak &#34;. Bir kez odaklı, kamera 1 ortaya çıkarmak. Pozlama uçak optimize etmek ve tıkırtı üstünde odak yüksekliğini ayarla &#34; almak yükseklik &#34;. ~ 3.000 en büyük piksel yoğunluğu vermek güç lazer ve pozlama zaman değişiyor. Pozlama parametreleri kaydedin. Tekrar maruz kalma 2.</li>
	<li>Select &#34; deney tanımı &#34; sekmesini oluşturmak bir düzen ve sublayout. Sürükle ve bırak ilgili düzen, pozlama, başvuru yansıması, skewcrop dosya ve sublayout. Deneme kaydedin.</li>
	<li>Select &#34; otomatik deney &#34; tab ve görüntüleri. Her çalışma sonunda, çektiğiniz resimleri otomatik olarak sunucuya karşıya.</li>
</ol> 6. Görüntü iki kanal görüntü analizi <ol><li>(nükleuslar, sitozol ve toplamları) birincil nesneleri segmentlere ayırmak için bilgisayar yazılımı algoritma seçin ( Şekil 7).</li>
	<li>Çekirdeği doğru bir şekilde bölümlenmiş nesneleri görsel denetim tarafından kesim yöntemi seçin. Höchst lekeli nesneleri Kanal 1 (Ch1) hücreleri belirlemek için kullanılır. YFP SOD1-A4V Kanal 2 (Ch2) toplam miktarını belirlemek için kullanılan mutant boyama.</li>
	<li>Kullanarak hücreleri hesaplama &#39; çekirdeği bulmak &#39; algoritması bölgeleri Höchst boyama olarak &#62; 20 µm 2, 7.0, bireysel bir eşik değeri 0.40 ve bir kontrast split faktörle &#62; 0.10.</li>
	<li>Veri tablosu oluşturma ve EC 50 her kullanarak bileşikler için belirlemek &#39; Non-linear regresyon &#39; grafik yazılım denklemde.</li>
</ol>

<ol>
	<li>Schulte, J., Sepp, K. J., Wu, C., Hong, P., Littleton, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+chemical+and+rnai+screens+for+suppressors+of+neurotoxicity+in+a+huntington's+disease+model.">High-content chemical and rnai screens for suppressors of neurotoxicity in a huntington's disease model.</a> PLoS ONE. 6 (8), e23841 (2011).</li><li>Honarnejad, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+implementation+of+a+high-throughput+compound+screening+assay+for+targeting+disrupted+ER+calcium+homeostasis+in+Alzheimer's+disease.">Development and implementation of a high-throughput compound screening assay for targeting disrupted ER calcium homeostasis in Alzheimer's disease.</a> PLoS ONE. 8 (11), 1-12 (2013).</li><li>Burkhardt, M. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cellular+model+for+sporadic+ALS+using+patient-derived+induced+pluripotent+stem+cells.">A cellular model for sporadic ALS using patient-derived induced pluripotent stem cells.</a> Mol Cell Neurosci. 56, 355-364 (2013).</li><li>Mattiazzi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Content+Screening+for+Quantitative+Cell+Biology.">High-Content Screening for Quantitative Cell Biology.</a> Trends Cell Biol. 26 (8), 598-611 (2016).</li><li>Kato, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amyotrophic+lateral+sclerosis+models+and+human+neuropathology:+Similarities+and+differences.">Amyotrophic lateral sclerosis models and human neuropathology: Similarities and differences.</a> Acta Neuropathologica. 115 (1), 97-114 (2008).</li><li>Strong, M. J., Kesavapany, S., Pant, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pathobiology+of+amyotrophic+lateral+sclerosis:+a+proteinopathy?.">The pathobiology of amyotrophic lateral sclerosis: a proteinopathy?.</a> J neuropathol exp neurol. 64 (8), 649-664 (2005).</li><li>Cleveland, D. W., Rothstein, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+Charcot+to+Lou+Gehrig:+deciphering+selective+motor+neuron+death+in+ALS.">From Charcot to Lou Gehrig: deciphering selective motor neuron death in ALS.</a> Nat rev Neurosci. 2 (11), 806-819 (2001).</li><li>Bruijn, L. I., Miller, T. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+Mechanisms+Involved+in+Motor+Neuron+Degeneration+in+Als.">Unraveling the Mechanisms Involved in Motor Neuron Degeneration in Als.</a> Annu Rev Neurosci. 27 (1), 723-749 (2004).</li><li>Vassall, K. a., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+stability+and+increased+formation+of+soluble+aggregates+by+immature+superoxide+dismutase+do+not+account+for+disease+severity+in+ALS.">Decreased stability and increased formation of soluble aggregates by immature superoxide dismutase do not account for disease severity in ALS.</a> Proc Natl Acad Sci USA. 108 (6), 2210-2215 (2011).</li><li>Hwang, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonamyloid+aggregates+arising+from+mature+copper/zinc+superoxide+dismutases+resemble+those+observed+in+amyotrophic+lateral+sclerosis.">Nonamyloid aggregates arising from mature copper/zinc superoxide dismutases resemble those observed in amyotrophic lateral sclerosis.</a> J Biol Chem. 285 (53), 41701-41711 (2010).</li><li>Kim, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimerization,+Oligomerization,+and+Aggregation+of+Human+Amyotrophic+Lateral+Sclerosis+Copper/Zinc+Superoxide+Dismutase+1+Protein+Mutant+Forms+in+Live+Cells.">Dimerization, Oligomerization, and Aggregation of Human Amyotrophic Lateral Sclerosis Copper/Zinc Superoxide Dismutase 1 Protein Mutant Forms in Live Cells.</a> J Biol Chem. 289 (21), 15094-15103 (2014).</li><li>Shaw, B. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detergent-insoluble+aggregates+associated+with+amyotrophic+lateral+sclerosis+in+transgenic+mice+contain+primarily+full-length,+unmodified+superoxide+dismutase-1.">Detergent-insoluble aggregates associated with amyotrophic lateral sclerosis in transgenic mice contain primarily full-length, unmodified superoxide dismutase-1.</a> J Biol Chem. 283 (13), 8340-8350 (2008).</li><li>Banci, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SOD1+and+amyotrophic+lateral+sclerosis:+Mutations+and+oligomerization.">SOD1 and amyotrophic lateral sclerosis: Mutations and oligomerization.</a> PLoS ONE. 3 (2), 1-8 (2008).</li><li>Johnston, J. a., Dalton, M. J., Gurney, M. E., Kopito, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+high+molecular+weight+complexes+of+mutant+Cu,+Zn-superoxide+dismutase+in+a+mouse+model+for+familial+amyotrophic+lateral+sclerosis.">Formation of high molecular weight complexes of mutant Cu, Zn-superoxide dismutase in a mouse model for familial amyotrophic lateral sclerosis.</a> Proc Natl Acad Sci. 97 (23), 12571-12576 (2000).</li><li>Niwa, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disulfide+bond+mediates+aggregation,+toxicity,+and+ubiquitylation+of+familial+amyotrophic+lateral+sclerosis-linked+mutant+SOD1.">Disulfide bond mediates aggregation, toxicity, and ubiquitylation of familial amyotrophic lateral sclerosis-linked mutant SOD1.</a> J Biol Chem. 282 (38), 28087-28095 (2007).</li><li>Juneja, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prognosis+in+familial+amyotrophic+lateral+sclerosis:+progression+and+survival+in+patients+with+glu100gly+and+ala4val+mutations+in+Cu,Zn+superoxide+dismutase.">Prognosis in familial amyotrophic lateral sclerosis: progression and survival in patients with glu100gly and ala4val mutations in Cu,Zn superoxide dismutase.</a> Neurology. 48 (1), 55-57 (1997).</li><li>Kaur, S. J., McKeown, S. R., Rashid, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+SOD1+mediated+pathogenesis+of+Amyotrophic+Lateral+Sclerosis.">Mutant SOD1 mediated pathogenesis of Amyotrophic Lateral Sclerosis.</a> Gene. 577 (2), 109-118 (2016).</li><li>de Bruyns, A., Geiling, B., Dankort, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Modular+Lentiviral+Vectors+for+Effective+Gene+Expression+and+Knockdown.">Construction of Modular Lentiviral Vectors for Effective Gene Expression and Knockdown.</a> Methods Mol Biol. 1448, 3-21 (2016).</li><li>Sirven, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+Transgene+Expression+in+Cord+Blood+CD34+-Derived+Hematopoietic+Cells,+Including+Developing+T+Cells+and+NOD/SCID+Mouse+Repopulating+Cells,+Following+Transduction+with+Modified+TRIP+Lentiviral+Vectors.">Enhanced Transgene Expression in Cord Blood CD34+-Derived Hematopoietic Cells, Including Developing T Cells and NOD/SCID Mouse Repopulating Cells, Following Transduction with Modified TRIP Lentiviral Vectors.</a> Mol Ther. 3 (4), 438-448 (2001).</li><li>Wu, C., Lu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-titre+retroviral+vector+system+for+efficient+gene+delivery+into+human+and+mouse+cells+of+haematopoietic+and+lymphocytic+lineages.">High-titre retroviral vector system for efficient gene delivery into human and mouse cells of haematopoietic and lymphocytic lineages.</a> J gen virol. 91 (Pt 8), 1909-1918 (2010).</li><li>Irshad, H., Veillard, A., Roux, L., Racoceanu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+nuclei+detection,+segmentation,+and+classification+in+digital+histopathology:+A+review-current+status+and+future+potential.">Methods for nuclei detection, segmentation, and classification in digital histopathology: A review-current status and future potential.</a> IEEE Rev Biomed Eng. 7, 97-114 (2014).</li><li>Purschke, M., Rubio, N., Held, K. D., Redmond, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phototoxicity+of+Hoechst+33342+in+time-lapse+fluorescence+microscopy.">Phototoxicity of Hoechst 33342 in time-lapse fluorescence microscopy.</a> Photochem Photobiol Sci. 9 (12), 1634-1639 (2010).</li><li>Jaskova, K., Pavlovicova, M., Jurkovicova, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calcium+transporters+and+their+role+in+the+development+of+neuronal+disease+and+neuronal+damage.">Calcium transporters and their role in the development of neuronal disease and neuronal damage.</a> Gen physiol biophys. 31 (4), 375-382 (2012).</li><li>Kieran, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+with+arimoclomol,+a+coinducer+of+heat+shock+proteins,+delays+disease+progression+in+ALS+mice.">Treatment with arimoclomol, a coinducer of heat shock proteins, delays disease progression in ALS mice.</a> Nat Med. 10 (4), 402-405 (2004).</li></ol>

Yazarlar ifşa gerek yok.

İstikrarlı hücre hatları oluşturmak için iki temel yaklaşım vardır. İlk birkaç hafta sürer ve genomik entegre plazmid DNA vektörel çizimler geçici transfection ve direnç işaretlenmesini gerektirir. İkinci birkaç saat kullanımı ile lentivirus, sınırlı bir çaba ile birden çok hücre hatlarında bu protokolü mükellef etkili ifade hedef protein yapma alır. GEZİ-CMV vektör19 , korunmuş iletim verimliliği ve istikrarlı transgene ifade ile kullanmak için sürekli bir ve...

Protein toplama biyolojik bir işlem tarafından hangi kadar proteinler grup misfolded ve nörodejeneratif hastalıklarda (Amiloidoz) etken ajanı olarak hareket edebilir olur. Protein toplama karakterize patoloji başlangıcı etkileyen yeni faktörler keşfi kolaylaştırılması olduğu gibi hücresel disfonksiyon de toplamları rolünün anlaşılması önemlidir. Floresans öğesini proteinler canlı hücreler arasında görselleştirme deneyleri (HCS)1,2,3,4eleme yüksek içeriğe uygun geliştirilmesine yardımcı olabilir güçlü bir yöntemdir.
Amyotrofik lateral skleroz (ALS) toplamak ve ailesel ALS (fALS) ve sporadik ALS (sALS)5,6 motor nöronlarda birikir eğilimi ile misfolded proteinlerin kaynaklanan bir proteopathic hastalık olarak kabul edilir . Bir alt fALS olguların % 20 ~ ilişkili baskın mutasyonlar gen sitozolik antioksidan enzim kodlama ile bakır-çinko süperoksit dismutaz yazın 1 (SOD1)7,8. Bu genetik olarak türetilmiş disfonksiyon için birkaç olası nedeni, yapısı ve SOD1 türevleri, anormal istikrar, artmış unfolding hızı ve toplam9eğilimi gibi fonksiyon değişiklikleri de dahil olmak üzere önerilmiştir, 10. Özellikle tek doğrulanmış ve potansiyel olarak toksik özelliği her iki SOD1 ALS bağlantılı türevleri tarafından paylaşılan ve vahşi-tipi (WT) SOD1 bölümlere protein toplamları veya proteinaceous kapanımlar11,12 oluşturmak için artan bir eğilimi olduğunu . Misfolded mutant SOD1, ısrarla polyubiquitinated olduğunu ve ubiquitin-proteasome sistemi tarafından bozulmuş. Proteasome aktivitesinin inhibisyonu düşük düzeyde SOD113,14hangi formu amorf çözünür mutant SOD1 ile alışverişi yapabilirsiniz çözünür bileşenler yapılarından, agrega mutant birikimi sonucu olarak, yol açar sitozol15' te. Özellikle, SOD1 mutant A4V içinde (alanin kodon 4, Valin için değişti) en yaygın ALS neden mutasyon ve hızlı ateş hastalığı başlangıcı16sonra daha az 2 yıllık bir ortalama yaşam süresi ile yol açar. Biyokimyasal olarak, SOD1 A4V monomerize, toplamak ve amiloid gözenekleri oluşturmak için artan bir eğilim vardır; onun gözenek benzeri toplamları diğer hastalık bağlı mutant gibi form α-synuclein ve β-amiloid protein17amiloid gözeneklerin benzer. SOD1-agrega birikim dinamiklerini incelemek için geliştirilecek çözünür ve çözünmez SOD1 toplama formları izlemek için yöntem kalır.
Biz daha önce canlı hücre Imaging'i kullanma göstermiştir ve HEK-293 hücreleri geçici ALS ilişkili mutasyonlar SOD1 dimerization ve toplama11zarar floresan protein etiketli SOD1 ile transfected. Her ne kadar geçici ifade sistemleri kısa vadeli gen overexpression biyolojik sonucu hakkında yararlı bilgiler sağlayabilir, istenen genlerin istikrarlı entegrasyon sağlayan yöntemleri tahlil geliştirme için tercih edilebilir. Bu nedenle, lentiviral vektörler uzun vadeli ve düzenlenmiş gen ekspresyonu memeli hücreleri 18tarihinde bir görüşme olanağı sunuyoruz. Bu çalışmada rekombinant lentivirus WT taşıyan transduced istikrarlı hücre hatları nesil üzerinde duruldu ve mutant SOD1 sarı floresan protein (YFP) ile Etiketlenmiş. Canlı hücre görüntüleme mikroskobu ve SOD1 toplama otomatik miktar kullanarak, biz tetiklenir ve SOD1 toplama olayları üzerine proteasome inhibisyonu sayılabilir.

<table>
	<tbody>
		<tr>
			<td>ALLN (C20H37N3O4)</td>
			<td>Millipore</td>
			<td>208719</td>
			<td></td>
		</tr>
		<tr>
			<td>MG132 (C26H41N3O5)</td>
			<td>Sigma-Aldrich</td>
			<td>C2211</td>
			<td></td>
		</tr>
		<tr>
			<td>Epoxomicin (C28H50N4O7)</td>
			<td>Sigma-Aldrich</td>
			<td>E3652</td>
			<td></td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Invitrogen</td>
			<td>H-3570</td>
			<td></td>
		</tr>
		<tr>
			<td>Opera</td>
			<td>Perkin Elmer</td>
			<td>OP-QEHS-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Opera EvoShell software</td>
			<td>Perkin Elmer</td>
			<td>Ver 1.8.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Operetta</td>
			<td>Perkin Elmer</td>
			<td>OPRT1288</td>
			<td></td>
		</tr>
		<tr>
			<td>Harmony Imaging software</td>
			<td>Perkin Elmer</td>
			<td>Ver 3.0.0</td>
			<td></td>
		</tr>
		<tr>
			<td>Columbus Image analysis software</td>
			<td>Perkin Elmer</td>
			<td>Ver 2.3.2</td>
			<td></td>
		</tr>
		<tr>
			<td>CyBi Hummingwell liquid handling</td>
			<td>CyBio AG</td>
			<td>OL 3387 3 0110</td>
			<td></td>
		</tr>
	</tbody>
</table>

assay development for high content quantification of sod1 mutant protein aggregate formation in living cells

Amyotrofik lateral skleroz (ALS) gen kodlama bakır-çinko süperoksit dismutaz 1 (SOD1) devralınan mutasyonlar neden ölümcül nörodejeneratif bir hastalıktır. SOD1 yapısal istikrarsızlık ve ailesel ALS hastalarında SOD1 pozitif kapanımlar tespiti ALS patoloji misfolded ve/veya toplanan SOD1 için potansiyel bir nedensel rolü destekler. Bu çalışmada, canlı hücreler toplamada SOD1 dinamikleri ölçmek için yaklaşımlar eleme yüksek içerik tarafından tasarlanmış bir hücre tabanlı tahlil gelişimini açıklar. Lentiviral vektörler kullanarak, biz vahşi tipi ve mutant A4V sarı floresan protein ile öğesini ve her iki proteinler sitozol toplama belirtisi olmadan ifade edildi bulundu SOD1 ifade istikrarlı hücre satırları oluşturulur. İlginçtir, sadece SOD1 A4V stabil HEK-293 ile ifade ancak U2OS veya SH-SY5Y hücre hatlarında proteasome inhibitörü tedavisi üzerine toplamları biçimi değil. Çeşitli proteasome inhibitörleri doz-yanıt analize göre toplama ölçmek ve toplama-oluşumu Kinetik tarafından hızlandırılmış mikroskobu izlemek mümkün olduğunu göstereceğiz. Yaklaşımımız ALS mutasyonlar rolünü SOD1 toplama oluşumunda etkisi miktarının yanı sıra SOD1 A4V toplama önlemek küçük moleküller için tarama olanağı sunar.

Lentivirus kullanarak oluşturma kararlı hücre kültürünü: SOD1 protein toplamları izleme için genel strateji şekil 1' de gösterilmiştir. Bir ilk adım olarak, biz bir lentiviral ifade vektör SOD1 istikrarlı gen teslim içine hücre hatları (Adım 1) için oluşturulan. İki lentiviral vektörler kodlama YFP öğesini SOD1 WT ve SOD1 A4V (SOD1WT-YFP ve SOD1A4V-YFP, sırasıyla) ambalaj ve zarf ile plazmid (ş...

Watch this Scientific Journal Video about Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells at JoVE.com

Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells

Biz toplama misfolded proteinlerin ölçmek için bir yöntem açıklanmaktadır. Bizim protocol detayları lentiviral istikrarlı hücre satırı üretimi, otomatik confocal görüntüleme ve görüntü analizi protein toplamları indüklenen. Açıklayıcı bir uygulama olarak SOD1 toplama bir saat ve doz bağımlı şekilde teşvik küçük moleküller etkisini okudu.

Yüksek içerik miktar Sod1 canlı hücreler Mutant Protein toplama oluşumu için tahlil geliştirme

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that can be caused by inherited mutations in the gene encoding copper-zinc ...

assay-development-for-high-content-quantification-sod1-mutant-protein

Research

JoVE Journal

Neuroscience

7.1K Görüntüleme.  Institut Pasteur Korea. Biz toplama misfolded proteinlerin ölçmek için bir yöntem açıklanmaktadır. Bizim protocol detayları lentiviral istikrarlı hücre satırı üretimi, otomatik confocal görüntüleme ve görüntü analizi protein toplamları indüklenen. Açıklayıcı bir uygulama olarak SOD1 toplama bir saat ve doz bağımlı şekilde teşvik küçük moleküller etkisini okudu.

Video: Assay Development for High Content Quantification of Sod1 Mutant Protein Aggregate Formation in Living Cells

Preparation of Living Isolated Vertebrate Photoreceptor Cells for Fluorescence Imaging

In the vertebrate retina, phototransduction, the conversion of light to an electrical signal, is carried out by the rod and cone photoreceptor cells1-4. Rod photoreceptors are responsible for vision in dim light, cones in bright light. Phototransduction takes place in the outer segment of the photoreceptor cell, a specialized compartment that contains a high concentration of visual pigment, the primary light detector. The visual pigment is composed of a chromophore, 11-cis retinal, attached to a protein, opsin. A photon absorbed by the visual pigment isomerizes the chromophore from 11-cis to all-trans. This photoisomerization brings about a conformational change in the visual pigment that 
initiates a cascade of reactions culminating in a change in membrane potential, and bringing about the transduction of the light stimulus to an electrical signal. The 
recovery of the cell from light stimulation involves the deactivation of the intermediates activated by light, and the reestablishment of the membrane potential. Ca2+ modulates the activity of several of the enzymes involved in phototransduction, and its concentration is reduced upon light stimulation. In this way, Ca2+ plays an important role in the recovery of the cell from light stimulation and its adaptation to background light.
Another essential part of the recovery process is the regeneration of the visual pigment that has been destroyed during light-detection by the 
photoisomerization of its 11-cis chromophore to all-trans5-7. This regeneration begins with the release of all-trans retinal by 
the photoactivated pigment, leaving behind the apo-protein opsin. The released all-trans retinal is rapidly reduced in a reaction utilizing NADPH to all-
trans retinol, and opsin combines with fresh 11-cis retinal brought into the outer segment to reform the visual pigment. All-trans retinol is 
then transferred out of the outer segment and into neighboring cells by the specialized carrier Interphotoreceptor Retinoid Binding Protein (IRBP).
Fluorescence imaging of single photoreceptor cells can be used to study their physiology and cell biology. Ca2+-sensitive fluorescent dyes can be used to examine in detail the interplay between outer 
segment Ca2+ changes and response to light8-12 as well as the role of inner segment Ca2+ stores in Ca2+ homeostasis13,14. 
Fluorescent dyes can also be used for measuring Mg2+ concentration15, pH, and as tracers of aqueous and membrane compartments16. 
Finally, the intrinsic fluorescence of all-trans retinol (vitamin A) can be used to monitor the kinetics of its formation and removal in single 
photoreceptor cells17-19.

A method is described for the preparation of single living photoreceptor cells from different vertebrate species for fluorescence imaging. The method can be used to image the fluorescence of endogenous fluorophores, such as NADH or vitamin A, or that of exogenously added fluorescent dyes sensitive to Ca2+ or other factors.

Floresans Görüntüleme Living İzole Omurgalı fotoreseptör hücrelerinin hazırlanması

In the vertebrate retina, phototransduction, the conversion of light to an electrical signal, is carried out by the rod and cone photoreceptor cells1-4.  ...

Nörobilim

A Quantitative Cell Migration Assay for Murine Enteric Neural Progenitors

Neural crest cells (NCC) are a transient and multipotent cell population that originates from the dorsal neural tube and migrates extensively throughout the developing vertebrate embryo. In addition to providing peripheral glia and neurons, NCC generate melanocytes as well as most of the cranio-facial skeleton. NCC migration and differentiation is controlled by a combination of their axial origin along the neural tube and their exposure to regionally distinct extracellular cues. Such contribution of extracellular ligands is especially evident during the formation of the enteric nervous system (ENS), a complex interconnected network of neural ganglia that locally controls (among other things) gut muscle movement and intestinal motility. Most of the ENS is derived from a small initial pool of NCC that undertake a long journey in order to colonize - in a rostral to caudal fashion - the entire length of the prospective gut. Among several signaling pathways known to influence enteric NCC colonization, GDNF/RET signaling is recognized as the most important. Indeed, spatiotemporally controlled secretion of the RET ligand GDNF by the gut mesenchyme is chiefly responsible for the attraction and guidance of RET-expressing enteric NCC to and within the embryonic gut. Here, we describe an ex vivo cell migration assay, making use of a transgenic mouse line possessing fluorescently labeled NCC, which allows precise quantification of enteric NCC migration potential in the presence of various growth factors, including GDNF.

We present an ex vivo cell migration assay that allows precise quantification of enteric neural crest cell migration potential in the presence of various growth factors.

Kemirgen Enterik Sinir progenitörlerin için Kantitatif Hücre Göç Tahlili

Neural crest cells (NCC) are a transient and multipotent cell population that originates from the dorsal neural tube and migrates extensively throughout ...

A High Content Imaging Assay for Identification of Botulinum Neurotoxin Inhibitors

Synaptosomal-associated protein-25 (SNAP-25) is a component of the soluble NSF attachment protein receptor (SNARE) complex that is essential for synaptic neurotransmitter release. Botulinum neurotoxin serotype A (BoNT/A) is a zinc metalloprotease that blocks exocytosis of neurotransmitter by cleaving the SNAP-25 component of the SNARE complex. Currently there are no licensed medicines to treat BoNT/A poisoning after internalization of the toxin by motor neurons. The development of effective therapeutic measures to counter BoNT/A intoxication has been limited, due in part to the lack of robust high-throughput assays for screening small molecule libraries. Here we describe a high content imaging (HCI) assay with utility for identification of BoNT/A inhibitors. Initial optimization efforts focused on improving the reproducibility of inter-plate results across multiple, independent experiments. Automation of immunostaining, image acquisition, and image analysis were found to increase assay consistency and minimize variability while enabling the multiparameter evaluation of experimental compounds in a murine motor neuron system.

Botulinum neurotoxin is one of the most potent toxins among Category-A biothreat agents, yet a post-exposure therapeutic is not available. The high content imaging approach is a powerful methodology for identifying novel inhibitors as it enables multiparameter screening using biologically relevant motor neurons, the primary target of this toxin.

Botulinum nörotoksininin önleyicilerinin tanımlanmasına daha yüksek bir miktarda Görüntüleme Deneyi

Synaptosomal-associated protein-25 (SNAP-25) is a component of the soluble NSF attachment protein receptor (SNARE) complex that is essential for synaptic ...

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Drosophila melanogaster is an emerging model to study different aspects of social interactions. For example, flies avoid areas previously occupied by stressed conspecifics due to an odorant released during stress known as the Drosophila stress odorant (dSO). Through the use of the T-maze apparatus, one can quantify the avoidance of the dSO by responder flies in a very affordable and robust assay. Conditions necessary to obtain a strong performance are presented here. A stressful experience is necessary for the flies to emit dSO, as well as enough emitter flies to cause a robust avoidance response to the presence of dSO. Genetic background, but not their group size, strongly altered the avoidance of the dSO by the responder flies. Canton-S and Elwood display a higher performance in avoiding the dSO than Oregon and Samarkand strains. This behavioral assay will allow identification of mechanisms underlying this social behavior, and the assessment of the influence of genes and environmental conditions on both emission and avoidance of the dSO. Such an assay can be included in batteries of simple diagnostic tests used to identify social deficiencies of mutants or environmental conditions of interest.

Straightforward Assay for Quantification of Social Avoidance in Drosophila melanogaster

Here, we present a protocol to quantify the avoidance of stressed individuals. This paradigm is powerful yet user-friendly and can be used to assess the influence of genes and environment on one kind of social interaction in Drosophila melanogaster.

Sosyal Kaçınma Niceleme için Basit Testi<em&gt; Drosophila melanogaster</em

Drosophila melanogaster is an emerging model to study different aspects of social interactions. For example, flies avoid areas previously occupied by ...

High-resolution Quantification of Odor-guided Behavior in Drosophila melanogaster Using the Flywalk Paradigm

In their natural environment, insects such as the vinegar fly Drosophila melanogaster are bombarded with a huge amount of chemically distinct odorants. To complicate matters even further, the odors detected by the insect nervous system usually are not single compounds but mixtures whose composition and concentration ratios vary. This leads to an almost infinite amount of different olfactory stimuli which have to be evaluated by the nervous system.
To understand which aspects of an odor stimulus determine its evaluation by the fly, it is therefore desirable to efficiently examine odor-guided behavior towards many odorants and odor mixtures. To directly correlate behavior to neuronal activity, behavior should be quantified in a comparable time frame and under identical stimulus conditions as in neurophysiological experiments. However, many currently used olfactory bioassays in Drosophila neuroethology are rather specialized either towards efficiency or towards resolution.
Flywalk, an automated odor delivery and tracking system, bridges the gap between efficiency and resolution. It allows the determination of exactly when an odor packet stimulated a freely walking fly, and to determine the animal&#180;s dynamic behavioral reaction.

High-resolution Quantification of Odor-guided Behavior in Drosophila melanogaster Using the Flywalk Paradigm

The automated tracking system Flywalk is used for high-resolution quantification of odor-guided behavior in Drosophila melanogaster.

Koku kılavuzluğunda Davranış Yüksek çözünürlüklü Niceleme<em&gt; Drosophila melanogaster</emKullanma&gt;<em&gt; Flywalk</em&gt; Paradigma

In their natural environment, insects such as the vinegar fly Drosophila melanogaster are bombarded with a huge amount of chemically distinct odorants. To ...

High-throughput Analysis of Locomotor Behavior in the Drosophila Island Assay

Advances in next-generation sequencing technologies contribute to the identification of (candidate) disease genes for movement disorders and other neurological diseases at an increasing speed. However, little is known about the molecular mechanisms that underlie these disorders. The genetic, molecular, and behavioral toolbox of Drosophila melanogaster makes this model organism particularly useful to characterize new disease genes and mechanisms in a high-throughput manner. Nevertheless, high-throughput screens require efficient and reliable assays that, ideally, are cost-effective and allow for the automatized quantification of traits relevant to these disorders. The island assay is a cost-effective and easily set-up method to evaluate Drosophila locomotor behavior. In this assay, flies are thrown onto a platform from a fixed height. This induces an innate motor response that enables the flies to escape from the platform within seconds. At present, quantitative analyses of filmed island assays are done manually, which is a laborious undertaking, particularly when performing large screens.
This manuscript describes the &#34;Drosophila Island Assay&#34; and &#34;Island Assay Analysis&#34; algorithms for&#160;high-throughput, automated data processing and quantification of island assay data. In the setup, a simple webcam connected to a laptop collects an image series of the platform while the assay is performed. The &#34;Drosophila Island Assay&#34; algorithm developed for the open-source software Fiji processes these image series and quantifies, for each experimental condition, the number of flies on the platform over time. The &#34;Island Assay Analysis&#34; script, compatible with the free software R, was developed to automatically process the obtained data and to calculate whether treatments/genotypes are statistically different. This greatly improves the efficiency of the island assay and makes it a powerful readout for basic locomotion and flight behavior. It can thus be applied to large screens investigating fly locomotor ability, Drosophila models of movement disorders, and drug efficacy.

High-throughput Analysis of Locomotor Behavior in the Drosophila Island Assay

The island assay is a relatively new, cost-effective assay that can be used to evaluate the basic locomotor behavior of Drosophila melanogaster. This manuscript describes algorithms for automatic data processing and objective quantification of island assay data, making this assay a sensitive, high-throughput readout for large genetic or pharmacological screens.

Yüksek üretilen iş analiz Locomotor davranış Drosophila Adası tahlil

Advances in next-generation sequencing technologies contribute to the identification of (candidate) disease genes for movement disorders and other ...

High-resolution Confocal Imaging of the Blood-brain Barrier: Imaging, 3D Reconstruction, and Quantification of Transcytosis

The blood-brain barrier (BBB) is a dynamic multicellular interface that regulates the transport of molecules between the circulation and the brain. Transcytosis across the BBB regulates the delivery of hormones, metabolites, and therapeutic antibodies to the brain parenchyma. Here, we present a protocol that combines immunofluorescence of free-floating sections with laser scanning confocal microscopy and image analysis to visualize subcellular organelles within endothelial cells at the BBB. Combining this data-set with 3D image analysis software allows for the semi-automated segmentation and quantification of capillary volume and surface area, as well as the number and intensity of intracellular organelles at the BBB. The detection of mouse endogenous immunoglobulin (IgG) within intracellular vesicles and their quantification at the BBB is used to illustrate the method. This protocol can potentially be applied to the investigation of the mechanisms controlling BBB transcytosis of different molecules in vivo.

Here we present a microscopy-based protocol for high-resolution imaging and a three-dimensional reconstruction of the mouse neurovascular unit and blood-brain barrier using brain free-floating sections. This method allows for the visualization, analysis, and quantification of intracellular organelles at the BBB.

Kan - beyin bariyerini yüksek çözünürlüklü Confocal görüntüleme: görüntüleme, 3D yeniden yapılanma ve Transcytosis miktar

The blood-brain barrier (BBB) is a dynamic multicellular interface that regulates the transport of molecules between the circulation and the brain. ...

A Temperature Gradient Assay to Determine Thermal Preferences of Drosophila Larvae

Many animals, including the fruit fly, Drosophila melanogaster, are capable of discriminating minute differences in&#160;environmental temperature, which enables them to seek out their preferred thermal landscape. To define the temperature preferences of larvae over a defined linear range, we developed an assay using a temperature gradient. To establish a single-directional gradient, two aluminum blocks are connected to independent water baths, each of which controls the temperature of individual blocks. The two blocks set the lower and upper limits of the gradient. The temperature gradient is established by placing an agarose-coated aluminum plate over the two water-controlled blocks so that the plate spans the distance between them. The ends of the aluminum plate that is set on the top of the water blocks defines the minimum and maximum temperatures, and the regions in-between the two blocks form a linear temperature gradient. The gradient assay can be applied to&#160;larvae of different ages and can be used to identify mutants that exhibit phenotypes, such as those with mutations affecting genes encoding TRP channels and opsins, which are required for temperature discrimination.

A Temperature Gradient Assay to Determine Thermal Preferences of Drosophila Larvae

Here, we present a protocol to determine the preferred environmental temperature of Drosophila larvae using a continuous thermal gradient.

Drosophila larva termal tercihlerini belirlemek için bir sıcaklık gradyanı tahlil

Many animals, including the fruit fly, Drosophila melanogaster, are capable of discriminating minute differences in&#160;environmental temperature, which ...

Quantitative Autoradiographic Method for Determination of Regional Rates of Cerebral Protein Synthesis In Vivo

Protein synthesis is required for development and maintenance of neuronal function and is involved in adaptive changes in the nervous system. Moreover, it is thought that dysregulation of protein synthesis in the nervous system may be a core phenotype in some developmental disorders. Accurate measurement of rates of cerebral protein synthesis in animal models is important for understanding these disorders. The method that we have developed was designed to be applied to the study of awake, behaving animals. It is a quantitative autoradiographic method, so it can yield rates in all regions of the brain simultaneously. The method is based on the use of a tracer amino acid, L-[1-14C]-leucine, and a kinetic model of the behavior of L-leucine in the brain. We chose L-[1-14C]-leucine as the tracer because it does not lead to extraneous labeled metabolic products. It is either incorporated into protein or rapidly metabolized to yield 14CO2 which is diluted in a large pool of unlabeled CO2 in the brain. The method and the model also allow for the contribution of unlabeled leucine derived from tissue proteolysis to the tissue precursor pool for protein synthesis. The method has the spatial resolution to determine protein synthesis rates in cell and neuropil layers, as well as hypothalamic and cranial nerve nuclei. To obtain reliable and reproducible quantitative data, it is important to adhere to procedural details. Here we present the detailed procedures of the quantitative autoradiographic L-[1-14C]-leucine method for the determination of regional rates of protein synthesis in vivo.

Protein synthesis is&#160;a critical biological process for cells. In brain, it is required for adaptive changes. Measurement of rates of protein synthesis in the intact brain requires careful methodological considerations. Here we present the L-[1-14C]-leucine quantitative autoradiographic method for determination of regional rates of cerebral protein synthesis in vivo.

Serebral protein sentezi In vivo bölgesel oranlarının belirlenmesi için nicel Autoradiographic yöntemi

Protein synthesis is required for development and maintenance of neuronal function and is involved in adaptive changes in the nervous system. Moreover, it ...

A High-content Assay for Monitoring AMPA Receptor Trafficking

Postsynaptic trafficking of receptors to and from the cell surface is an important mechanism by which neurons modulate their responsiveness to different stimuli. The &#945;-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors, which are responsible for fast excitatory synaptic transmission in neurons, are trafficked to and from the postsynaptic surface to dynamically alter neuronal excitability. AMPA receptor trafficking is essential for synaptic plasticity and can be disrupted in neurological disease. However, prevalent approaches for quantifying receptor trafficking ignore entire receptor pools, are overly time- and labor-intensive, or potentially disrupt normal trafficking mechanisms and therefore complicate the interpretation of resulting data. We present a high-content assay for the quantification of both surface and internal AMPA receptor populations in cultured primary hippocampal neurons using dual fluorescent immunolabeling and a near-infrared fluorescent 96-well microplate scanner. This approach facilitates the rapid screening of bulk internalized and surface receptor densities while minimizing sample material. However, our method has limitations in obtaining single-cell resolution or conducting live cell imaging. Finally, this protocol may be amenable to other receptors and different cell types, provided proper adjustments and optimization.

Neuronal excitability can be modulated through a dynamic process of endo- and exocytosis of excitatory ionotropic glutamate receptors. Described here is an accessible, high-content assay for quantifying surface and internal receptor population pools.

AMPA izlemek için bir yüksek-içerik tahlil reseptör ticareti

Postsynaptic trafficking of receptors to and from the cell surface is an important mechanism by which neurons modulate their responsiveness to different ...

Yüksek içerik miktar Sod1 canlı hücreler Mutant Protein toplama oluşumu için tahlil geliştirme

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler