Quantifying Environmental Microorganisms and Viruses Using qPCR

1. Sample Collection

1. Collect soil using an auger or shovel to a determined depth. If collecting soil from the rhizosphere, only collect soil within 7 mm around plant root, by hitting excess soil off the root and scraping desired soil into a collection barrel.
2. Place a sterile Nalgene bottle into dipping stick. Hold the end of the stick and collect water by submerging bottle. Place bottle into a cooler with ice.
3. Transfer samples to the laboratory.

2. Nucleic Acids Extraction

1. To isolate microorganisms from the collected samples and to extract DNA and/or RNA from them, please see the JoVE Science Education video on community nucleic acid extraction.

3. Reverse Transcription

1. If the genetic material being assayed is RNA, it must be used to generate complementary DNA (cDNA) via reverse transcription before proceeding to PCR. For details, please refer to JoVE Science Education video on RT-PCR.

4. Setting up qPCR

1. Retrieve reagents stored at -20 °C, and thaw them on ice or at room temperature inside a clean hood. Reagents used in this example include the qPCR reaction mix (dependent on the qPCR machine used; contains DNA polymerase), forward and reverse primers, and the TaqMan probe. The primer and probe sequences are designed with sequences specific to the organism that is being enumerated. Refer to current literature to find sequences of interest. In this example, the Roche Light Cycler 480 Probes Mix reagent system will be used. Pepper mild mottle virus will be enumerated in the water sample.^1,2 See Table 1 for primer and probe sequences.
2. Thaw extracted (c)DNA from samples and the positive control DNA (which consists of organism-specific sequences cloned into bacterial plasmids) at room temperature.
3. Prepare a 96-cell table template that resembles the 96-well qPCR plate. Label each cell with the reaction that will be loaded onto the plate. Include reactions for each sample and standard in triplicate, as well as for the positive control and negative control, such as a no-DNA reaction.
4. Calculate the reagent volumes needed for a reaction “master mix”, which includes all of the reagents that are constant among the reactions, based on manufacturer’s instructions and the literature. Prepare enough master mix for triplicate reactions for all samples plus controls, and an additional 10% to account for pipetting error. For a sample master mix recipe, refer to Table 2.
5. Working inside a clean hood, once all reagents are completely thawed, add calculated amount of each reagent into a 1.5-mL low-binding microfuge tube to create master mix. Vortex and briefly minicentrifuge each reagent before adding. Change pipette tip between each reagent to prevent contamination and ensure correct concentrations. After all reagents have been added, vortex and minicentrifuge tube with the master mix to ensure homogeneity.
6. Aliquot the appropriate volume of master mix into each designated well in the 96-well PCR plate.
7. Add the appropriate volume of (c)DNA sample, positive control plasmid, and negative control (molecular grade water) into designated wells.
8. Once all samples and controls have been added, seal plate with sealing foil. Use a sealing tool to push air out from underneath the foil and prevent bubbles. Tear off edges of the foil carefully.
9. Centrifuge the sealed 96-well plate in a centrifuge with a plate-holder to gather mixture at the bottom of each well. Make sure to use a counterweight plate to ensure that the centrifuge will be properly balanced while rotating. Pulse centrifuge up to 1000 rpm, then let the centrifuge slowly stop without brakes.

5. qPCR Operation

1. Place sealed 96-well plate into qPCR machine. Ensure that machine indicates it is ready to start.
2. Follow qPCR machine instructions to properly input all information needed by software, then set qPCR machine to run.
3. After machine completes run, the software will be able to use the known concentrations of the positive control to calculate the quantity of cDNA in each reaction. The quantity of virus in the original sample can then be calculated, based on the dilution, filtration, concentration, amplification, and/or extraction processes performed to obtain the DNA sample.

Reagent	Sequence (5’ → 3’)	Volume (μL / well)	Final Conc.
Forward Primer	GAGTGGTTTGACCTTAACGT­TTGA	2.25	900 nM
Reverse Primer	TTGTCGGTTGCAATGCAAGT	2.25	900 nM
Probe	FAM-CCTACCGAAGCAAATG-BHQ1	1.0	200 nM

Table 1. Sample primer and probe sequences for detecting pepper mild mottle virus.

Reagent	Volume (μL / well)	Number of Wells	Master Mix Volume (μL)
LC 480 Mix	12.5	26	325
Molecular H2O	4.5		117
Forward Primer	2.25		58.5
Reverse Primer	2.25		58.5
Probe	1.0		26
Total	22.5		585

Table 2. Reagent volumes for individual reaction and master mix.