Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00.000+00:00
Duration: 12 min 29 s
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

We acknowledge the lab of Prof. Joris Winderickx, who provided the UV crosslinking apparatus equipped with the conventional UV lamp. K. G. is supported by the KU Leuven research fund and acknowledges support from FWO grant G065713N.

The authors have nothing to disclose.

We successfully applied mRNA interactome capture, developed for yeast and human cells, to plant leaf mesophyll protoplasts. Leaf mesophyll cells are the major type of ground tissue in plant leaves. The major advantage of this method is that it uses in vivo crosslinking to discover the proteins from a physiological environment.
In this protocol, we mainly present a number of optimized experimental conditions (e.g., the number of protoplasts to use as starting material and the duration of UV irradiation)50. The captured proteins in the CL samples can only be detected by SDS-PAGE and silver staining when a minimum of 107 protoplasts (medium-scale) is used (step 1.5.5). Lower concentrations do not yield an observable mRBP pattern on SDS-PAGE and should probably not be used for further analysis by proteomics. Indeed, using more than 107 cells (e.g., 109 in a large-scale experiment) is also possible20. Results from silver-staining assays suggest that UV irradiation for 1 min with 0.00875 W/cm2 of intensity generated by a continuous-wave UV source is optimal (Figure 1D). High efficiency at the critical step (i.e., mRNP pull-down and purification by oligo-d(T)25 beads, step 4) is supported by the results of the RT-qPCR, silver-staining, and MS assays (Figure 1C; 1D; and 1E, right). The combination of qualitative and quantitative proteomics can help to identify the positive RBPs in the overlap region between non-CL control and CL samples (Figure 1E). The majority of identified proteins were RBPs not previously annotated in datasets (Figure 1F). We presented these previously unknown RNA-binding proteins in category III as candidate RBPs50 (Figure 1F). Exploring the binding specificities of these candidate RBPs must be done using other methods, such as the previously mentioned CLIP methods23. One example that investigates the binding specificity of an RBP to regulate its target mRNA transcript in Arabidopsis through the use of CLIP51 can be found in Zhang et al., 2015. In addition, an alternative modified method from PAR-CLIP, called photoactivatable-ribonucleoside-enhanced crosslinking (PAR-CL, 365-nm UV-A) has also been previously recommended for the investigation of mRNA-bound proteomes from yeast and human cells14,23. PAR-CL requires 4Su, which is taken up by cells and incorporated into nascent RNAs during RNA metabolism and can be highly reactive, forming covalent bonds with amino acids52 under UV-A (365-nm) irradiation. Currently, there are no studies focusing on the toxicity of 4sU to the plant cells and the efficient uptake of exogenous 4sU into mesophyll protoplasts53. However, we believe that it will become possible to use both conventional CL (254-nm UV-C) and PAR-CL (365 nm UV-A) on plants, which will contribute to the discovery and validation of diverse RBPs from the physiological environment in the future.

Eukaryotes use multiple RNA biogenesis regulatory pathways to maintain cellular biological processes. Among the known types of RNA, mRNA is very diverse and carries the coding capacity of proteins and their isoforms1.The PTGR pathway directs the fates of pre-mRNAs2,3. RBPs from different gene families control the regulation of RNA, and in PTGR, specific mRBPs guide mRNAs through direct physical interactions, forming functional mRNPs. Therefore, identifying and characterizing mRBPs and their mRNPs is critical to understanding the regulation of cellular mRNA metabolism2.Over the past three decades, various in vitro methods &#8211; including RNA electrophoretic mobility shift (REMSA) assays, systematic evolution of ligands by exponential enrichment assays (SELEX) based on library-derived constructs, RNA Bind-n-Seq (RBNS), radiolabeled or quantitative fluorescence RNA binding assays, X-ray crystallography, and NMR spectroscopy4,5,6,7,8,9 &#8211; have been widely applied to studies of RBPs, mainly from mammalian cells. The results of these studies of mammalian RBPs can be searched via the RNA-binding Protein DataBase (RBPDB), which collects the published observations10.
Although these in vitro approaches are powerful tools, they determine the bound RNA motifs from a given RNA pool of sequences and therefore are limited in their ability to discover new target RNAs. The same is true for computational strategies to predict genome-wide RBPs, which are based on the conservation of protein sequence and structure15. To overcome this, a new experimental method has been established that allows for the identification of the RNA motifs that an RBP of interest interacts with, as well as for the determination of the precise location of binding. This method, called &#34;crosslinking and immunoprecipitation&#34; (CLIP), is composed of in vivo UV crosslinking followed by immunoprecipitation11. Early studies have shown that photoactivation of DNA and RNA nucleotides can occur at excitation UV wavelengths greater than 245 nm. The reaction through thymidine seems to be favored (rank in order of decreased photoreactivity: dT &#8805; dC &#62; rU &#62; rC, dA, dG)12. Using UV light with a wavelength of 254 nm (UV-C), it was observed that covalent bonds between RNA nucleotides and protein residues are created when in the range of only a few Angstroms (&#197;). The phenomenon is therefore called the &#34;zero-length&#34; crosslinking of RNA and RBP. This can be followed by a stringent purification procedure with little background13,14.
A strategy complementary to CLIP is to combine in vivo UV crosslinking with protein identification to describe the landscape of RBPs. A number of such genome-wide mRNA-bound proteomes have been isolated from yeast cells, embryonic stem cells (ESCs), and human cell lines (i.e., HEK293 and HeLa) using this novel experimental approach, called &#34;mRNA interactome capture&#34;18,19,20,21. The method is composed of in vivo UV crosslinking followed by mRNP purification and MS-based proteomics. By applying this strategy, many novel &#34;moonlighting&#34; RBPs containing non-canonical RBDs have been discovered, and it has become clear that more proteins have RNA-binding capacities than previously supposed15,16,17. The use of this method allows for new applications and for the ability to answer new biological questions when investigating RBPs. For example, a recent study has investigated the conservation of the mRNA-bound proteome (the core RBP proteome) between yeast and human cells22.
Plant RBPs have already been found to be involved in growth and development (e.g., in the post-transcriptional regulation of flowering time, the circadian clock, and gene expression in mitochondria and chloroplasts)24,25,26,27,28,29. Furthermore, they are thought to perform functions in the cellular processes responding to abiotic stresses (e.g., cold, drought, salinity, and abscisic acid (ABA))31,32,33,34. There are more than 200 predicted RBP genes in the Arabidopsis thaliana genome, based on RNA recognition motif (RRM) and K homology (KH) domain sequence motifs; in rice, approximately 250 have been noted35,36. It is notable that many predicted RBPs seem to be unique to plants (e.g., no metazoan orthologs to approximately 50% of predicted Arabidopsis RBPs containing an RRM domain)35, suggesting that many may serve new functions. The functions of most predicted RBPs remain uncharacterized23.
The isolation of mRNA-bound proteomes from Arabidopsis etiolated seedlings, leaf tissue, cultured root cells, and leaf mesophyll protoplasts through the use of mRNA interactome capture has recently been reported38,39. These studies demonstrate the strong potential of systematically cataloging functional RBPs in plants in the near future. Here, we present a protocol for mRNA interactome capture from plant protoplasts (i.e., cells without cell walls). Arabidopsis thaliana leaf mesophyll protoplasts are the major type of leaf cell. The isolated protoplasts allow optimal access of UV light to the cells. This cell type can be used in assays that transiently express proteins for functional characterization40,41. Furthermore, protoplasting has been applied to several other plant cell types and species42,43,44 (e.g., Petersson et al., 2009; Bargmann and Birnbaum, 2010; and Hong et al., 2012).
The method encompasses a total of 11 steps (Figure 1A). Arabidopsis leaf mesophyll protoplasts are first isolated (step 1) and are subsequently UV irradiated to form crosslinked mRNPs (step 2). When protoplasts are lysed under denaturing conditions (step 3), the crosslinked mRNPs are released in lysis/binding buffer and pulled down by oligo-d(T)25 beads (step 4). After several rounds of stringent washes, the mRNPs are purified and further analyzed. The denatured peptides of mRBPs are digested by proteinase K before the crosslinked mRNAs are purified and the RNA quality is verified by qRT-PCR (steps 5 and 6). After RNase treatment and protein concentration (step 7), the protein quality is controlled by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and silver staining (step 8). The difference in protein band patterns can easily be visualized between a crosslinked sample (CL) and a non-crosslinked sample (non-CL; the negative control sample from protoplasts that is not subjected to UV irradiation). The identification of proteins is achieved through MS-based proteomics. The proteins from the CL sample are separated by one-dimensional polyacrylamide gel electrophoresis (1D-PAGE) to remove possible background contamination, are &#34;in-gel digested&#34; into short peptides using trypsin, and are purified (step 9). Nano reverse-phase liquid chromatography coupled to mass spectrometry (nano-LC-MS) allows for the determination of the amount of definitive proteins in the mRNA-bound proteome (step 10). Finally, the identified mRBPs are characterized and cataloged using bioinformatic analysis (step 11).

<table><tbody><tr><td>&lt;strong&gt;REAGENTS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.8 M Mannitol</td><td>Sigma</td><td>M1902-500G</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; MMg solution</td></tr><tr><td>2 M KCl</td><td>MERCK</td><td>Art. 4935</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; W5 buffer</td></tr><tr><td>0.2 M MES (pH 5.7)&lt;br/&gt; (4-morpholineethanesulfonic acid)</td><td>Sigma-aldrich</td><td>M2933</td><td>Primary isotonic Enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; MMg solution,&lt;br/&gt; Filtration sterilization</td></tr><tr><td>Cellulase R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>CELLULASE&lt;br/&gt; &amp;ldquo;ONOZUKA&amp;rdquo;&lt;br/&gt; R-10, 10 g</td><td>Final isotonic enzyme solution</td></tr><tr><td>Macerozyme R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>MACEROZYME R-10, 10g</td><td>Final isotonic enzyme solution</td></tr><tr><td>10% (&lt;em&gt;w/v&lt;/em&gt;) BSA&lt;br/&gt; (Bovine Serum Albumin)</td><td>Sigma-aldrich</td><td>A7906-100G</td><td>Final isotonic enzyme solution &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Chem-Lab NV</td><td>CL00.0317.1000</td><td>Final isotonic enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>1 M NaCl</td><td>Fisher Chemical</td><td>S/3160/60</td><td>W5 buffer</td></tr><tr><td>2 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M8266-100G</td><td>MMg solution</td></tr><tr><td>1 M LiCl&lt;br/&gt; (Lithium Chloride)</td><td>Acros</td><td>199885000</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2 &amp;amp;&lt;br/&gt; Low salt buffer</td></tr><tr><td>5% (&lt;em&gt;w/v&lt;/em&gt;) LiDS&lt;br/&gt; (Lithium Dodecyl Sulphate)</td><td>Sigma-aldrich</td><td>L4632-25G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M DTT&lt;br/&gt; (Dithiothreitol)</td><td>Thermo Fisher Scientific&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Wash buffer 2</td><td>307866</td><td>Lysis/binding buffer,</td></tr><tr><td>1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td><td>Acros &amp;amp;&lt;br/&gt; Fisher Chemical</td><td>167620010 &amp;amp;&lt;br/&gt; H/1200/PB15</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td><td>Sigma-aldrich</td><td>ED-500G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>Tween 20</td><td>MERCK</td><td>8.22184.0500</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>0.1 M NaOH</td><td>VWR PROLABO CHEMICALS</td><td>28244.295</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>1x PBS (pH 7.4)&lt;br/&gt; (Phosphate Buffered Saline)&lt;br/&gt; containing&lt;br/&gt; (NaCl; KCl; Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;; KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Fisher Chemical, MERCK,&lt;br/&gt; Sigma-aldrich &amp;amp; SAFC</td><td>S/3160/60,&lt;br/&gt; Art. 4935,&lt;br/&gt; 71640-250G &amp;amp;&lt;br/&gt; 60230</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>Proteinase K solution (2 &amp;mu;g/&amp;mu;L)</td><td>Thermo Fisher Scientific</td><td>11789020</td><td>Protein digestion</td></tr><tr><td>Loading dye</td><td>Invitrogen</td><td>LC5925</td><td>SDS-PAGE</td></tr><tr><td>qPCR master mix</td><td>Promega</td><td>A6001</td><td>qRT-PCR assay</td></tr><tr><td>RNase Cocktail</td><td>Thermo Fisher Scientific</td><td>AM2286</td><td>RNA digestion</td></tr><tr><td>Methanol</td><td>Sigma-aldrich</td><td>322415</td><td>Gel fixation and gel destaining</td></tr><tr><td>Acetic acid</td><td>Sigma-aldrich</td><td>537020</td><td>Gel fixation and gel destaining</td></tr><tr><td>Coomassie Brilliant Blue R-250</td><td>Thermo Fisher Scientific</td><td>20278</td><td>Gel staining</td></tr><tr><td>1 M NH&lt;sub&gt;4&lt;/sub&gt;HCO&lt;sub&gt;3&lt;/sub&gt;&lt;br/&gt; (Ammonium bicarbonate)&lt;br/&gt; &amp;nbsp;</td><td>Sigma-aldrich</td><td>09830-500G</td><td>Gel hydration &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>CH&lt;sub&gt;3&lt;/sub&gt;CN&lt;br/&gt; (Acetonitrile)</td><td>Sigma-aldrich</td><td>34851-100ML</td><td>Gel dehydration &amp;amp;&lt;br/&gt; Peptide dissolving solution</td></tr><tr><td>IAA&lt;br/&gt; (Iodoacetic acid)</td><td>Sigma-aldrich</td><td>I4386-10G</td><td>Alkylating agent</td></tr><tr><td>TFA&lt;br/&gt; (Trifluoroacetic acid)</td><td>Sigma-aldrich</td><td>302031-10X1ML</td><td>Peptide dissolving solution</td></tr><tr><td>FA&lt;br/&gt; (Formic acid)</td><td>Sigma-aldrich</td><td>06554-5G</td><td>Peptide extraction</td></tr><tr><td>Trypsin solution (6 ng/&amp;mu;L)</td><td>Promega</td><td>V5280</td><td>Digestion buffer</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Soil</td><td>Peltracom</td><td>LP2D</td><td>Plant growth</td></tr><tr><td>Vermiculite 3</td><td>Sibli AS</td><td>05VERMICULIET</td><td>Plant growth</td></tr><tr><td>Petri dish (150 x 20 mm)</td><td>Sarstedt</td><td>82.1184.500</td><td>Carrier for protoplast suspension</td></tr><tr><td>0.22 &amp;mu;m filter</td><td>Millipore</td><td>SE2M229104</td><td>Homogenization of final isotonic enzyme solution</td></tr><tr><td>Razorblade</td><td>Agar Scientific</td><td>T585</td><td>Rosette leaf strips</td></tr><tr><td>35-75 &amp;mu;m nylon mesh</td><td>SEFAR NITEX</td><td>74010</td><td>Protoplast suspension filtration</td></tr><tr><td>50 mL round bottom tubes</td><td>Sigma-aldrich</td><td>T1918-10EA</td><td>Carrier for protoplast suspension</td></tr><tr><td>Hemocytometer&lt;br/&gt; (B&amp;uuml;rker hemocytometer)</td><td>MARIENFELD</td><td>650030</td><td>Protoplast cell counting</td></tr><tr><td>UV crosslinking apparatus&lt;br/&gt; (HL-2000 HybriLinker)</td><td>UVP, LLC</td><td>UVP95003101</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>UV lamp&lt;br/&gt; (Sankyo-Denki G8T5)</td><td>SANKYO&lt;br/&gt; DENKI</td><td>SD G8T5</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>50 mL glass syringe</td><td>FORTUNA Optima</td><td>Z314560</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Narrow needle (0.9 x 25 mm)</td><td>Becton Dickinson microlance 3</td><td>2021-04</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Rotator Model L26</td><td>Labinco BV</td><td>26110912</td><td>Sample incubation by rotating</td></tr><tr><td>Oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; magnetic beads&lt;br/&gt; (5 mg/mL)</td><td>New England BioLabs</td><td>S1419S</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>CS15000</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Centrifugal filter units&lt;br/&gt; (Amicon Ultra-4 centrifugal filter units)</td><td>EMD Millipore</td><td>UFC800308</td><td>mRBP concentration</td></tr><tr><td>Pierce Silver Stain Kit</td><td>Thermo Fisher Scientific</td><td>24612</td><td>Silver-staining assay</td></tr><tr><td>RNA purification kit&lt;br/&gt; (InviTrap Spin Plant RNA Mini Kit)</td><td>STRATEC Molecular</td><td>1064100300</td><td>RNA purification</td></tr><tr><td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td><td>Thermo Fisher Scientific</td><td>ND-1000</td><td>RNA quality and quantity</td></tr><tr><td>Real-Time PCR cycler&lt;br/&gt; (StepOne Real-Time PCR cycler)</td><td>Thermo Fisher Scientific</td><td>4376600</td><td>cDNA quantification</td></tr><tr><td>&amp;micro;-C18 columns&lt;br/&gt; (Millipore Zip Tip &amp;micro;-C18 columns)</td><td>Sigma-aldrich</td><td>720046-960EA</td><td>Peptide purification</td></tr><tr><td>Mass spectrometer&lt;br/&gt; (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td><td>Thermo Fisher Scientific</td><td>IQLAAEGAAPFALGMAZR</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td><td>Thermo Fisher Scientific</td><td>ULTIM3000RSLCNANO</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 column&lt;br/&gt; (Easy Spray Pepmap RSLC C18 column)</td><td>Thermo Fisher Scientific</td><td>ES800</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 precolumn&lt;br/&gt; (Acclaim Pepmap 100 C18 precolumn)</td><td>Thermo Fisher Scientific</td><td>160321</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Primers for qRT-PCR assay&lt;/strong&gt;</td><td>&lt;strong&gt;Sequences&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>&lt;em&gt;UBQ10&lt;/em&gt; mRNA&lt;br/&gt; (Li &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: AACTTTGGTGGTTTGTGTTTTGG&lt;br/&gt; Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td><td></td><td></td></tr><tr><td>18S rRNA&lt;br/&gt; (Durut &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: CGTAGTTGAACCTTGGGATG&lt;br/&gt; Rv: CACGACCCGGCCAATTA</td><td></td><td></td></tr></tbody></table>

mrna interactome capture from plant protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

We observed a characteristic halo, which surrounds the bead pellet in the CL sample, in wash step 4.3 with wash buffer 2 (Figure 1B). Although it has not been investigated, this phenomenon can probably be explained by the interference of crosslinked mRNP complexes with bead aggregation during the magnetic capture, causing a more diffuse aggregate to form. It indicates that the oligo-d(T)25 bead capture was effective14.
The significantly higher UBQ10 reference mRNA levels than 18S rRNA in both non-CL control and CL samples are shown in Figure 1C. This indicates that mRNAs are enriched in the eluent due to the capture by oligo-d(T)25 beads, which can only bind to poly(A)-tailed mRNAs. The efficiency of the oligo-d(T)25 bead capture was further supported by SDS-PAGE and silver staining (step 8), as shown in Figure 1D after RNase treatment and mRBP concentration (step 7). A difference in protein band pattern between non-CL control and CL sample lanes can clearly be observed, and the protein bands present in the non-CL control sample lane can be explained by the presence of RNase. This illustrates the strong enrichment of mRBPs in the CL sample.
The efficiency of crosslinking can be controlled by varying the time duration of UV irradiation. Sufficient crosslinking but the avoidance of protoplast damage and RNA degradation is optimal. In Figure 1D, specific protein band patterns in all CL samples were obtained when comparing different UV irradiation times (1, 3, and 5 min). Under the same UV intensity (0.00875 W/cm2), the most optimal conditions were found to be 1 or 3 min, due to the indistinguishable protein band intensities. Weaker band intensities were observed with the longer crosslinking time (5 min). We considered 1 min as the optimal condition because a shorter duration of crosslinking has the additional advantage of easier transfer and collection of protoplasts from the Petri dish. Protoplasts can be rapidly precipitated to the bottom of the Petri dish during UV irradiation because they stick to the dish bottom. This makes it more difficult to collect and transfer them to the tubes after longer UV irradiation duration.
Based on the optimized conditions, the identification of proteins from three biological replicates was subsequently achieved by qualitative and quantitative proteomics, which was described in steps 9 and 10. In the analysis by qualitative proteomics (Figure 1E, right), a total of 341 proteins were identified in CL samples, of which 36 were found both in non-CL control and CL samples, and only 8 proteins were detected in the non-CL control sample. This enormous difference in identified protein numbers between both samples is consistent with the different protein band patterns (Figure 1D), supporting the idea that the SDS-PAGE and silver-staining assay are good tools to validate the efficiency of oligo-d(T)25 bead capture. In the analysis by quantitative proteomics (Figure 1E, left), a total of 325 proteins (blue- and green-colored) showed a log2-fold change greater than 2. Among these proteins, 100 proteins (blue-colored) had small p-values above the significance level. Therefore, they were also defined as positive hits. It is notable that the p-values of another 225 proteins (green-colored) were greater than 0.05, below the significance level due to data sparsity. In other words, there were lowly abundant peptides present for each protein, with high variability of peptide intensities. However, because all of them were qualitatively detected only in CL samples, they were considered positive.
Based on the GO and InterPro databases50 (step 11), these 325 proteins were further classified into category I (ribosomal proteins), category II (main RBPs), and category III (candidate RBPs) (Figure 1F). There were 123 ribosomal proteins in category I, while in category II, 70 annotated classical RBPs were observed. These two categories&#8212;which contain most annotated proteins linking to molecular RNA binding and RNA biology (Figure 1F, right) and which occupy approximately 38% and 22% of the whole mRNA-bound proteome, respectively&#8212;indicate the high efficiency of optimized mRNA interactome capture. The last 40% (132 candidate RBPs) were classified in category III due to the lack of conventional RBDs. Furthermore, most of their roles in RNA binding and RNA biological processes have not been validated (Figure 1F, left). We suppose that proteins from this category could reveal novel functions in RNA regulations.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56011/56011fig1.jpg" /> 
Figure 1: Flowchart and Results of the Optimized Method for Discovering the mRNA-bound Proteome from Arabidopsis Leaf Mesophyll Protoplasts. (A) Major steps of the whole method are listed from 1 to 11. Putative cellular and molecular processes are illustrated by the photo and cartoons. Details for each step have been intensively described in the Protocol. (B) A halo was observed surrounding the beads pellet in the CL sample, but not in the non-CL control sample, during wash step 4.3. (C) Comparison of relative UBQ10 mRNA and 18S rRNA levels in non-CL control and CL samples by qRT-PCR (values are mean &#177; SD (n = 3); * and **: significant differences with p &#60;0.05 and &#60;0.01). (D) Concentrated protein eluent of non-CL control sample compared with CL samples irradiated by a continuous-wave UV source for 1, 3, and 5 min, with the UV intensity at 0.00875 W/cm2. (E) Identification of mRNA-bound proteome by proteomics. In the quantitative proteomics performed by the Progenesis software package (left), the volcano plot displays the average log2-fold changes (CL/non-CL) and the related adjusted p-values (-log10 (adj. p-values)) of all proteins. In the qualitative proteomics performed by the Peaks software package (right), the proteins in the samples are illustrated in Venn diagrams. The quantity of the proteins is listed in numbers. The FDR at the peptide and protein levels is below 5%. The numbers of proteins inside the light-brown frames are considered positive hits. (F) Classification of three categories from the mRNA-bound proteome. The quantity of identified proteins is listed in numbers in each category. Green-colored regions are annotated proteins linked to RNA binding, while blue-colored regions refer to annotated proteins linked to RNA biology. The blank region indicates proteins with unknown functions linked to RNA binding or RNA biology. All figures above were modified from Zhang et al., 2016. <a href="http://cloudflare.jove.com/files/ftp_upload/56011/56011fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Nanyang Technological University

Research

JoVE Journal

Biochemistry

9.0K Views.  KU Leuven. Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

Video: mRNA Interactome Capture from Plant Protoplasts

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Genetics

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Biology

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome affinity purification (TRAP) method and consecutive optimized low-input library preparation.
As starting material, we employ plant lines that express GFP-tagged ribosomal protein RPL18 in a cell type-specific manner by use of adequate promoters. Prior to immunopurification and RNA extraction, the tissue is snap frozen, which preserves tissue integrity and simultaneously allows execution of time series studies with high temporal resolution. Notably, cell wall structures remain intact, which is a major drawback in alternative procedures such as fluorescence-activated cell sorting-based approaches that rely on tissue protoplasting to isolate distinct cell populations. Additionally, no tissue fixation is necessary as in laser capture microdissection-based techniques, which allows high-quality RNA to be obtained.
However, sampling from subpopulations of cells and only isolating polysome-associated RNA severely limits RNA yields. It is, therefore, necessary to apply sufficiently sensitive library preparation methods for successful data acquisition by RNA-seq.
TRAP offers an ideal tool for plant research as many developmental processes involve cell wall-related and mechanical signaling pathways. The use of promoters to target specific cell populations is bridging the gap between organ and single-cell level that in turn suffer from little resolution or very high costs. Here, we apply TRAP to study cell-cell communication in lateral root formation.

Translating Ribosome Affinity Purification TRAP to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Translating ribosome affinity purification (TRAP) offers the possibility to dissect developmental programs with minimal processing of organs and tissues. The protocol yields high-quality RNA from cells targeted with a green fluorescent protein (GFP)-labeled ribosomal subunit. Downstream analysis tools, such as qRT-PCR or RNA-seq, reveal tissue and cell type-specific expression profiles.

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome ...

Developmental Biology

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been successfully used for identification of protein-protein interactions (PPIs) in mammalian cells. However, requirements of toxic hydrogen peroxide (H2O2) in APEX-based PL, longer incubation time with biotin (16&#8211;24 h), and higher incubation temperature (37 &#176;C) in BioID-based PL severely limit their applications in plants. The recently described TurboID-based PL addresses many limitations of BioID and APEX. TurboID allows rapid proximity labeling of proteins in just 10&#8201;min under room temperature (RT) conditions. Although the utility of TurboID has been demonstrated in animal models, we recently showed that TurboID-based PL performs better in plants compared to BioID for labeling of proteins that are proximal to a protein of interest. Provided here is a step-by-step protocol for the identification of protein interaction partners using the N-terminal Toll/interleukin-1 receptor (TIR) domain of the nucleotide-binding leucine-rich repeat (NLR) protein family as a model. The method describes vector construction, agroinfiltration of protein expression constructs, biotin treatment, protein extraction and desalting, quantification, and enrichment of the biotinylated proteins by affinity purification. The protocol described here can be easily adapted to study other proteins of interest in Nicotiana and other plant species.

Described here is a proximity labeling method for identification of interaction partners of the TIR domain of the NLR immune receptor in Nicotiana benthamiana leaf tissue. Also provided is a detailed protocol for the identification of interactions between other proteins of interest using this technique in Nicotiana and other plant species.

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been ...

Immunology and Infection

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Protein-protein Interactions Visualized by Bimolecular Fluorescence Complementation in Tobacco Protoplasts and Leaves

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular fluorescence complementation (BiFC) is an in vivo method to monitor such interactions in plant cells. In the presented protocol the investigated candidate proteins are fused to complementary halves of fluorescent proteins and the respective constructs are introduced into plant cells via agrobacterium-mediated transformation. Subsequently, the proteins are transiently expressed in tobacco leaves and the restored fluorescent signals can be detected with a confocal laser scanning microscope in the intact cells. This allows not only visualization of the interaction itself, but also the subcellular localization of the protein complexes can be determined. For this purpose, marker genes containing a fluorescent tag can be coexpressed along with the BiFC constructs, thus visualizing cellular structures such as the endoplasmic reticulum, mitochondria, the Golgi apparatus or the plasma membrane. The fluorescent signal can be monitored either directly in epidermal leaf cells or in single protoplasts, which can be easily isolated from the transformed tobacco leaves. BiFC is ideally suited to study protein-protein interactions in their natural surroundings within the living cell. However, it has to be considered that the expression has to be driven by strong promoters and that the interaction partners are modified due to fusion of the relatively large fluorescence tags, which might interfere with the interaction mechanism. Nevertheless, BiFC is an excellent complementary approach to other commonly applied methods investigating protein-protein interactions, such as coimmunoprecipitation, in vitro pull-down assays or yeast-two-hybrid experiments.

Formation of protein complexes in vivo can be visualized by bimolecular fluorescence complementation. Interaction partners are fused to complementary parts of fluorescent tags and transiently expressed in tobacco leaves, resulting in a reconstituted fluorescent signal upon close proximity of the two proteins.

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel protein-protein interaction pairs and monitoring protein interaction dynamics are of particular interest for revealing how plants respond to environmental factors and/or developmental signals. A plethora of approaches have been developed to examine protein-protein interactions, either in vitro or in vivo. Among them, the recently established luciferase complementation imaging (LCI) assay is the simplest and fastest method for demonstrating in vivo protein-protein interactions. In this assay, protein A or protein B is fused with the amino-terminal or carboxyl-terminal half of luciferase, respectively. When protein A interacts with protein B, the two halves of luciferase will be reconstituted to form a functional and active luciferase enzyme. Luciferase activity can be recorded with a luminometer or CCD-camera. Compared with other approaches, the LCI assay shows protein-protein interactions both qualitatively and quantitatively. Agrobacterium infiltration in Nicotiana benthamiana leaves is a widely used system for transient protein expression. With the combination of LCI and transient expression, these approaches show that the physical interaction between COP1 and SPA1 was gradually reduced after jasmonate treatment.

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

This manuscript describes an easy and rapid experimental procedure for determining protein-protein interactions based on the measurement of luciferase activity.

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...

mRNA Interactome Capture from Plant Protoplasts

Summary

Explore More Videos

Chapters in this video

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Fluorescence Activated Cell Sorting of Plant Protoplasts

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Identification of Post-translational Modifications of Plant Protein Complexes

Protein-protein Interactions Visualized by Bimolecular Fluorescence Complementation in Tobacco Protoplasts and Leaves

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics