Name: mrna interactome capture from plant protoplasts
Uploaded: 2017-07-28T13:00:00
Description: Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

We acknowledge the lab of Prof. Joris Winderickx, who provided the UV crosslinking apparatus equipped with the conventional UV lamp. K. G. is supported by the KU Leuven research fund and acknowledges support from FWO grant G065713N.

1. Arabidopsis Leaf Mesophyll Protoplast Isolation
NOTE: Arabidopsis leaf mesophyll protoplasts are essentially isolated as described by Yoo et al., 2007, with several modifications40.
<ol>
	<li>Growth of plants
	<ol>
		<li>Soak approximately 200 Arabidopsis thaliana Col-0 ecotype seeds in sterilized water for 2 days at 4 &#176;C in darkness for stratification. 
		NOTE: This number of seeds is enough for one no...

We successfully applied mRNA interactome capture, developed for yeast and human cells, to plant leaf mesophyll protoplasts. Leaf mesophyll cells are the major type of ground tissue in plant leaves. The major advantage of this method is that it uses in vivo crosslinking to discover the proteins from a physiological environment.
In this protocol, we mainly present a number of optimized experimental conditions (e.g., the number of protoplasts to use as starting material and the ...

Eukaryotes use multiple RNA biogenesis regulatory pathways to maintain cellular biological processes. Among the known types of RNA, mRNA is very diverse and carries the coding capacity of proteins and their isoforms1.The PTGR pathway directs the fates of pre-mRNAs2,3. RBPs from different gene families control the regulation of RNA, and in PTGR, specific mRBPs guide mRNAs through direct physical interactions, forming functional mRNPs. Therefore, identifying and characterizing mRBPs and their mRNPs is critical to understanding the regulation of cellular mRNA metabolism2.Over the past three decades, various in vitro methods &#8211; including RNA electrophoretic mobility shift (REMSA) assays, systematic evolution of ligands by exponential enrichment assays (SELEX) based on library-derived constructs, RNA Bind-n-Seq (RBNS), radiolabeled or quantitative fluorescence RNA binding assays, X-ray crystallography, and NMR spectroscopy4,5,6,7,8,9 &#8211; have been widely applied to studies of RBPs, mainly from mammalian cells. The results of these studies of mammalian RBPs can be searched via the RNA-binding Protein DataBase (RBPDB), which collects the published observations10.
Although these in vitro approaches are powerful tools, they determine the bound RNA motifs from a given RNA pool of sequences and therefore are limited in their ability to discover new target RNAs. The same is true for computational strategies to predict genome-wide RBPs, which are based on the conservation of protein sequence and structure15. To overcome this, a new experimental method has been established that allows for the identification of the RNA motifs that an RBP of interest interacts with, as well as for the determination of the precise location of binding. This method, called &#34;crosslinking and immunoprecipitation&#34; (CLIP), is composed of in vivo UV crosslinking followed by immunoprecipitation11. Early studies have shown that photoactivation of DNA and RNA nucleotides can occur at excitation UV wavelengths greater than 245 nm. The reaction through thymidine seems to be favored (rank in order of decreased photoreactivity: dT &#8805; dC &#62; rU &#62; rC, dA, dG)12. Using UV light with a wavelength of 254 nm (UV-C), it was observed that covalent bonds between RNA nucleotides and protein residues are created when in the range of only a few Angstroms (&#197;). The phenomenon is therefore called the &#34;zero-length&#34; crosslinking of RNA and RBP. This can be followed by a stringent purification procedure with little background13,14.
A strategy complementary to CLIP is to combine in vivo UV crosslinking with protein identification to describe the landscape of RBPs. A number of such genome-wide mRNA-bound proteomes have been isolated from yeast cells, embryonic stem cells (ESCs), and human cell lines (i.e., HEK293 and HeLa) using this novel experimental approach, called &#34;mRNA interactome capture&#34;18,19,20,21. The method is composed of in vivo UV crosslinking followed by mRNP purification and MS-based proteomics. By applying this strategy, many novel &#34;moonlighting&#34; RBPs containing non-canonical RBDs have been discovered, and it has become clear that more proteins have RNA-binding capacities than previously supposed15,16,17. The use of this method allows for new applications and for the ability to answer new biological questions when investigating RBPs. For example, a recent study has investigated the conservation of the mRNA-bound proteome (the core RBP proteome) between yeast and human cells22.
Plant RBPs have already been found to be involved in growth and development (e.g., in the post-transcriptional regulation of flowering time, the circadian clock, and gene expression in mitochondria and chloroplasts)24,25,26,27,28,29. Furthermore, they are thought to perform functions in the cellular processes responding to abiotic stresses (e.g., cold, drought, salinity, and abscisic acid (ABA))31,32,33,34. There are more than 200 predicted RBP genes in the Arabidopsis thaliana genome, based on RNA recognition motif (RRM) and K homology (KH) domain sequence motifs; in rice, approximately 250 have been noted35,36. It is notable that many predicted RBPs seem to be unique to plants (e.g., no metazoan orthologs to approximately 50% of predicted Arabidopsis RBPs containing an RRM domain)35, suggesting that many may serve new functions. The functions of most predicted RBPs remain uncharacterized23.
The isolation of mRNA-bound proteomes from Arabidopsis etiolated seedlings, leaf tissue, cultured root cells, and leaf mesophyll protoplasts through the use of mRNA interactome capture has recently been reported38,39. These studies demonstrate the strong potential of systematically cataloging functional RBPs in plants in the near future. Here, we present a protocol for mRNA interactome capture from plant protoplasts (i.e., cells without cell walls). Arabidopsis thaliana leaf mesophyll protoplasts are the major type of leaf cell. The isolated protoplasts allow optimal access of UV light to the cells. This cell type can be used in assays that transiently express proteins for functional characterization40,41. Furthermore, protoplasting has been applied to several other plant cell types and species42,43,44 (e.g., Petersson et al., 2009; Bargmann and Birnbaum, 2010; and Hong et al., 2012).
The method encompasses a total of 11 steps (Figure 1A). Arabidopsis leaf mesophyll protoplasts are first isolated (step 1) and are subsequently UV irradiated to form crosslinked mRNPs (step 2). When protoplasts are lysed under denaturing conditions (step 3), the crosslinked mRNPs are released in lysis/binding buffer and pulled down by oligo-d(T)25 beads (step 4). After several rounds of stringent washes, the mRNPs are purified and further analyzed. The denatured peptides of mRBPs are digested by proteinase K before the crosslinked mRNAs are purified and the RNA quality is verified by qRT-PCR (steps 5 and 6). After RNase treatment and protein concentration (step 7), the protein quality is controlled by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and silver staining (step 8). The difference in protein band patterns can easily be visualized between a crosslinked sample (CL) and a non-crosslinked sample (non-CL; the negative control sample from protoplasts that is not subjected to UV irradiation). The identification of proteins is achieved through MS-based proteomics. The proteins from the CL sample are separated by one-dimensional polyacrylamide gel electrophoresis (1D-PAGE) to remove possible background contamination, are &#34;in-gel digested&#34; into short peptides using trypsin, and are purified (step 9). Nano reverse-phase liquid chromatography coupled to mass spectrometry (nano-LC-MS) allows for the determination of the amount of definitive proteins in the mRNA-bound proteome (step 10). Finally, the identified mRBPs are characterized and cataloged using bioinformatic analysis (step 11).

<table>
	<tbody>
		<tr>
			<td colspan="4">REAGENTS</td>
		</tr>
		<tr>
			<td>0.8 M Mannitol</td>
			<td>Sigma</td>
			<td>M1902-500G</td>
			<td>Primary isotonic Enzyme solution &#38; 
			MMg solution</td>
		</tr>
		<tr>
			<td>2M KCl</td>
			<td>MERCK</td>
			<td>Art. 4935</td>
			<td>Primary isotonic Enzyme solution &#38; 
			W5 buffer</td>
		</tr>
		<tr>
			<td>0.2 M MES (pH 5.7) 
			(4-morpholineethanesulfonic acid)</td>
			<td>Sigma-aldrich</td>
			<td>M2933</td>
			<td>Primary isotonic Enzyme solution, 
			W5 buffer &#38; 
			MMg solution, 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>Cellulase R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>CELLULASE 
			&#8220;ONOZUKA&#8221; 
			R-10, 10 g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Macerozyme R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>MACEROZYME R-10, 10g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>10% (w/v) BSA 
			(Bovine Serum Albumin)</td>
			<td>Sigma-aldrich</td>
			<td>A7906-100G</td>
			<td>Final isotonic enzyme solution &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M CaCl2</td>
			<td>Chem-Lab NV</td>
			<td>CL00.0317.1000</td>
			<td>Final isotonic enzyme solution, 
			W5 buffer &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>1M NaCl</td>
			<td>Fisher Chemical</td>
			<td>S/3160/60</td>
			<td>W5 buffer</td>
		</tr>
		<tr>
			<td>2M MgCl2</td>
			<td>Sigma</td>
			<td>M8266-100G</td>
			<td>MMg solution</td>
		</tr>
		<tr>
			<td>1M LiCl 
			(Lithium Chloride)</td>
			<td>Acros</td>
			<td>199885000</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2 &#38; 
			Low salt buffer</td>
		</tr>
		<tr>
			<td>5% (w/v) LiDS 
			(Lithium Dodecyl Sulphate)</td>
			<td>Sigma-aldrich</td>
			<td>L4632-25G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1 &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M DTT 
			(Dithiothreitol)</td>
			<td>Thermo Fisher Scientific 
			Wash buffer 1 &#38; 
			Wash buffer 2</td>
			<td>307866</td>
			<td>Lysis/binding buffer,</td>
		</tr>
		<tr>
			<td>1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td>
			<td>Acros &#38; 
			Fisher Chemical</td>
			<td>167620010 &#38; 
			H/1200/PB15</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>ED-500G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>MERCK</td>
			<td>8.22184.0500</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>0.1 M NaOH</td>
			<td>VWR PROLABO CHEMICALS</td>
			<td>28244.295</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>1X PBS (pH 7.4) 
			(Phosphate Buffered Saline) 
			containing 
			(NaCl; KCl; Na2HPO4; KH2PO4)</td>
			<td>Fisher Chemical, MERCK, 
			Sigma-aldrich &#38; SAFC</td>
			<td>S/3160/60, 
			Art. 4935, 
			71640-250G &#38; 
			60230</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>Proteinase K solution (2 &#956;g/&#956;L)</td>
			<td>Thermo Fisher Scientific</td>
			<td>11789020</td>
			<td>Protein digestion</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>Invitrogen</td>
			<td>LC5925</td>
			<td>SDS-PAGE</td>
		</tr>
		<tr>
			<td>qPCR master mix</td>
			<td>Promega</td>
			<td>A6001</td>
			<td>qRT-PCR assay</td>
		</tr>
		<tr>
			<td>RNase Cocktail</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td>RNA digestion</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Sigma-aldrich</td>
			<td>322415</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Sigma-aldrich</td>
			<td>537020</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Coomassie Brilliant Blue R-250</td>
			<td>Thermo Fisher Scientific</td>
			<td>20278</td>
			<td>Gel staining</td>
		</tr>
		<tr>
			<td>1M NH4HCO3 
			(Ammonium bicarbonate) 
			&#160;</td>
			<td>Sigma-aldrich</td>
			<td>09830-500G</td>
			<td>Gel hydration &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>CH3CN 
			(Acetonitrile)</td>
			<td>Sigma-aldrich</td>
			<td>34851-100ML</td>
			<td>Gel dehydration &#38; 
			Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>IAA 
			(Iodoacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>I4386-10G</td>
			<td>Alkylating agent</td>
		</tr>
		<tr>
			<td>TFA 
			(Trifluoroacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>302031-10X1ML</td>
			<td>Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>FA 
			(Formic acid)</td>
			<td>Sigma-aldrich</td>
			<td>06554-5G</td>
			<td>Peptide extraction</td>
		</tr>
		<tr>
			<td>Trypsin solution (6 ng/&#956;L)</td>
			<td>Promega</td>
			<td>V5280</td>
			<td>Digestion buffer</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td colspan="4">EQUIPMENT</td>
		</tr>
		<tr>
			<td>Soil</td>
			<td>Peltracom</td>
			<td>LP2D</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Vermiculite 3</td>
			<td>Sibli AS</td>
			<td>05VERMICULIET</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Petri dish (150 x 20 mm)</td>
			<td>Sarstedt</td>
			<td>82.1184.500</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Millipore</td>
			<td>SE2M229104</td>
			<td>Homogenization of final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Razorblade</td>
			<td>Agar Scientific</td>
			<td>T585</td>
			<td>Rosette leaf strips</td>
		</tr>
		<tr>
			<td>35-75 &#956;m nylon mesh</td>
			<td>SEFAR NITEX</td>
			<td>74010</td>
			<td>Protoplast suspension filtration</td>
		</tr>
		<tr>
			<td>50 mL round bottom tubes</td>
			<td>Sigma-aldrich</td>
			<td>T1918-10EA</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>Hemocytometer 
			(B&#252;rker hemocytometer)</td>
			<td>MARIENFELD</td>
			<td>650030</td>
			<td>Protoplast cell counting</td>
		</tr>
		<tr>
			<td>UV crosslinking apparatus 
			(HL-2000 HybriLinker)</td>
			<td>UVP, LLC</td>
			<td>UVP95003101</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>UV lamp 
			(Sankyo-Denki G8T5)</td>
			<td>SANKYO 
			DENKI</td>
			<td>SD G8T5</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>50 mL glass syringe</td>
			<td>FORTUNA Optima</td>
			<td>Z314560</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Narrow needle (0.9 x 25 mm)</td>
			<td>Becton Dickinson microlance 3</td>
			<td>2021-04</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Rotator Model L26</td>
			<td>Labinco BV</td>
			<td>26110912</td>
			<td>Sample incubation by rotating</td>
		</tr>
		<tr>
			<td>Oligo-d(T)25 magnetic beads 
			(5 mg/mL)</td>
			<td>New England BioLabs</td>
			<td>S1419S</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>CS15000</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Centrifugal filter units 
			(Amicon Ultra-4 centrifugal filter units)</td>
			<td>EMD Millipore</td>
			<td>UFC800308</td>
			<td>mRBP concentration</td>
		</tr>
		<tr>
			<td>Pierce Silver Stain Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>24612</td>
			<td>Silver-staining assay</td>
		</tr>
		<tr>
			<td>RNA purification kit 
			(InviTrap Spin Plant RNA Mini Kit)</td>
			<td>STRATEC Molecular</td>
			<td>1064100300</td>
			<td>RNA purification</td>
		</tr>
		<tr>
			<td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-1000</td>
			<td>RNA quality and quantity</td>
		</tr>
		<tr>
			<td>Real-Time PCR cycler 
			(StepOne Real-Time PCR cycler)</td>
			<td>Thermo Fisher Scientific</td>
			<td>4376600</td>
			<td>cDNA quantification</td>
		</tr>
		<tr>
			<td>&#181;-C18 columns 
			(Millipore Zip Tip &#181;-C18 columns)</td>
			<td>Sigma-aldrich</td>
			<td>720046-960EA</td>
			<td>Peptide purification</td>
		</tr>
		<tr>
			<td>Mass spectrometer 
			(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>IQLAAEGAAPFALGMAZR</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ULTIM3000RSLCNANO</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 column 
			(Easy Spray Pepmap RSLC C18 column)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ES800</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 precolumn 
			(Acclaim Pepmap 100 C18 precolumn)</td>
			<td>Thermo Fisher Scientific</td>
			<td>160321</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers for qRT-PCR assay</td>
			<td colspan="3">Sequences</td>
		</tr>
		<tr>
			<td>UBQ10 mRNA 
			(Li et al., 2014)</td>
			<td colspan="3">Fw: AACTTTGGTGGTTTGTGTTTTGG 
			Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td>
		</tr>
		<tr>
			<td>18S rRNA 
			(Durut et al., 2014)</td>
			<td colspan="3">Fw: CGTAGTTGAACCTTGGGATG 
			Rv: CACGACCCGGCCAATTA</td>
		</tr>
	</tbody>
</table>

mrna interactome capture from plant protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

We observed a characteristic halo, which surrounds the bead pellet in the CL sample, in wash step 4.3 with wash buffer 2 (Figure 1B). Although it has not been investigated, this phenomenon can probably be explained by the interference of crosslinked mRNP complexes with bead aggregation during the magnetic capture, causing a more diffuse aggregate to form. It indicates that the oligo-d(T)25 bead capture was effective14.
<...

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

The overall goal of this optimized mRNA interactome capture is to isolate and identify an mRNA-bound proteome from plant cells. This method is applied to arabidopsis thaliana leaf mesophil protoplasts, a cell type used as a versatile tool in various cellular assays. This method can help to answer key questions in the field of post-transcriptional gene regulation implants such as discovering and understanding the role of plant messengers RNA binding proteins.The main advantage of this technique is that it can isolate and identify a plant messenger on a bound proteome directly from the physiological environment. So this method can provide insight into the messenger RNA-bound protein from aribidopsis leaf mesophil protoplasts. It also can be applied to other systems like other plant's protoplasts or tissues.We first had the idea for this method when we noticed that it had been applied successfully to yeast and mammalian cell lines. Isolate arabidopsis leaf mesophil protoplasts for two different samples, as described in the text protocol. Keep the control sample that will not be UV crosslinked, or non-CL sample on ice.Transfer the protoplast suspension to be crosslinked, or CL-sample to a large petri dish. Add 30 milliliters of ice-cold MMG solution to the dish to cover the surface and spread the cells by gentle pipetting. Cover the petri dish with aluminum foil when transported to the UV crosslinking apparatus.Place the opened petri dish in a UV crosslinking apparatus immediately. Make sure that the distance between the dish and the UV lamp is eight centimeters and then irradiate the sample for one minute. After that, quickly aliquot the protoplast suspension from the petri dish into two new 50 milliliter round-bottom tubes.Wash the bottom of the dish with an additional five milliliters of the ice-cold MMG solution to collect the remainder of the protoplasts. Divide the suspension between the two tubes. Next, centrifuge the non-CL and two CL sample tubes at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, place the tube with the non-CL pellet back on ice. Add 10 milliliters of ice-cold MMG solution to each CL sample tube and gently shake the tubes to re-suspend the pellets. After combining the two samples into one 50 milliliter round-bottom tube, centrifuge at 100 times g at four degrees celsius for five minutes.After discarding the supernatant, keep the pellet on ice. Then add nine milliliters of ice-cold lysis binding buffer to the cell pellet of each sample. Lyse the protoplasts by pipetting up and down approximately twenty times, until the solution is a homogenous light green color.For homogenization, pass the protoplast lysate two times through a 50 milliliter glass syringe with a narrow needle, and then incubate the lysate on ice for ten minutes. Freeze the samples in liquid nitrogen and store at minus 80 degrees celsius for up to three weeks. After thawing the tube with frozen protoplast lysate at room temperature, keep the tube on ice.Aliquot 1.8 milliliters of oligo-d(T)magnetic beads into six new two milliliter round-bottom micro centrifuge tubes placed on ice. Wash the bead suspension in each tube with 600 microliters of lysis binding buffer by briefly pipetting up and down and gently rotate the beads on a rotator for two minutes. Keep the beads on ice.Next, place all six tubes containing the beads into a magnetic rack for at least three minutes to allow enough time for the complete magnetic capture. When the beads are completely captured, the suspension will become clear. Then, discard the supernatant from all six tubes and immediately aliquot nine milliliters of protoplast lysate into them.Mix the beads with lysate by pipetting until the suspension appears brown and homogenous. Incubate the tubes at four degrees celsius for one hour with gentle rotation. After incubation, place the tubes back into the magnetic rack for three minutes.When all the beads are captured on the side of the tubes, collect the supernatant containing the protoplast lysate into six new two milliliter round-bottom micro centrifuge tubes. Next, add 1.5 milliliters of ice-cold wash buffer one to each tube containing beads, and resuspend the beads by pipetting. After gentle rotation for one minute, place the tubes back into the magnetic rack for three minutes.Discard the supernatant and repeat this wash step once. Using 1.5 milliliters of ice-cold wash buffer two, repeat the same washing procedure twice. If the mRNP's have been efficiently isolated from the protoplast lysate, there should be a halo visible around the bead pellet in the CL sample.Finally, repeat the washing procedure once with 1.5 milliliters of ice-cold low salt buffer. After washing, add 500 microliters of elution buffer to each tube, and gently re-suspend the beads by pipetting. Incubate at 50 degrees celsius for three minutes to release the poly-A tailed RNA's.Gently re-suspend the beads by pipetting once and place the tubes back into the magnetic rack at four degrees celsius for five minutes. Transfer and combine eluents from all six tubes into a 15 milliliter conical-bottom tube placed on ice. This will yield approximately three millimeters of the eluent.The quality and quantity of RNA can be immediately determined using a spectrophotometer. Prepare the oligo-d(T)beads to be re-used by washing them twice with one milliliter of ice-cold elution buffer. After that, wash them with one milliliter of ice-cold lysis binding buffer to adjust the salt concentration back to 500 millimolar.Use these washed oligo-d(T)beads to repeat the binding, washing, and elution procedures for an additional two rounds. This will deplete the poly-A tailed RNA's from the protoplast lysate and yield a total of nine millimeters of eluent for each sample. Beads can be stored and used for another experiment for a maximum of three times.To test the RNA for quality, digest the UV-crosslinked proteins with proteinase K solution according to the text protocol. Then, purify the RNA using the RNA purification kit to remove any residual contaminates. After purification, the samples are ready for the RNA quality test using qRT-PCR.Begin by treating eight milliliters of each sample with 100 units of RNAse cocktail containing RNAse A and RNAse T1.After brief vortexing, incubate the samples at 37 degrees celsius for one hour. To concentrate mRNA binding proteins, or mRBP's, filter the samples using centrifugal filter units. Each sample will yield 75 microliters with two micrograms of protein.For long-term storage, freeze the samples at minus 80 degrees celsius. To run an SDS-page gel, mix 25 microliters of each concentrated sample with 15 microliters of 2X loading dye and heat the samples at 95 degrees celsius for five minutes. Load the samples in a protein marker on an SDS-page gel with a five percent stacking gel and twelve percent resolving gel.Next, wash the gel twice with ultrapure water for five minutes per wash. Use a commercial silver staining kit to stain the gel. If the sufficient number of starting protoplasts has been used, the protein bands will show within five minutes.To further test the mRBP's, purify the peptides from a second 1D page gel as explained in the text protocol. These purified peptides can now be analyzed by nano reverse-phased liquid chromatography, mass spectrometry, and qualitative and quantitative proteomics. After oligo-d(T)bead capture, qRT-PCR demonstrated significantly higher levels of poly ubiquitin 10 reference mRNA versus 18S rRNA.Since oligo-d(T)beads only bind to poly-A tailed RNA, this suggests that mRNA's are enriched in the eluent. Capture of mRBP's by oligo-d(T)beads is further evaluated by a silver-stained SDS-page gel. The gel shows a significantly higher protein amount in the UV-crosslinked CL sample versus the non-crosslinked non-CL sample.The duration of UV irradiation can influence the efficiency of crosslinking. This silver-stained SDS-page gel confirms that one or three minutes of UV irradiation is the optimal condition, with the strongest band intensities. A total of 325 proteins were identified by quantitative proteomics analysis.225 of these proteins were below the significance level due to low abundant peptides present for each protein, with high variability of peptide intensities. However, because all of them were qualitatively detected only in CL samples, they were all considered positive results. These 325 proteins were further classified into three categories, Ribosomal proteins, main RBP's, and candidate RBP's.The candidate RBP's lack conventional RNA binding domains and most of their roles have not been validated, suggesting possible novel functions in RNA regulation. Once mastered, this technique can be done in one week if performed appropriately. After it's development, this technique paved the way for researchers in the field of molecular regulation pathways in plants to explore genome-wide messenger RNA-bound proteome in dicots and monocots cells and tissues.

mrna-interactome-capture-from-plant-protoplasts

Research

JoVE Journal

Biochemistry

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not detected or are not identified as differentially expressed (DE) in transcriptomic analyses of whole plant organs. Laser Microdissection RNA-Seq (LM RNA-Seq) is a powerful tool to identify genes that are DE in specific developmental domains. However, the choice of cellular domains to microdissect and compare, and the accuracy of the microdissections are crucial to the success of the experiments. Here, two examples illustrate design considerations for transcriptomics experiments; a LM RNA-seq analysis to identify genes that are DE along the maize leaf proximal-distal axis, and a second experiment to identify genes that are DE in liguleless1-R (lg1-R) mutants compared to wild-type. Key elements that contributed to the success of these experiments were detailed histological and in situ hybridization analyses of the region to be analyzed, selection of leaf primordia at equivalent developmental stages, the use of morphological landmarks to select regions for microdissection, and microdissection of precisely measured domains. This paper provides a detailed protocol for the analysis of developmental domains by LM RNA-Seq. The data presented here illustrate how the region selected for microdissection will affect the results obtained.

Many developmentally important genes have cell- or tissue-specific expression patterns. This paper describes LM RNA-seq experiments to identify genes that are differentially expressed at the maize leaf blade-sheath boundary and in lg1-R mutants compared to wild-type. The experimental considerations discussed here apply to transcriptomic analyses of other developmental phenomena.

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually determined by transcriptomic, proteomic, metabolomics and lipidomic measurements. In this protocol, we introduce a simple method for the reproducible extraction of metabolites, lipids and proteins from biological tissues using a single aliquot per sample. The extraction method is based on a methyl tert-butyl ether: methanol: water system for liquid: liquid partitioning of hydrophobic and polar metabolites into two immiscible phases along with the precipitation of proteins and other macromolecules as a solid pellet. This method, therefore, provides three different fractions of specific molecular composition, which are fully compatible with common high throughput 'omics' technologies such as liquid chromatography (LC) or gas chromatography (GC) coupled to mass spectrometers. Even though the method was initially developed for the analysis of different plant tissue samples, it has proved to be fully compatible for the extraction and analysis of biological samples from systems as diverse as algae, insects, and mammalian tissues and cell cultures.

A protocol for comprehensive extraction of lipids, metabolites and proteins from biological tissues using one sample is presented.

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Leaf Spray Mass Spectrometry: A Rapid Ambient Ionization Technique to Directly Assess Metabolites from Plant Tissues

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing plant metabolites because it provides molecular weights with high sensitivity and specificity. Leaf spray MS is an ambient ionization technique where plant tissue is used for direct chemical analysis via electrospray, eliminating chromatography from the process. This approach to sampling metabolites allows for a wide range of chemical classes to be detected simultaneously from intact plant tissues, minimizing the amount of sample preparation needed. When used with a high-resolution, accurate mass MS, leaf spray MS facilitates the rapid detection of metabolites of interest. It is also possible to collect tandem mass fragmentation data with this technique to facilitate a compound identification. The combination of accurate mass measurements and fragmentation is beneficial in confirming compound identities. The leaf spray MS technique requires only minor modifications to a nanospray ionization source and is a useful tool to further expand the capabilities of a mass spectrometer. Here, fresh leaf tissue from Sceletium tortuosum (Aizoaceae), a traditional medicinal plant from South Africa, is analyzed; numerous mesembrine alkaloids are detected with leaf spray MS.

Leaf spray mass spectrometry is a direct chemical analysis technique that minimizes the sample preparation and eliminates chromatography, allowing for the rapid detection of small molecules from plant tissues.

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Studying Protein Import into Chloroplasts Using Protoplasts

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many secondary metabolites and lipids. Chloroplasts require a large number of proteins for these various physiological processes. Over 95% of chloroplast proteins are nucleus-encoded and imported into chloroplasts from the cytosol after translation on cytosolic ribosomes. Thus, the proper import or targeting of these nucleus-encoded chloroplast proteins to chloroplasts is essential for the proper functioning of chloroplasts as well as the plant cell. Nucleus-encoded chloroplast proteins contain signal sequences for specific targeting to chloroplasts. Molecular machinery localized to the chloroplast or cytosol recognize these signals and carry out the import process. To investigate the mechanisms of protein import or targeting to chloroplasts in vivo, we developed a rapid, efficient protoplast-based method to analyze protein import into chloroplasts of Arabidopsis. In this method, we use protoplasts isolated from leaf tissues of Arabidopsis. Here, we provide a detailed protocol for using protoplasts to investigate the mechanism by which proteins are imported into chloroplasts.

Here we describe a protocol to express proteins into protoplasts by using PEG-mediated transformation method. The method provides easy expression of proteins of interest, and efficient investigation of protein localization and the import process for various experimental conditions in vivo.

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Label-Free Immunoprecipitation Mass Spectrometry Workflow for Large-scale Nuclear Interactome Profiling

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This publication presents a complete interaction proteomics workflow designed for identifying low abundance protein-protein interactions from the nucleus that could also be applied to other subcellular compartments. This workflow includes subcellular fractionation, immunoprecipitation, sample preparation, offline cleanup, single-shot label-free mass spectrometry, and downstream computational analysis and data visualization. Our protocol is optimized for detecting compartmentalized, low abundance interactions that are difficult to identify from whole cell lysates (e.g., transcription factor interactions in the nucleus) by immunoprecipitation of endogenous proteins from fractionated subcellular compartments. The sample preparation pipeline outlined here provides detailed instructions for the preparation of HeLa cell nuclear extract, immunoaffinity purification of endogenous bait protein, and quantitative mass spectrometry analysis. We also discuss methodological considerations for performing large-scale immunoprecipitation in mass spectrometry-based interaction profiling experiments and provide guidelines for evaluating data quality to distinguish true positive protein interactions from nonspecific interactions. This approach is demonstrated here by investigating the nuclear interactome of the CMGC kinase, DYRK1A, a low abundance protein kinase with poorly defined interactions within the nucleus.

Described is a proteomics workflow for identifying protein interaction partners from a nuclear subcellular fraction using immunoaffinity enrichment of a given protein of interest and label-free mass spectrometry. The workflow includes subcellular fractionation, immunoprecipitation, filter aided sample preparation, offline cleanup, mass spectrometry, and a downstream bioinformatics pipeline.

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This ...