Name: measurement of in vitro integration activity of hiv-1 preintegration complexes
Uploaded: 2017-02-22T12:30:00
Description: Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

This work is partly supported by grants DA024558, DA30896, DA033892, and DA021471 from the NIDA/NIH to CD. We also acknowledge the RCMI grant G12MD007586, the Vanderbilt CTSA grant UL1RR024975, the Meharry Translational Research Center (MeTRC) CTSA grant U54 RR026140 from the NCRR/NIH, the U54 grant MD007593 from the NIMHD/NIH, and the Tennessee CFAR grant P30 AI110527.

1. Virus Production
NOTE: To generate high titers of infectious HIV-1, transfect the Human Embryonic Kidney (HEK) cell line 293T with an infectious HIV-1 molecular clone using an activated dendrimer-based transfection reagent. It has been observed that the calcium phosphate transfection method yields comparable results.
<ol>
	<li>In a Biosafety Level 2 (BSL2) lab, seed 3 x 106 293T cells per 10 cm dish in 8 mL of Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% Fe...

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

Biochemical analyses of retroviral PICs have provided critical insights into the mechanism of retroviral DNA integration. Measurement of the integration activity of retroviral PICs can be achieved by plaque formation assay, Southern blot analysis, and nested qPCR. The experimental strategy of plaque assay is laborious and utilizes an indirect method to measure integration6,7,18. Southern blot-based assays measure integration dir...

HIV-1 replication in the target cell involves multiple steps, broadly grouped into two phases: early and late events. The early events begin when HIV-1 sequentially binds to the target cell surface receptor CD4 and one of the two co-receptors (CCR5 or CXCR4)1. Consequently, the virus-cell membranes fuse, and the viral capsid (CA) core is released into the cytoplasm2. The CA core contains the viral genomic single-stranded RNA (ssRNA) and several proteins, both viral and cellular in origin. The CA-associated viral proteins include Reverse Transcriptase (RT) and integrase (IN), two enzymes that mediate critical steps during early events in viral replication. The RT and IN function in the context of nucleoprotein complexes, namely the Reverse Transcription Complex (RTC) and the pre-integration complex (PIC), respectively3,4,5,6. The ends of the viral ssRNA genome harbor terminal repeat (R) elements adjacent to the unique sequences U5 (at the 5&#39; end) and U3 (at the 3&#39; end). The RTC converts the viral ssRNA genome into a double-stranded (ds) DNA copy (vDNA). This reverse transcription process also results in duplication of the U5 and U3 sequences, thus generating long terminal repeats (LTR) at both ends of the vDNA7,8. Subsequently, the PIC-associated IN catalyzes two sequential biochemical reactions that enable the integration of the vDNA into the host chromosome9,10,11. First, in the cytoplasm, IN multimers engage both LTRs12 and cleave a dinucleotide from each of the 3&#39;-terminal ends. This 3&#39;-end processing generates a hydroxyl group at each 3&#39;-end (CAOH) of the vDNA. Next, PIC traffics to the nucleus, wherein IN uses the vDNA CAOH as a nucleophile to cut both strands of the chromosomal DNA in a staggered fashion. Simultaneously, IN coordinately splices both ends of the vDNA to the resulting phosphodiester bonds on opposite strands of the chromosomal DNA. Following this strand transfer step, the host cell machinery removes the two unpaired nucleotides at the 5&#39; ends of the vDNA and repairs the ensuing single-stranded gaps at the junction of the integration site. The early events thus culminate with the establishment of an integrated DNA copy (provirus) of the HIV-1 genome. The provirus provides a suitable environment for efficient viral gene expression, which initiates later events, including the expression of the virus-encoded proteins; assembly of the immature virus; and budding, release, and maturation into infectious virions13.
Purified recombinant retroviral IN is competent to carry out, in vitro, both 3&#39;-end processing and strand transfer activities on exogenously supplied LTR-like substrate DNA. Biochemical studies using such purified recombinant IN have revealed critical aspects of vDNA integration14,15,16,17. However, unlike in natural infection, this in vitro biochemical reaction does not support concerted integration of both ends of the substrate DNA into the target DNA. In contrast, retroviral PICs isolated from acutely infected cells concertedly integrate both ends of the endogenous vDNA into heterologous target DNA. This led to the widespread adoption and subsequent refinements of In Vitro&#160;Integration (IVI) assays using isolated native PICs.
In the first reported retroviral IVI assay, cytoplasmic extracts from cells infected with a recombinant Murine Leukemia Virus (MLV) harboring the E. coli supF gene in its LTR served as the source of IN activity, and the DNA of a mutant lambda phage defective in lytic growth was exogenously supplied as the target DNA. Successful integration of the recombinant MLV DNA copy into the phage DNA and the ensuing supF expression led to restoration of the plaque-forming ability of the recombinant phages. However, this experimental strategy is laborious and measures integration in an indirect manner. To address such caveats, a Southern blot-based indirect end-labeling assay, which quantifies the PIC-associated IVI activity as a measure of the endogenous vDNA integrated into exogenous linearized bacteriophage phiX174 DNA, was developed6,7,18. Though this method provides a direct measure of integration events, relatively high amounts of PIC preparation are required, which remains a technically challenging endeavor. To circumvent this, nested PCR-based assays requiring only modest amounts of PICs were developed4,5,19.
In this report, we describe an updated version of a nested PCR-based in vitro method devised to recapitulate the HIV-1 PIC-mediated integration activity occurring during natural infection. This method uses the cytoplasmic extracts of HIV-1-infected target cells as a source of endogenous PIC activity, which is measured with a real-time quantitative&#160;Polymerase Chain Reaction (qPCR). The procedures for isolating PICs and measuring their integration activities are adapted, with modifications, from protocols published by the Engelman laboratory20. In this method, the PIC-associated integration activity is initiated by providing an exogenous linear target DNA21, and the DNA products resulting from this integration reaction are purified and used as the starting material for subsequent PCR-based quantification. In the first-round conventional PCR, the viral-target DNA junctions are amplified by using appropriate primers. In the second-round qPCR, LTR-specific primers are used to specifically enrich the vDNA population from the first-round PCR products. Please see the protocol section for a detailed description of this method.
In vitro studies with retroviral PICs have led to significant advances in our understanding of the mechanism of retroviral DNA integration and in the development of IN inhibitors. Based on the recent increased focus on mapping HIV-1 integration sites, determining the role of viral and host factors in HIV-1 integration, and developing new antiviral drugs towards combating drug resistance, we envisage an increased interest in and widespread use of IVI assays, like the one described in this report. This, in turn, will lead to future refinements in the method, thereby diversifying the scope of its applications.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Isolation of HIV-1 PICs
A schematic of the protocol used for the isolation of HIV-1 PICs from acutely infected Sup-T1 cells is depicted in Figure 1. This protocol is derived from the methods described by Engelman et al.19,20. HIV-1 PICs are nucleoprotein complexes that are assembled in infected cells and are comprised of the rev...

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

Research

JoVE Journal

Immunology and Infection

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

In vitro Uncoating of HIV-1 Cores

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...