We thank Dr. Charles Greenberg for the use of his Real time PCR machine. This work is supported by MUSC Hollings Cancer Center Startup Fund, Hollings Cancer Center ACS IRG, ASCO Conquer Cancer Foundation Career Development Award, NIH 1K08HL 103780-01A1, and NIH 3P30CA138313-01S3. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or other funding agents.

1. Bone Marrow Cell Isolation
<ol>
	<li>Euthanize male donor FVB/NJ mice and female FVB/NJ mice using CO2 method followed by cervical dislocation. The female FVB/NJ bone marrow cells will be used as competitive cells.</li>
	<li>Use small scissors and forceps, dissect out femurs and tibiaes from mice and place them in a 60 mm tissue culture dish containing 6 ml ice-cold RPMI1640 with 5% heat inactivated FBS. Use kimwipe tissue to remove muscle and other tissues. Cut off both ends of each bone shaft in the dish.</li>
	<li>Connect the end of the bone with 23G needle on 3 cc syringe, flush out bone marrow with RPMI1640 with 5% heat inactivated FBS into the dish. Disaggregate bone marrow tissues by repeated aspirations using the same needle. Transfer the cell suspension to 15 ml centrifuge tube.</li>
	<li>Spin down the cells for 5 min at 400 x g, remove the supernatant, resuspend the cells in 1 ml of room temperature red blood cell lysis buffer (155 mM potassium bicarbonate, 10 mM Ammonium chloride, 0.1 mM of EDTA, PH=7.4) and incubate at room temperature for 5 min then add 5-10 ml of RPMI 1640 with 5% heat inactivated FBS.</li>
	<li>Pass the cells through a cell strainer. Collect the flow through to a new tube. Spin down for 5 min at 400 x g. Remove the supernatant; the cell pellet should not contain any red color. The absence of red color indicates a complete removal of red blood cells. Resuspend the cell pellet in 10 ml of RPMI1640 with 5% heat inactivated FBS. Gently vortex to make sure the cell suspension is completely uniform. Take an aliquot and count the cells in a hemacytometer. Calculate how much volume of cells needed for bone marrow transplantation and aliquot enough cells and mix male donor cells with competitor female cells at a ratio of 5:2. Spin down for 5 min at 400 x g, wash with PBS, resuspend in PBS with the final concentration of donor cells at 5&times;106/ml and competitor cells at 2&times;106/ml.</li>
</ol>
2. Competitive Bone Marrow Transplantation
<ol>
	<li>Irradiate female recipient mice (8-12 wks of age) with 137Cs gamma rays radiator at a single dose of 11Gy 4-6 hr before bone marrow transplantation.</li>
	<li>Place the irradiated female mice in a mouse restrainer. Inject the mixed donor and competitor cells via tail vein in 0.1 ml of total volume such that each mouse receives 5&times;105 donor cells and 2&times;105 competitor bone marrow cells.</li>
</ol>
3. Sample Collection
Couples weeks after bone marrow transplantation, collect peripheral blood samples (~50 &mu;l) from female recipient mouse by retro-orbital bleeding under anesthesia condition. Samples are collected into EDTA coated tubes. BM samples can also be collected at the end of experiment, usually at least 4 months post transplantation, with same procedures as previous described (Step 1); usually 20-40% of 1 tibia BM cells are enough to make enough amount of DNA. Blood or BM samples from age matched normal female and male mice are also collected to prepare standard curve.
4. Genomic DNA Isolation
<ol>
	<li>Add 4&times; volume of room temperature RBC lysis buffer (~ 200 &mu;l) to each blood sample. Mix well and incubate at room temperature for 5 min. Add 1 ml of PBS, then spin down to remove most of the lysed RBC.</li>
	<li>Isolate DNA using a blood DNA extraction kit (QIAmp DNA Blood extraction kit). Pre-warm the elution buffer (AE) at 37 &deg;C to enhance the yield of eluted DNA. Male and female DNAs for standard curve are isolated similarly.</li>
	<li>(Optional) Genomic DNA can be further purified or concentrated using EtOH precipitation method in the presence of 3 M Sodium Acetate (pH=5.5). The DNA pellets are then resuspended in 40-50 &mu;l distilled water for analysis immediately or stored at -20 &deg;C for future use.</li>
	<li>Measure the DNA concentration with Nanodrop ND-1000 spectra photometer. Samples with OD 260/280 between 1.8-2.0 are used for further analysis.</li>
	<li>Dilute DNA with DNAase free H2O to 4ng/&mu;l in a total volume of 50 &mu;l.</li>
</ol>
5. Standard Curve Preparation
Dilute male DNA and female DNA to a concentration of 4 ng/&mu;l, and make the DNA mixture according the Table1
<table border="1">
	<tbody>
		<tr>
			<td>% of male DNA in Female Background</td>
			<td>Volume (&mu;l) of 4ng/&mu;l male DNA</td>
			<td>Volume (&mu;l) of 4ng/&mu;l female DNA</td>
			<td>Total volume(&mu;l)</td>
		</tr>
		<tr>
			<td>0.2</td>
			<td>1</td>
			<td>499</td>
			<td>500</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>1</td>
			<td>199</td>
			<td>200</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>5</td>
			<td>195</td>
			<td>200</td>
		</tr>
		<tr>
			<td>12.5</td>
			<td>25</td>
			<td>175</td>
			<td>200</td>
		</tr>
		<tr>
			<td>50</td>
			<td>100</td>
			<td>100</td>
			<td>200</td>
		</tr>
		<tr>
			<td>87.5</td>
			<td>175</td>
			<td>25</td>
			<td>200</td>
		</tr>
		<tr>
			<td>100</td>
			<td>200</td>
			<td>0</td>
			<td>200</td>
		</tr>
	</tbody>
</table>
Table 1. Sample preparation for standard curve. Normal male and female FVB/NJ mice at the age of 8-12wks were sacrificed. Blood and BM cells were collected. DNAs from male cells and female cells were isolated and re-suspended at a concentration of 4ng/&mu;l. The male and female DNAs were mixed at various ratios to generate the DNA standard sample mixtures.
6. Real-time PCR
<ol>
	<li>Set up the PCR reaction plate by mixing SYBR Green supermix reagent with primers and genomic DNA. The reaction volume (20 &mu;l) contains 400 nM of each primer and 5 &mu;l of blood cell genomic DNA (4ng/&mu;l x5 &mu;l=20 ng) in each reaction. DNA samples and standards were set up in triplicate. The sequences of primers are shown in Table 2.</li>
</ol>
<table border="1">
	<tbody>
		<tr>
			<td>Gene name</td>
			<td>Forward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>Bcl2</td>
			<td>5&prime;-AAGCTGTCACAGAGGGGCTA</td>
			<td>5&prime;- CAGGCTGGAAGGAGAAGATG</td>
		</tr>
		<tr>
			<td>Zfy1</td>
			<td>5-TGGAGAGCCACAAGCTAACCA</td>
			<td>5'- CCCAGCATGAGAAAGATTCTTC</td>
		</tr>
	</tbody>
</table>
Table 2. RT-PCR primer sequence for murine Bcl2 and Zfy1.
<ol start="2">
	<li>Perform PCR reaction using Biorad iQ5 PCR machine with the following conditions: 95 &deg;C 3 min, 42 amplification cycles of 95 &deg;C for 10 sec, 58 &deg;C for 25 sec and 72 &deg;C for 15 sec, followed by a melting-curve step.</li>
	<li>Obtain Cycle threshold (Ct) values by Bio-Rad iQ5 2.1 Standard Edition Optical System. Calculate &delta;Ct (CtZfy1-CtBcl2) value, and Zfy1 expression level is calculated as the value of 2-&delta; Ct.</li>
	<li>Establish standard curves for each reaction series using 2-&delta;Ct reading from known male/female standard mixtures. The standard curves are generated by plotting the mean of 2-&delta;Ct value of triplicates to the known % male DNA in the mixture with linear regression fitting.</li>
</ol>

<ol>
	<li>McCulloch, E. A., Till, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+radiation+sensitivity+of+normal+mouse+bone+marrow+cells,+determined+by+quantitative+marrow+transplantation+into+irradiated+mice.">The radiation sensitivity of normal mouse bone marrow cells, determined by quantitative marrow transplantation into irradiated mice.</a> Radiat. Res. 13, 115-125 (1960).</li><li>Xiao, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+stem+cells+lacking+Ott1+display+aspects+associated+with+aging+and+are+unable+to+maintain+quiescence+during+proliferative+stress.">Hematopoietic stem cells lacking Ott1 display aspects associated with aging and are unable to maintain quiescence during proliferative stress.</a> Blood. 119, 4898-4907 (2012).</li><li>Kang, Y., Chen, B. J., Deoliveira, D., Mito, J., Chao, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+enhancement+of+donor+hematopoietic+cell+engraftment+by+the+CXCR4+antagonist+AMD3100+in+a+mouse+transplantation+model.">Selective enhancement of donor hematopoietic cell engraftment by the CXCR4 antagonist AMD3100 in a mouse transplantation model.</a> PLoS One. 5, e11316 (2010).</li><li>Sadeghi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GVHD+after+chemotherapy+conditioning+in+allogeneic+transplanted+mice.">GVHD after chemotherapy conditioning in allogeneic transplanted mice.</a> Bone Marrow Transplant. 42, 807-818 (2008).</li><li>Taketo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FVB/N:+an+inbred+mouse+strain+preferable+for+transgenic+analyses.">FVB/N: an inbred mouse strain preferable for transgenic analyses.</a> Proc. Natl. Acad. Sci. U.S.A. 88, 2065-2069 (1991).</li><li>Morisaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotypic+analysis+using+a+Y-chromosome-specific+probe+following+bone+marrow+transplantation.">Genotypic analysis using a Y-chromosome-specific probe following bone marrow transplantation.</a> Am. J. Hematol. 27, 30-33 (1988).</li><li>Lo, Y. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+fetal+DNA+in+maternal+plasma+and+serum:+implications+for+noninvasive+prenatal+diagnosis.">Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis.</a> Am. J. Hum. Genet. 62, 768-775 (1998).</li><li>Byrne, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimerism+analysis+in+sex-mismatched+murine+transplantation+using+quantitative+real-time+PCR.">Chimerism analysis in sex-mismatched murine transplantation using quantitative real-time PCR.</a> Biotechniques. 32, 279-280 (2002).</li><li>Ma, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+recipient-derived+cells+in+allograft+neointima+formation+and+the+response+to+stent+implantation.">Contribution of recipient-derived cells in allograft neointima formation and the response to stent implantation.</a> PLoS One. 3, e1894 (2008).</li><li>Bosio, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+between+real-time+quantitative+PCR+and+DNA+hybridization+for+quantitation+of+male+DNA+following+myoblast+transplantation.">A comparison between real-time quantitative PCR and DNA hybridization for quantitation of male DNA following myoblast transplantation.</a> Cell Transplant. 13, 817-821 (2004).</li><li>Merchant, A., Joseph, G., Wang, Q., Brennan, S., Matsui, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+regulates+the+proliferation+and+differentiation+of+HSCs+and+myeloid+progenitors.">Gli1 regulates the proliferation and differentiation of HSCs and myeloid progenitors.</a> Blood. 115, 2391-2396 (2010).</li><li>Nagamine, C. M., Chan, K., Hake, L. E., Lau, Y. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+two+candidate+testis-determining+Y+genes+(Zfy-1+and+Zfy-2)+are+differentially+expressed+in+fetal+and+adult+mouse+tissues.">The two candidate testis-determining Y genes (Zfy-1 and Zfy-2) are differentially expressed in fetal and adult mouse tissues.</a> Genes &amp; development. 4, 63-74 (1990).</li><li>Grundler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+PIM+serine/threonine+kinases+in+FLT3-ITD-induced+leukemogenesis+reveals+PIM1+as+regulator+of+CXCL12-CXCR4-mediated+homing+and+migration.">Dissection of PIM serine/threonine kinases in FLT3-ITD-induced leukemogenesis reveals PIM1 as regulator of CXCL12-CXCR4-mediated homing and migration.</a> J. Exp. Med. 206, 1957-1970 (2009).</li></ol>

We have no competing financial interests to disclose.

The objective of our current study is to provide the audiences a PCR based technique to quantify donor cell engraftment in a competitive murine bone marrow transplantation model. Several studies have been reported using RT-PCR to detect donor cells in transplantation models 9-10. Dr. Schwarzenberger's group first developed a murine bone marrow transplantation model using real-time PCR to amplify y-chromosome-specific 8. This method was used to study Gli-1 function in HSC activity 11. We t...

Murine bone marrow (BM) transplantation model was first developed in 1960s1. This model has been extensively used for the study of donor hematopoietic stem cell (HSC) biology in a host recipient mouse. Murine bone marrow transplant model has provided us with valuable knowledge on HSC functions and their regulation and is indispensable in HSC research. Allogeneic bone marrow transplant model like C57Bl/6JH2b-Balb/CH2d or congenic transplant model like C56Bl/6JCD45.2-B6.SJLCD45.1 are used in many laboratories to study the gene function on HSC activity2, effect of drug treatment on HSC function3 or transplantation related diseases such as graft-versus-host disease (GvHD)4.
Cell surface markers such as MHC haplotype or CD45.1 are commonly used for distinguishing donor-derived cells from recipient-originated cells. C57Bl/6JH2b, CD45.2, Balb/CH2d and B6.SJLCD45.1 are the most commonly used mouse strains in bone marrow transplantation because the donor cell contribution can be easily assessed by flow cytometry measuring CD45.1 vs. CD45.2 or H2b vs. H2d. However, many other strains such as FVB/NJ5 and C3H are also often used to generate genetically engineered transgenic or knockout mice. These mice may be backcrossed to an inbred line and maintained in a mixed genetic/MHC background. In these cases, determining donor cell engraftment and HSC function could be difficult as donor specific- cell surface markers may not be available.
Using Y-chromosome-specific DNA probe to detect the donor male cells by southern blot in sex-mismatched bone marrow transplantation was first developed by Dr. Miwa's group 6. Then, a real-time PCR for the sex-determining region Y was found to be an accurate and highly specific method to quantitate male fetal cells in the maternal blood system7. This concept was adapted by Dr. Schwarzenberger's group for the development of a real-time PCR technique in a murine bone marrow transplantation model to determine donor cell engraftment 8. We further modified this method for the measurement of donor cell engraftment in FVB/NJ mouse bone marrow transplant model. This method is currently extensively utilized in our group for studying the role of Pim1 kinase in HSC biology.

<table border="1">
<tbody>
 <tr>
 <td>Name 			of the reagent</td>
 <td>Company</td>
 <td>Catalogue 			number</td>
 <td>Comments 			(optional)</td>
 </tr>
 <tr>
 <td>RPMI 			1640</td>
 <td>Hyclone</td>
 <td>SH30255.01</td>
 <td></td>
 </tr>
 <tr>
 <td>FBS</td>
 <td>Invitrogen</td>
 <td>16140-017</td>
 <td>Heat 			inactivated</td>
 </tr>
 <tr>
 <td>Ammonium 			chloride</td>
 <td>MP 			Biomedicaals</td>
 <td>194806</td>
 <td></td>
 </tr>
 <tr>
 <td>Potassium 			Bicarbonate</td>
 <td>Fisher</td>
 <td>P184-500</td>
 <td></td>
 </tr>
 <tr>
 <td>QIAamp 			DNA Blood minikit</td>
 <td>Qiagen</td>
 <td>51106</td>
 <td></td>
 </tr>
 <tr>
 <td>Cell 			strainer</td>
 <td>BD 			bioscience</td>
 <td></td>
 <td></td>
 </tr>
 <tr>
 <td>iQ 			SYBR Green supermix</td>
 <td>Biorad</td>
 <td>170-8882</td>
 <td></td>
 </tr>
 <tr>
 <td>iQ5 			real time PCR machine</td>
 <td>Biorad</td>
 <td></td>
 <td></td>
 </tr>
 <tr>
 <td>Spectra 			photometer</td>
 <td>Nanodrop 			ND-1000</td>
 <td>ND-1000</td>
 <td></td>
 </tr>
 </tbody>
</table>

using quantitative real-time pcr to determine donor cell engraftment in a competitive murine bone marrow transplantation model

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules that regulate HSCs. In these transplant model systems, the function of HSCs is determined by the ability of these cells to engraft and reconstitute lethally irradiated recipient mice. Commonly, the donor cell contribution/engraftment is measured by antibodies to donor- specific cell surface proteins using flow cytometry. However, this method heavily depends on the specificity and the ability of the cell surface marker to differentiate donor-derived cells from recipient-originated cells, which may not be available for all mouse strains. Considering the various backgrounds of genetically modified mouse strains in the market, this cell surface/ flow cytometry-based method has significant limitations especially in mouse strains that lack well-defined surface markers to separate donor cells from congenic recipient cells. Here, we reported a PCR-based technique to determine donor cell engraftment/contribution in transplant recipient mice. We transplanted male donor bone marrow HSCs to lethally irradiated congenic female mice. Peripheral blood samples were collected at different time points post transplantation. Bone marrow samples were obtained at the end of the experiments. Genomic DNA was isolated and the Y chromosome specific gene, Zfy1, was amplified using quantitative Real time PCR. The engraftment of male donor-derived cells in the female recipient mice was calculated against standard curve with known percentage of male vs. female DNAs. Bcl2 was used as a reference gene to normalize the total DNA amount. Our data suggested that this approach reliably determines donor cell engraftment and provides a useful, yet simple method in measuring hematopoietic cell reconstitution in murine bone marrow transplantation models. Our method can be routinely performed in most laboratories because no costly equipment such as flow cytometry is required.

Figure 1 and 2 showed examples of standard curves plotted with mean values of 2-&delta;Ct against percentages of male DNA. Figure 1A showed specific melting temperature for Bcl2 and Zfy1 amplicons localized at 78.5 &deg;C and 88.5 &deg;C, respectively. Bcl2 is used as a reference gene to normalize the total amount of loaded DNA in each PCR reaction. Bcl2 amplification curves (Log view) for each standard sample merge with each other independent of male DNA concentration, indica...

Watch this Scientific Journal Video about Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model at JoVE.com

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules ...

using-quantitative-real-time-pcr-to-determine-donor-cell-engraftment

Research

JoVE Journal

Medicine

15.3K Views.  Medical University of South Carolina. Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Video: Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

A Mouse Model of in Utero Transplantation

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus. For example, in utero transplantation (IUT) of hematopoietic stem cells has been used to successfully treat patients with severe combined immunodeficiency.1,2 In several other conditions, however, IUT has been attempted without success.3 Given these mixed results, the availability of an efficient non-human model to study the biological sequelae of stem cell transplantation and gene therapy is critical to advance this field. We and others have used the mouse model of IUT to study factors affecting successful engraftment of in utero transplanted hematopoietic stem cells in both wild-type mice4-7 and those with genetic diseases.8,9 The fetal environment also offers considerable advantages for the success of in utero gene therapy. For example, the delivery of adenoviral10, adeno-associated viral10, retroviral11, and lentiviral vectors12,13 into the fetus has resulted in the transduction of multiple organs distant from the site of injection with long-term gene expression. in utero gene therapy may therefore be considered as a possible treatment strategy for single gene disorders such as muscular dystrophy or cystic fibrosis. Another potential advantage of IUT is the ability to induce immune tolerance to a specific antigen. As seen in mice with hemophilia, the introduction of Factor IX early in development results in tolerance to this protein.14 
In addition to its use in investigating potential human therapies, the mouse model of IUT can be a powerful tool to study basic questions in developmental and stem cell biology. For example, one can deliver various small molecules to induce or inhibit specific gene expression at defined gestational stages and manipulate developmental pathways. The impact of these alterations can be assessed at various timepoints after the initial transplantation. Furthermore, one can transplant pluripotent or lineage specific progenitor cells into the fetal environment to study stem cell differentiation in a non-irradiated and unperturbed host environment.
The mouse model of IUT has already provided numerous insights within the fields of immunology, and developmental and stem cell biology. In this video-based protocol, we describe a step-by-step approach to performing IUT in mouse fetuses and outline the critical steps and potential pitfalls of this technique.

A Mouse Model of in Utero Transplantation

The mouse model of in utero transplantation is a versatile tool that can be used to study the potential clinical applications of stem cell transplantation and gene therapy in the fetus. In this protocol, we present a general approach to performing this technique

The transplantation of stem cells and viruses in utero has tremendous potential for treating congenital disorders in the human fetus.  For example, in ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

Pre-clinical Evaluation of Tyrosine Kinase Inhibitors for Treatment of Acute Leukemia

Receptor tyrosine kinases have been implicated in the development and progression of many cancers, including both leukemia and solid tumors, and are attractive druggable therapeutic targets. Here we describe an efficient four-step strategy for pre-clinical evaluation of tyrosine kinase inhibitors (TKIs) in the treatment of acute leukemia. Initially, western blot analysis is used to confirm target inhibition in cultured leukemia cells. Functional activity is then evaluated using clonogenic assays in methylcellulose or soft agar cultures. Experimental compounds that demonstrate activity in cell culture assays are evaluated in vivo using NOD-SCID-gamma (NSG) mice transplanted orthotopically with human leukemia cell lines. Initial in vivo pharmacodynamic studies evaluate target inhibition in leukemic blasts isolated from the bone marrow. This approach is used to determine the dose and schedule of administration required for effective target inhibition. Subsequent studies evaluate the efficacy of the TKIs in vivo using luciferase expressing leukemia cells, thereby allowing for non-invasive bioluminescent monitoring of leukemia burden and assessment of therapeutic response using an in vivo bioluminescence imaging system. This strategy has been effective for evaluation of TKIs in vitro and in vivo and can be applied for identification of molecularly-targeted agents with therapeutic potential or for direct comparison and prioritization of multiple compounds.

Receptor tyrosine kinases are ectopically expressed in many cancers and have been identified as therapeutic targets in acute leukemia. This manuscript describes an efficient strategy for pre-clinical evaluation of tyrosine kinase inhibitors for the treatment of acute leukemia.

Receptor tyrosine kinases have been implicated in the development and progression of many cancers, including both leukemia and solid tumors, and are ...

Murine Cervical Heart Transplantation Model Using a Modified Cuff Technique

Mouse models are of special interest in research since a wide variety of monoclonal antibodies and commercially defined inbred and knockout strains are available to perform mechanistic in vivo studies. While heart transplantation models using a suture technique were first successfully developed in rats, the translation into an equally widespread used murine equivalent was never achieved due the technical complexity of the microsurgical procedure. In contrast, non-suture cuff techniques, also developed initially in rats, were successfully adapted for use in mice1-3. This technique for revascularization involves two major steps I) everting the recipient vessel over a polyethylene cuff; II) pulling the donor vessel over the formerly everted recipient vessel and holding it in place with a circumferential tie. This ensures a continuity of the endothelial layer, short operating time and very high patency rates4.
Using this technique for vascular anastomosis we performed more than 1,000 cervical heart transplants with an overall success rate of 95%. For arterial inflow the common carotid artery and the proximal aortic arch were anastomosed resulting in a retrograde perfusion of the transplanted heart. For venous drainage the pulmonary artery of the graft was anastomosed with the external jugular vein of the recipient5.
Herein, we provide additional details of this technique to supplement the video.

The murine cervical heart transplantation model is well suited for immunological as well as ischemia reperfusion injury studies. We modified the procedure using a non-suture cuff technique and performed more than 1,000 successful transplants with this approach.
Herein, we provide additional details of this technique to supplement the video.

Mouse models are of special interest in research since a wide variety of monoclonal antibodies and commercially defined inbred and knockout strains are ...

A Three-dimensional Tissue Culture Model to Study Primary Human Bone Marrow and its Malignancies

Tissue culture has been an invaluable tool to study many aspects of cell function, from normal development to disease. Conventional cell culture methods rely on the ability of cells either to attach to a solid substratum of a tissue culture dish or to grow in suspension in liquid medium. Multiple immortal cell lines have been created and grown using such approaches, however, these methods frequently fail when primary cells need to be grown ex vivo. Such failure has been attributed to the absence of the appropriate extracellular matrix components of the tissue microenvironment from the standard systems where tissue culture plastic is used as a surface for cell growth. Extracellular matrix is an integral component of the tissue microenvironment and its presence is crucial for the maintenance of physiological functions such as cell polarization, survival, and proliferation. Here we present a 3-dimensional tissue culture method where primary bone marrow cells are grown in extracellular matrix formulated to recapitulate the microenvironment of the human bone (rBM system). Embedded in the extracellular matrix, cells are supplied with nutrients through the medium supplemented with human plasma, thus providing a comprehensive system where cell survival and proliferation can be sustained for up to 30 days while maintaining the cellular composition of the primary tissue. Using the rBM system we have successfully grown primary bone marrow cells from normal donors and patients with amyloidosis, and various hematological malignancies. The rBM system allows for direct, in-matrix real time visualization of the cell behavior and evaluation of preclinical efficacy of novel therapeutics. Moreover, cells can be isolated from the rBM and subsequently used for in vivo transplantation, cell sorting, flow cytometry, and nucleic acid and protein analysis. Taken together, the rBM method provides a reliable system for the growth of primary bone marrow cells under physiological conditions.

In standard culture methods cells are taken out of their physiological environment and grown on the plastic surface of a dish. To study the behavior of primary human bone marrow cells we created a 3-D culture system where cells are grown under conditions recapitulating the native microenvironment of the tissue.

Tissue culture has been an invaluable tool to study many aspects of cell function, from normal development to disease. Conventional cell culture methods ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

Murine Corneal Transplantation: A Model to Study the Most Common Form of Solid Organ Transplantation

Corneal transplantation is the most common form of organ transplantation in the United States with between 45,000 and 55,000 procedures performed each year. While several animal models exist for this procedure and mice are the species that is most commonly used. The reasons for using mice are the relative cost of using this species, the existence of many genetically defined strains that allow for the study of immune responses, and the existence of an extensive array of reagents that can be used to further define responses in this species. This model has been used to define factors in the cornea that are responsible for the relative immune privilege status of this tissue that enables corneal allografts to survive acute rejection in the absence of immunosuppressive therapy. It has also been used to define those factors that are most important in rejection of such allografts. Consequently, much of what we know concerning mechanisms of both corneal allograft acceptance and rejection are due to studies using a murine model of corneal transplantation. In addition to describing a model for acute corneal allograft rejection, we also present for the first time a model of late-term corneal allograft rejection.

Mice have been used as a model for studying many forms of transplantation, including corneal transplantation. We describe in this report a murine model for both acute and late-term corneal transplantation.

Corneal transplantation is the most common form of organ transplantation in the United States with between 45,000 and 55,000 procedures performed each ...

Evaluation of Lung Metastasis in Mouse Mammary Tumor Models by Quantitative Real-time PCR

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated death 1. Common sites of metastatic spread include lung, lymph node, brain, and bone 2. Mechanisms that drive metastasis are intense areas of cancer research. Consequently, effective assays to measure metastatic burden in distant sites of metastasis are instrumental for cancer research. Evaluation of lung metastases in mammary tumor models is generally performed by gross qualitative observation of lung tissue following dissection. Quantitative methods of evaluating metastasis are currently limited to ex vivo and in vivo imaging based techniques that require user defined parameters. Many of these techniques are at the whole organism level rather than the cellular level 3-6. Although newer imaging methods utilizing multi-photon microscopy are able to evaluate metastasis at the cellular level 7, these highly elegant procedures are more suited to evaluating mechanisms of dissemination rather than quantitative assessment of metastatic burden. Here, a simple in vitro method to quantitatively assess metastasis is presented. Using quantitative Real-time PCR (QRT-PCR), tumor cell specific mRNA can be detected within the mouse lung tissue.

This protocol describes how to use quantitative Real-time PCR (QRT-PCR) to detect tumor cell specific mRNA representing metastasis within the mouse lung tissue.

Metastatic disease is the spread of malignant tumor cells from the primary cancer site to a distant organ and is the primary cause of cancer associated ...

Murine Cervical Aortic Transplantation Model using a Modified Non-Suture Cuff Technique

With the introduction of powerful immunosuppressive protocols, distinct advances are possible in the prevention and therapy of acute rejection episodes. However, only minor improvement in the long-term results of transplanted solid organs could be observed over the past decades. In this context, chronic allograft vasculopathy (CAV) still represents the leading cause of late organ failure in cardiac, renal and pulmonary transplantation.
Thus far, the underlying pathogenesis of CAV development remains unclear, explaining why effective treatment strategies are presently missing and emphasizing a need for relevant experimental models in order to study the underlying pathophysiology leading to CAV formation. The following protocol describes a murine heterotopic cervical aortic transplantation model using a modified non-suture cuff technique. In this technique, a segment of the thoracic aorta is interpositioned in the right common carotid artery. With the use of the non-suture cuff technique, an easy to learn and reproducible model can be established, minimizing the possible heterogeneity of sutured vascular micro anastomoses.

Here, we present a protocol of heterotopic aortic transplantation in mice using the non-suture cuff technique in a cervical murine model. This model can be used to study the underlying pathology of chronic allograft vasculopathy (CAV) and can help evaluate new therapeutic agents in order to prevent its formation.

With the introduction of powerful immunosuppressive protocols, distinct advances are possible in the prevention and therapy of acute rejection episodes. ...

Flow Cytometry Analysis of Immune Cell Subsets within the Murine Spleen, Bone Marrow, Lymph Nodes and Synovial Tissue in an Osteoarthritis Model

Osteoarthritis (OA) is one of the most prevalent musculoskeletal diseases, affecting patients suffering from pain and physical limitations. Recent evidence indicates a potential inflammatory component of the disease, with both T-cells and monocytes/macrophages potentially associated with the pathogenesis of OA. Further studies postulated an important role for subsets of both inflammatory cell lineages, such as Th1, Th2, Th17, and T-regulatory lymphocytes, and M1, M2, and synovium-tissue-resident macrophages. However, the interaction between the local synovial and systemic inflammatory cellular response and the structural changes in the joint is unknown. To fully understand how T-cells and monocytes/macrophages contribute towards OA, it is important to be able to quantitively identify these cells and their subsets simultaneously in synovial tissue, secondary lymphatic organs and systemically (the spleen and bone marrow). Nowadays, the different inflammatory cell subsets can be identified by a combination of cell-surface markers making multi-color flow cytometry a powerful technique in investigating these cellular processes. In this protocol, we describe detailed steps regarding the harvest of synovial tissue and secondary lymphatic organs as well as generation of single cell suspensions. Furthermore, we present both an extracellular staining assay to identify monocytes/macrophages and their subsets as well as an extra- and intra-cellular staining assay to identify T-cells and their subsets within the murine spleen, bone marrow, lymph nodes and synovial tissue. Each step of this protocol was optimized and tested, resulting in a highly reproducible assay that can be utilized for other surgical and non-surgical OA mouse models.

Here, we describe a detailed and reproducible flow cytometry protocol to identify monocyte/macrophage and T-cell subsets using both extra- and intracellular staining assays within the murine spleen, bone marrow, lymph nodes and synovial tissue, utilizing an established surgical model of murine osteoarthritis.