Name: atomic force microscopy investigations of dna lesion recognition in nucleotide excision repair
Uploaded: 2017-05-24T14:00:00.000+00:00
Duration: 10 min 59 s
Description: Watch this Scientific Journal Video about Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair at JoVE.com

PUC19N, CPD-containing oligonucleotides, and p44 were kindly provided by Samuel Wilson, Korbinian Heil and Thomas Carell, and Gudrun Michels and Caroline Kisker, respectively. This work was supported by grants from the Deutsche Forschungsgemeinschaft (DFG) FZ82 and TE-671/4 to IT.

<ol>
	<li>Janicijevic, A., Ristic, D., Wyman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+machines+of+DNA+repair:+scanning+force+microscopy+analysis+of+their+architecture.">The molecular machines of DNA repair: scanning force microscopy analysis of their architecture.</a> J. Microsc. 212 (3), 264-272 (2003).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+bending+and+unbending+by+MutS+govern+mismatch+recognition+and+specificity.">DNA bending and unbending by MutS govern mismatch recognition and specificity.</a> Proc. Natl. Acad. Sci. USA. 100 (25), 14822-14827 (2003).</li><li>Tessmer, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+MutS+searching+for+DNA+mismatches+and+signaling+repair.">Mechanism of MutS searching for DNA mismatches and signaling repair.</a> J. Biol. Chem. 283 (52), 36646-36654 (2008).</li><li>Wagner, K., Moolenaar, G., van Noort, J., Goosen, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+analysis+reveals+two+separate+DNA-binding+domains+in+the+Escherichia+coli+UvrA+dimer.">Single-molecule analysis reveals two separate DNA-binding domains in the Escherichia coli UvrA dimer.</a> Nucleic Acids Res. 37 (6), 1962-1972 (2009).</li><li>Buechner, C. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strand-specific+recognition+of+DNA+damages+by+XPD+provides+insights+into+nucleotide+excision+repair+substrate+versatility.">Strand-specific recognition of DNA damages by XPD provides insights into nucleotide excision repair substrate versatility.</a> J Biol. Chem. 289 (6), 3613-3624 (2014).</li><li>Van der Linden, E., Sanchez, H., Kinoshita, E., Kanaar, R., Wyman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD50+and+NBS1+form+a+stable+complex+functional+in+DNA+binding+and+tethering.">RAD50 and NBS1 form a stable complex functional in DNA binding and tethering.</a> Nucleic Acids Res. 37 (5), 1580-1588 (2009).</li><li>Fuentes-Perez, M. E., Dillingham, M., Moreno-Herrero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AFM+volumetric+methods+for+the+characterization+of+proteins+and+nucleic+acids.">AFM volumetric methods for the characterization of proteins and nucleic acids.</a> Methods. 60, 113-121 (2013).</li><li>Shlyakhtenko, L. S., Lushnikov, A. Y., Miyagi, A., Lyubchenko, Y. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+of+binding+of+single-stranded+DNA-binding+protein+to+its+target.">Specificity of binding of single-stranded DNA-binding protein to its target.</a> Biochemistry. 51, 1500-1509 (2012).</li><li>Wirth, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+Divergence+in+Nucleotide+Excision+Repair+Lesion+Recognition.">Conservation and Divergence in Nucleotide Excision Repair Lesion Recognition.</a> J. Biol. Chem. 291 (36), 18932-18946 (2016).</li><li>Kuper, J., Kisker, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Damage+recognition+in+nucleotide+excision+DNA+repair.">Damage recognition in nucleotide excision DNA repair.</a> Curr. Opin. Struct. Biol. 22, 88-93 (2012).</li><li>Buechner, C. N., Tessmer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+substrate+preparation+for+atomic+force+microscopy+studies+of+protein-DNA+interactions.">DNA substrate preparation for atomic force microscopy studies of protein-DNA interactions.</a> J. Mol. Recognit. 26 (12), 605-617 (2013).</li><li>Sun, Z., Tan, H. Y., Bianco, P. R., Lyubchenko, Y. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Remodeling+of+RecG+Helicase+at+the+DNA+Replication+Fork+by+SSB+Protein.">Remodeling of RecG Helicase at the DNA Replication Fork by SSB Protein.</a> Sci. Rep. 5, 9625 (2015).</li><li>Billingsley, D. J., Bonass, W. A., Crampton, N., Kirkham, J., Thomson, N. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+studies+of+DNA+transcription+using+atomic+force+microscopy.">Single-molecule studies of DNA transcription using atomic force microscopy.</a> Phys. Biol. 9 (2), 021001 (2012).</li><li>Maurer, S., Fritz, J., Muskhelishvili, G., Travers, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+polymerase+and+an+activator+form+discrete+subcomplexes+in+a+transcription+initiation+complex.">RNA polymerase and an activator form discrete subcomplexes in a transcription initiation complex.</a> EMBO J. 25 (16), 3784-3790 (2006).</li><li>Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A Laboratory Manual. 1, (2012).</li><li>Theis, K., Chen, P. J., Skorvaga, M., Van Houten, B., Kisker, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+UvrB,+a+DNA+helicase+adapted+for+nucleotide+excision+repair.">Crystal structure of UvrB, a DNA helicase adapted for nucleotide excision repair.</a> EMBO J. 18 (24), 6899-6907 (1999).</li><li>Kuper, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+TFIIH,+XPD+helicase+is+exclusively+devoted+to+DNA+repair.">In TFIIH, XPD helicase is exclusively devoted to DNA repair.</a> PLoS Biol. 12 (9), e1001954 (2014).</li><li>Shlyakhtenko, L. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silatrane-based+surface+chemistry+for+immobilization+of+DNA,+protein-DNA+complexes+and+other+biological+materials.">Silatrane-based surface chemistry for immobilization of DNA, protein-DNA complexes and other biological materials.</a> Ultramicroscopy. 97, 279-287 (2003).</li><li>Roth, H. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XPB+helicase+regulates+DNA+incision+by+the+Thermoplasma+acidophilum+endonuclease+Bax1.">XPB helicase regulates DNA incision by the Thermoplasma acidophilum endonuclease Bax1.</a> DNA Repair. 11 (3), 286-293 (2012).</li><li>Ratcliff, G. C., Erie, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Novel+Single-Molecule+Study+to+Determine+Protein-Protein+Association+Constants.">A Novel Single-Molecule Study to Determine Protein-Protein Association Constants.</a> J. Am. Chem. Soc. 123 (24), 5632-5635 (2001).</li><li>Yang, Y., Sass, L. E., Du, C., Hsieh, P., Erie, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+protein-DNA+binding+constants+and+specificities+from+statistical+analyses+of+single+molecules:+MutS-DNA+interactions.">Determination of protein-DNA binding constants and specificities from statistical analyses of single molecules: MutS-DNA interactions.</a> Nucleic Acids Res. 33 (13), 4322-4334 (2005).</li><li>Caron, P. R., Grossman, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+a+cryptic+ATPase+activity+of+UvrB+and+its+proteolysis+product,+UvrB*+in+DNA+repair.">Involvement of a cryptic ATPase activity of UvrB and its proteolysis product, UvrB* in DNA repair.</a> Nucleic Acids Res. 16 (22), 10891-10902 (1988).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UvrB+domain+4,+an+autoinhibitory+gate+for+regulation+of+DNA+binding+and+ATPase+activity.">UvrB domain 4, an autoinhibitory gate for regulation of DNA binding and ATPase activity.</a> J. Biol. Chem. 281 (22), 15227-15237 (2006).</li><li>Chammas, O., Billingsley, D. J., Bonass, W. A., Thomson, N. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-stranded+DNA+loops+as+fiducial+markers+for+exploring+DNA-protein+interactions+in+single+molecule+imaging.">Single-stranded DNA loops as fiducial markers for exploring DNA-protein interactions in single molecule imaging.</a> Methods. 60 (2), 122-130 (2013).</li><li>Truglio, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+DNA+recognition+and+processing+by+UvrB.">Structural basis for DNA recognition and processing by UvrB.</a> Nat. Struct. Mol. Biol. 13 (4), 360-364 (2006).</li><li>Kuper, J., Wolski, S. C., Michels, G., Kisker, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+studies+of+the+nucleotide+excision+repair+helicase+XPD+suggest+a+polarity+for+DNA+translocation.">Functional and structural studies of the nucleotide excision repair helicase XPD suggest a polarity for DNA translocation.</a> EMBO J. 31 (2), 494-502 (2012).</li><li>Verhoeven, E. E., Wyman, C., Moolenaar, G. F., Goosen, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+two+UvrB+subunits+in+the+UvrAB+complex+ensures+damage+detection+in+both+DNA+strands.">The presence of two UvrB subunits in the UvrAB complex ensures damage detection in both DNA strands.</a> EMBO J. 21 (15), 4196-4205 (2002).</li><li>Verhoeven, E. E., Wyman, C., Moolenaar, G. F., Hoeijmakers, J. H., Goosen, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+nucleotide+excision+repair+complexes:+DNA+is+wrapped+by+UvrB+before+and+after+damage+recognition.">Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition.</a> EMBO J. 20 (3), 601-611 (2001).</li><li>Moolenaar, G. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Role+of+ATP+Binding+and+Hydrolysis+by+UvrB+during+Nucleotide+Excision+Repair.">The Role of ATP Binding and Hydrolysis by UvrB during Nucleotide Excision Repair.</a> J. Biol. Chem. 275, 8044-8050 (2000).</li></ol>

The authors have nothing to disclose.

AFM statistical analyses of binding positions of proteins on long DNA fragments that contain specific target sites can reveal interesting details on the particular strategies employed by the protein to recognize these sites2,3,4,5,6. To interpret the resulting position distributions, the positions of the targets in the DNA need to be precisely known. This is achieved by introducing specific sites at well-defined sequence positions into circular plasmid DNA and cutting out a fragment of the DNA including this specific site, using restriction enzyme technology. In AFM image analyses of protein binding positions, only DNA fragments with correct lengths (consistent with the full length of the cut out fragment) can be included because only for these, the position of the target site is known. It is worth noting that the preparation procedure described here results in linear DNA substrates with two indistinguishable fragment ends. Position distributions can hence only be measured and plotted from 0 x DNA length (proteins bound at DNA fragment ends) to 0.5 x DNA length (proteins bound at the center of fragments). Furthermore, for target positions that are not located exactly at the center of the substrate, these distributions always contain a small background of proteins that are nonspecifically bound at the same distance from the other DNA end. However, fitting a Gaussian curve to the distribution footed on the average background height (nonspecifically bound proteins, Figure 3) accounts for these complexes. Alternatively, one of the DNA ends can be labeled, for example with small volume peaks from secondary structure forming ssDNA overhangs24. Typical resolution limits of these position analyses are in the range of 100-fold preference of target site over nonspecific site binding. In addition, DNA fragment ends do not constitute nonspecific dsDNA sites but instead represent dsDNA breaks. DNA repair proteins often bind to these destabilized fragment ends, in addition to the strand-internally introduced specific target sites. DNA end binding can be revealed by AFM analyses and can provide important information on the function of a protein. If DNA end binding is not the focus of interest, these positions can, however, be easily omitted from the position distributions by starting the plots at a position &#62;0 (e.g., here 0.02 DNA lengths).
One of the particular advantages and, in fact, the defining, common property of single molecule techniques is the resolution of individual, different states present in a sample, which can possess vastly differing properties and activities. Even in cases where the particular species of interest may only be infrequent in a sample, these approaches thus allow the separate focus on this species whose contributions would be dwarfed in an ensemble measurement. For protein samples, for instance, AFM imaging allows the direct distinction between different types of protein complexes based on complex volume, if the sizes of the individual proteins differ sufficiently (typical resolution limits are around 20 kDa)1,4,6,7,9,12. AFM systems can be calibrated to allow the translation of the measured volumes into protein molecular weight (Protocol 3.1.3.1)4,8,19,20. Alternatively, protein standards with known sizes have been used as a direct reference in the images1,6. In the system focused on here, binding positions on DNA could thus separately be determined for the helicase inactive monomeric XPD and for helicase active heterodimeric XPD/p44 complexes. Preferential binding to a lesion site at a well-defined position in the DNA indicated DNA lesion recognition by a protein complex. Since protein loading and lesion sites were spatially separated, DNA translocation was a necessary pre-requisite for lesion recognition in the DNA substrates used here. Only the heterodimeric XPD/p44 complexes were capable of DNA translocation (Figure 3), consistent with results from helicase activity assays9. AFM volume analysis can hence provide important information on differential activities of different protein complex forms.
Lesion interaction and recognition by the helicase active XPD/p44 complex resulted in enhanced binding at the target site due to stalling of helicase translocation (Figure 3). Interestingly, varying the position of the loading site relative to the lesion position resulted in lesion recognition by XPD predominantly when loading occurred 5&#39; from the lesion for bulky fluorescein adducts, but when loading occurred 3&#39; from the lesion for the only little DNA distorting CPD lesion. Because of the 5&#39;-to-3&#39; directionality of XPD helicase (see schematic in Figure 3), this finding indicates that the enzyme detects fluorescein preferentially on the translocated strand but CPD preferentially on the opposite, non-translocated strand. The prokaryotic NER helicase UvrB, in contrast, preferentially recognized both fluorescein and CPD lesions upon loading 5&#39; from the lesion, i.e. on the translocated strand (Figure 3). These distinctive differences in their lesion recognition properties can be understood from the different structural properties of the two helicases. UvrB interacts with potential targets in the DNA via amino acid residues on the inside of a &#946;-hairpin feature in the enzyme behind which the translocated strand is likely threaded16,25. XPD, on the other hand, hosts a small pore in close proximity to an iron-sulfur (FeS) cluster26. The translocated DNA strand likely threads through this pore26. Bulkier lesions such as fluorescein may stall helicase translocation via interactions with residues within this pore, while less bulky CPD lesions may be identified more easily via interactions with the FeS cluster. In the prokaryotic system, two molecules of UvrB are believed to be involved in target site search in a hetero-tetrameric UvrA2-UvrB2 complex, in which each of the two UvrB monomers is able to investigate a different DNA strand27. XPD in eukaryotic NER likely exists as a single copy in the TFIIH lesion recognition complex. Flexibility in lesion interaction approaches of the eukaryotic enzyme may hence be required to enable recognition of the extremely large target site spectrum of the NER repair system.
Because specific (target site bound) and nonspecific complexes can be distinguished in AFM images based on their positions on the DNA, these different complex types can be analyzed separately and compared. Single molecule AFM is one of very few approaches that provide access to structural properties of protein complexes bound nonspecifically to DNA due to their often transient or variable nature. Here, conformational changes upon target site recognition were visualized and characterized in archaeal XPD based on the bending introduced in the DNA by the enzyme. The AFM data revealed a small but distinct, significant shift in DNA bend angles for XPD bound at a lesion site versus XPD bound to nonspecific DNA5. Conformational changes in the DNA bound proteins upon target site identification likely trigger the recruitment of the NER endonucleases (XPG and XPF in eukaryotic NER) that carry out excision of a short stretch of ssDNA containing the lesion. Interestingly, this shift and hence conformational re-arrangement required binding of ATP to the enzyme (but not hydrolysis). A similar approach of ATP-rebinding upon target site identification and subsequent recruitment of UvrC endonuclease has been reported for UvrB in prokaryotic NER28,29.
In summary, AFM single molecule imaging has revealed subtle differences in target site recognition by the prokaryotic and eukaryotic NER helicases. Once a target lesion has been identified by the enzymes, they share a similar strategy of recruiting the NER endonucleases via ATP-binding induced conformational re-arrangements selectively at the lesion. The technique of AFM in combination with careful DNA substrate design to mimic essential properties of the investigated system can hence provide insight into target site interactions of not only DNA repair but DNA binding protein systems in general. Structural information on both specific and nonspecific complexes with resolutions in the low nanometer range (at the molecular level, limited by the AFM probe) can contribute significantly to the understanding of the involved mechanisms.

Atomic force microscopy (AFM) is a powerful technique for the analysis of protein-DNA interactions1,2,3,4,5,6,7,8,9. It requires only low amounts of sample material to directly visualize heterogeneous samples with a resolution at the single molecule level. Heterogeneity can result from different conformational or oligomeric states of a protein. In particular, in the context of protein-DNA samples, protein complexes can display different stoichiometries and/or conformations induced by DNA binding in general or binding to a specific target site within DNA. Heterogeneous samples may also contain two (or more) different kinds of proteins, and different protein complex forms (e.g., consisting of only one type of protein versus heteromeric complexes) may interact differently with DNA. The studies discussed here exploit AFM imaging in air on static, dried samples of DNA repair proteins bound to long (~900 base pairs, bp) DNA fragments that contain a lesion, which represents a target of these proteins. The high, molecular resolution of AFM allows the distinction between different types of protein complexes and to determine the binding positions of the proteins on the DNA fragments. Importantly, the lesions are introduced into the DNA substrates at well-defined positions. Because the position of the lesion site in the DNA is known, the distributions of proteins bound on DNA provide insight into (different) lesion recognition properties of the (different) protein complexes, e.g., how well they recognize a particular type of lesion (compared to non-damaged DNA)2,3,4,5,6. Their positions on the DNA also allow the distinction between protein complexes bound specifically at the lesions and complexes bound nonspecifically elsewhere on the DNA. Separate characterization of these different complex types (complexes bound specifically at the lesion versus nonspecific complexes) can reveal potential conformational changes in the complexes induced upon target site identification.
The DNA repair proteins focused on here are helicases that are responsible for lesion recognition in the nucleotide excision repair (NER) pathway. In bacteria, NER is achieved by the proteins UvrA, UvrB, and UvrC. UvrA is responsible for initial lesion sensing in a UvaA2/UvrB2 DNA-scanning complex. Upon lesion verification by UvrB this complex converts to monomeric UvrB bound at the lesion site and this specific complex can then recruit the prokaryotic NER endonuclease UvrC. UvrC excises a short (12-13 nt) stretch of single stranded DNA (ssDNA) containing the lesion. The missing stretch is then refilled by DNA polymerase. Finally, DNA ligase seals the newly synthesized stretch with the original DNA9,10. In eukaryotes, most proteins of the NER cascade are part of the large, multimeric transcription factor II H (TFIIH) complex. After initial lesion sensing via the trimeric CEN2-XPC-HR23B complex, TFIIH is recruited to the DNA target site. When XPD within the complex verifies the presence of an NER target lesion, the eukaryotic NER endonucleases XPG and XPF are recruited to excise a short (24-32 nt) stretch of ssDNA containing the lesion9,10. Here, specifically, the helicases UvrB and XPD from prokaryotic and eukaryotic NER, respectively, were studied. These helicases require an unpaired region in the DNA (a DNA bubble) to thread onto one of the two DNA single strands and subsequently translocate along this strand fueled by ATP hydrolysis. In addition to the DNA lesions, a DNA bubble was hence introduced in the substrates that functions as loading site for the proteins.
The procedure for preparation of specific lesion DNA substrates has been described previously11. It requires a circular DNA construct (plasmid) with two closely spaced restriction sites for a nickase. In the context of this study, the plasmid pUC19N (2729 bp) was used (created by S. Wilson&#39;s laboratory, NIEHS). This plasmid contains three closely spaced restriction sites for the nickase Nt.BstNBI that frame a 48 nucleotide (nt) stretch. After incubation with the nickase, the stretch of ssDNA between these sites can be removed and replaced by an oligonucleotide containing any target feature. After each step, complete enzymatic digestion is tested via agarose gel electrophoresis. Nicked circular DNA can be distinguished due to its lower electrophoretic mobility compared to the original supercoiled plasmid. Gapping of the DNA and replacement of the removed stretch by the specific substrate oligonucleotide can be evaluated via digestion with a restriction enzyme which incises the substrate exclusively within the region between the nicks. Linearization of the circular plasmid by the enzyme will hence be suppressed for the gapped DNA and restored after insertion of the specific oligonucleotide. Finally, two endonuclease restriction sites (ideally single cutters) allow for the generation of a linear DNA substrate, with length as desired and with the specific target site at a defined position as well as a DNA bubble at a distance from the lesion either in 5&#39; or 3&#39; direction.
Recognition of the lesions by the NER helicases can be investigated via AFM imaging. Stalled DNA translocation of the helicases at the lesion site is visible as a peak in the protein position distribution on the DNA and indicates lesion recognition. Because DNA translocation of these helicases is furthermore directional, with 5&#39;-to-3&#39; polarity, the dependence of lesion recognition on the position of the loading site (DNA bubble upstream or downstream from the lesion) also indicates whether the lesion is preferentially recognized on the translocated or on the opposite, non-translocated ssDNA strand5,9. In the following sections, the methods used will be introduced and major findings from these experiments will be briefly discussed. Importantly, analogous to the exemplary work on DNA repair shown here, AFM imaging can be applied to the study of different DNA interacting systems, such as DNA replication or transcription8,12,13,14.

<table><tbody><tr><td>Molecular Force Probe (MFP) 3D</td><td>Asylum Research</td><td>N/A</td><td>atomic force microscope (AFM)</td></tr><tr><td>Precision 390</td><td>DELL</td><td>N/A</td><td>computer</td></tr><tr><td>ThermoMixer and 1.5 mL block</td><td>Eppendorf</td><td>5382000015</td><td>heat block for DNA preparation</td></tr><tr><td>Rotilabo Block-Heater H 250 &amp;amp; blocks for 0.5 mL tubes</td><td>Carl Roth GmbH</td><td>Y264.1 &amp;amp; Y267.1</td><td>heat block for protein-DNA incubations</td></tr><tr><td>Mini-Sub Cell GT</td><td>Bio-Rad Laboratories GmbH</td><td>1704467</td><td>electrophoresis chamber with gel caster and power supply</td></tr><tr><td>Power Pac Basic</td><td>Bio-Rad Laboratories GmbH</td><td>1645050</td><td>electrophoresis power supply</td></tr><tr><td>Centifuge 5415 D with rotor</td><td>Eppendorf</td><td>2262120-3</td><td>table centrifuge</td></tr><tr><td>Ultra-Lum electronic UV transillumonator MEB-15</td><td>Ultralum</td><td>900-1322-02</td><td>UV irradiation table</td></tr><tr><td>NanoDrop ND-1000</td><td>VWR International / PEQLAB Biotechnologie GmbH</td><td>N/A</td><td>UV spectrophotometer</td></tr><tr><td>TKAX-CAD with 0.2 &amp;mu;m capsule filter</td><td>Unity Lab Services</td><td>N/A</td><td>water deionization and filter unit</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Software&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MFP software on Igor Pro</td><td>Asylum Research</td><td>N/A</td><td>AFM software</td></tr><tr><td>ImageJ (open source Java image processing)</td><td>NIH Image</td><td>N/A</td><td>Image analysis software</td></tr><tr><td>Excel (Microsoft Office)</td><td>Microsoft Corporation</td><td>N/A</td><td>data analysis software</td></tr><tr><td>Origin9 / Origin2016</td><td>OriginLab Corporation</td><td>N/A</td><td>statistical data analysis and graphing software</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Material&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>OMCL-AC240TS</td><td>Olympus</td><td>OMCL-AC240TS</td><td>AFM cantilevers</td></tr><tr><td>grade V-5 muscovite</td><td>SPI Supplies</td><td>1805</td><td>mica sheets</td></tr><tr><td>Amicon Ultra 0.5 mL 50k Ultracell</td><td>Millipore Ireland Ltd.</td><td>UFC505096</td><td>centrifuge filters</td></tr><tr><td>NucleoSpin Extract II&amp;nbsp;</td><td>&amp;nbsp;Macherey-Nagel GmbH</td><td>740 609.250</td><td>Agarose gel extraction kit</td></tr><tr><td>Rotilabo cellulose paper type 111A</td><td>Carl Roth GmbH</td><td>AP59.1</td><td>AFM deposition blotting paper</td></tr><tr><td>Anatop 25 (0.02 &amp;mu;m)</td><td>Whatman GmbH</td><td>6809-2102</td><td>syringe filter</td></tr><tr><td>SSpI, BspQI</td><td>New England Biolabs (NEB)</td><td>R0132, R0712</td><td>restriction enzymes for DNA substrate preparation</td></tr><tr><td>XhoI, BglII</td><td></td><td>R0146, R0144</td><td>restriction enzymes for DNA preparation controls</td></tr><tr><td>nicking restriction enzyme Nt.BstNBI</td><td>New England Biolabs (NEB)</td><td>R0607</td><td>nickase</td></tr><tr><td>T4 DNA ligase</td><td>New England Biolabs (NEB)</td><td>M0202S</td><td>Ligase</td></tr><tr><td>Tris, HEPES</td><td>Carl Roth GmbH</td><td>4855, 9105</td><td>buffer chemicals</td></tr><tr><td>NaCl, MgCl&lt;sub&gt;2&lt;/sub&gt;, KCl, MgAcetate</td><td>Carl Roth GmbH</td><td>3957, HN03, HN02, P026</td><td>salt chemicals</td></tr><tr><td>NaAc</td><td>Sigma-Aldrich Chemie GmbH</td><td>32318</td><td>salt chemicals</td></tr><tr><td>DTT, TCEP, EDTA</td><td></td><td>6908, HN95, 8040</td><td>chemicals/reagents</td></tr><tr><td>agarose, acetic acid, HCl</td><td>Carl Roth GmbH</td><td>2267, 3738, K025</td><td>reagents</td></tr><tr><td>ATP</td><td>Carl Roth GmbH</td><td>K054</td><td>nucleotides</td></tr><tr><td>oligonucleotide #1 in Table 1</td><td>Biomers</td><td>custom</td><td>complementary DNA oligonucleotide</td></tr><tr><td>oligonucleotides #2, #3, and #6 in Table 1</td><td>Integrated DNA Technologies (IDT)</td><td>custom</td><td>fluorescein containing oligonucleotides</td></tr><tr><td>oligonucleotides #4&amp;nbsp; and #5 in Table 1</td><td>private (available from e.g. TriLink or GlenResearch)</td><td></td><td>CPD containing oligonucleotides</td></tr><tr><td>SafeSeal reaction tube 0.5 mL and 1.5 mL</td><td>Sarstedt</td><td>72.704 and 72.706</td><td>incubation tubes</td></tr><tr><td>GeneRuler 1 kb</td><td>Thermo Scientific</td><td>SM0311</td><td>DNA ladder</td></tr><tr><td>6x concentrate gel loading dye purple</td><td>New England Biolabs (NEB)</td><td>51406</td><td>DNA loading dye</td></tr><tr><td>Midori Green&amp;nbsp;</td><td>Nippon Genetics Europe GmbH</td><td>999MG28055</td><td>DNA stain</td></tr></tbody></table>

atomic force microscopy investigations of dna lesion recognition in nucleotide excision repair

AFM imaging is a powerful technique for the study of protein-DNA interactions. This single molecule method allows the simultaneous resolution of different molecules and molecular assemblies in a heterogeneous sample. In the particular context of DNA interacting protein systems, different protein complex forms and their corresponding binding positions on target sites containing DNA fragments can thus be distinguished. Here, an application of AFM to the study of DNA lesion recognition in the prokaryotic and eukaryotic nucleotide excision DNA repair (NER) systems is presented. The procedures of DNA and protein sample preparations are described and experimental as well as analytical details of the experiments are provided. The data allow important conclusions on the strategies by which target site verification may be achieved by the NER proteins. Interestingly, they indicate different approaches of lesion recognition and identification for the eukaryotic NER system, depending on the type of lesion. Furthermore, distinct structural properties of the two different helicases involved in prokaryotic and eukaryotic NER result in and explain the different strategies observed for these two systems. Importantly, these experimental and analytical approaches can be applied not only to the study of DNA repair but also very similarly to other DNA interacting protein systems such as those involved in replication or transcription processes.

Distinguishing between different complex types based on protein complex volumes
The helicase activity of the prokaryotic NER helicase UvrB is stimulated by DNA binding22,23. UvrB requires an unpaired region in the DNA (a DNA bubble) in order to load correctly onto one of the two single ssDNA strands. In vivo, this DNA structure is provided by DNA interactions through another protein of the NER cascade; in in vitro experiments, the bubble can be artificially introduced into dsDNA fragments in close proximity to a target lesion. Protein-protein interactions also enhance DNA binding by UvrB9. However, once UvrB is loaded on DNA, its activity does not appear to depend on protein co-factors9. In contrast, the eukaryotic NER helicase XPD requires interaction with the protein p44, which like XPD is part of the multi-subunit transcription factor IIH (TFIIH) complex in vivo, for activation of its helicase activity, but this interaction does not affect XPD binding to DNA17. XPD alone is expected to load onto DNA at a DNA bubble, but not translocate to the lesion (in the absence of its helicase activating co-factor). XPD without p44 should hence not be able to interact with and identify the lesion when loaded at a distance from the lesion site. Incubations of XPD with p44 in the presence of lesion containing DNA substrate result in a mix of XPD- or XPD/p44-DNA complexes (and possibly a minor species of p44 alone bound to DNA). To separately analyze lesion recognition by XPD/p44 and XPD, these different complex types can be distinguished based on their volumes in AFM images (Figure 2)9, as described in Protocol 3.1 above. AFM systems can be calibrated using a range of proteins with known molecular weight, to reveal a linear relationship between the AFM volume and the approximate molecular mass of a protein (complex)20, allowing an interpretation of the measured volumes. Binding positions on the DNA could thus be separately determined for helicase inactive monomeric XPD (~95 kDa, consistent with the ~100 nm3 class 2 species in Figure 2) and for helicase active XPD/p44 complexes (~135 kDa, ~150 nm3 class 3 species), based on their different AFM volumes.
Lesion recognition determination from protein binding positions on DNA
Here, long (916 bp) DNA substrates containing a lesion at ~30% of the DNA length were used. Control over the exact position of the lesion within the DNA substrate allows the distinction between specific (lesion-bound, at ~30% of the DNA length) and nonspecific (lesion search) complexes dependent on their positions on the DNA. Two different lesions were chosen, which are targets of NER; DNA substrates contained either a fluorescein (F) adduct or a cyclobutane pyrimidine dimer (CPD). In addition to the lesion site, the DNA contained an unpaired region (8 nt DNA bubble) that served as loading site for the helicases. This loading site was located at a distance of 26 nt (for the F containing DNA substrates) or 23 nt (for the CPD containing substrates) either 5&#39; or 3&#39; from the lesion (see Table 1). Lesion recognition leads to stalled DNA translocation of the helicases UvrB and XPD at the target site, apparent in the AFM protein position distribution on DNA as a peak at the position of the lesion. The lesion and bubble positions in these substrates cannot per se be distinguished within the resolution limits of AFM imaging (&#60;10 nm distance). However, the fraction of specific complexes that represents the amount of molecules stalled at the lesion and indicates lesion recognition, depended strongly on whether the lesion was placed 3&#39; or 5&#39; from the bubble (Figure 3)9.
From the fraction of complexes at the specific site (area under the Gaussian fit peak versus area of the nonspecifically bound background), the specificity, S, of UvrB and XPD for the two investigated lesion types was calculated (see Protocol 3.2 above). For UvrB, loading 5&#39; from the lesion position resulted in higher specificities (SB,F5 ~200 and SB,CPD5 ~400) than loading 3&#39; from the lesion (SB,F3 and SB,CPD3 ~100) for both lesion types. For XPD, complexes containing only XPD (class 2 in Figure 2) and complexes containing XPD as well as the helicase activating co-factor protein p44 (class 3 in Figure 2) were distinguished as described in the previous section. Class 2 protein peaks (XPD only, helicase inactive) did not preferentially localize at lesion sites independent of whether they were loaded 5&#39; or 3&#39; and independent of the lesion type (data not shown). In contrast, the position distributions for XPD/p44 (class 3) complexes showed enhanced binding at F lesions for loading 5&#39; from the lesion (SXPD/p44,F5 ~300 versus SXPD/p44,F3 ~100) but at CPD lesions for loading 3&#39; from the lesion (SXPD/p44,CPD3 ~600 versus SXPD/p44,CPD5 ~100, Figure 3). Because UvrB and XPD are 5&#39;-to-3&#39; helicases, these data provide information on whether complexes are stalled via interactions with the lesion within the ssDNA strand that they translocate on (the translocated strand, for loading 5&#39; from the lesion), or within the opposite, non-translocated strand (for loading 3&#39; from the lesion). The concept is schematically shown in Figure 3. Interestingly, these data hence indicate that specific recognition occurred preferentially on the translocated strand independent of the type of lesion for UvrB, but on different strands for XPD/p44 dependent on the type of lesion. Bulky F lesions were detected preferentially by XPD on the translocated strand, but the only gently DNA distorting CPD lesions on the opposite, non-translocated strand.
Investigating conformational changes upon lesion identification by XPD
Measuring the bending introduced into DNA at the site of bound complexes from AFM images (see Protocol 3.3 above) can reveal important information on complex conformational changes. DNA bend angles were measured for archaeal XPD5, which does not require protein co-factor interaction for helicase activity. In these studies, a fluorescein lesion was located directly in the context of a DNA bubble for enhanced protein loading at the lesion, at ~30% of the DNA fragment length. Figure 4 shows Gaussian fits to DNA bend angle distributions obtained for protein complexes at nonspecific (non-damaged) DNA positions and at ~30% of DNA length, consistent with XPD bound at the position of the fluorescein lesion (specific complexes). The data demonstrate a mean bend angle of ~50&#176; for nonspecific complexes versus ~65&#176; for specific complexes. This DNA bend angle shift was dependent on the presence of ATP or ATP&#404;s, indicating that ATP (re-)binding but not hydrolysis was necessary for the conformational rearrangements5.
<img alt="Figure 1" src="/files/ftp_upload/55501/55501fig1.jpg" /> 
Figure 1: Preparation of DNA substrates. A ssDNA gap is introduced into circular plasmid DNA by nicking the plasmid (here with the nickase N.BstNBI) at closely spaced sites and removing the enclosed ssDNA stretch via centrifuge filtration after heat destabilization in the presence of an excess of complementary oligonucleotide. A specific oligonucleotide containing the feature of choice can then be annealed and ligated into the gap region. Finally, digestion with restriction enzymes (here with SspI and BspQI) results in a linear DNA substrate with the target feature at a precisely known position (here at 30% of the DNA fragment length). Control assays allow for testing of the individual steps (shown underneath) via agarose gel electrophoresis (black arrow indicates 3000 bp). Nicking can be tested by the altered electrophoretic mobility of the nicked, relaxed circular DNA (control nicking, lane 2) versus the supercoiled plasmid (lane 1). Complete gapping of the DNA as well as subsequent insertion of the specific oligo can be tested by digestion with a restriction enzyme that cuts in the gap region (here: XhoI, in lanes 2, 4, and 6) so that a lack of DNA incision indicates gap formation (lanes 1,2 nicked DNA, lanes 3,4 gapped DNA) and re-stalled incision indicates insertion of the specific oligo (lanes 5,6). The final linear substrate that contains the specific feature can be purified from the gel after agarose gel electrophoresis and tested for homogeneity and purity via AFM imaging. <a href="http://cloudflare.jove.com/files/ftp_upload/55501/55501fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55501/55501fig2.jpg" /> 
Figure 2: Distinguishing different complex types from their AFM volumes. (A) AFM image of XPD/p44-DNA (grey arrow) and XPD-DNA (black arrow) complexes. (B) Examples of three different types of DNA bound complexes, interpreted as p44 or mere DNA superstructure (class 1), XPD (class 2, black frame), and XPD/p44 (class 3, grey frame) complexes based on their AFM volumes (shown on the right). <a href="http://cloudflare.jove.com/files/ftp_upload/55501/55501fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55501/55501fig3.jpg" /> 
Figure 3: Different lesion recognition strategies of prokaryotic and eukaryotic NER helicases. Lesion recognition competent DNA translocation by the NER helicases UvrB and XPD (in complex with its helicase activating co-factor p44) requires loading of the proteins at an unpaired DNA region (DNA bubble). The proteins then move in 5&#39;-to-3&#39; direction along the ssDNA strand on which they loaded. Recognition of a DNA lesion (here: CPD) by the helicases either on the translocated strand (for loading at 5&#39; bubble) or on the opposite, non-translocated strand (for loading at 3&#39; bubble) results in stalled DNA translocation. In the position distributions this shows as a peak (Gaussian fit lines), which indicates enhanced binding at the lesion position (at ~30% of DNA length for DNA substrates shown here). The prokaryotic NER helicase UvrB and its eukaryotic counterpart XPD show different strategies of CPD lesion recognition that indicate different DNA strand preferences. Specifically, CPD lesions are recognized on the translocated strand by UvrB, but preferentially on the opposite, non-translocated strand by XPD. Figure modified from reference9. <a href="http://cloudflare.jove.com/files/ftp_upload/55501/55501fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55501/55501fig4.jpg" /> 
Figure 4: Conformational changes in XPD-DNA complexes upon lesion identification. The distributions of DNA bend angles induced by XPD indicate conformational changes in the protein-DNA complexes at a fluorescein lesion. These conformational rearrangements were dependent on the presence of ATP (B) or ATP&#404;S (C). (A) In the absence of ATP, nonspecific bend angles (grey) and bend angles at the lesion site (specific bend angles, black) are similar and fit by a Gaussian curve with center at ~50&#176;. (B, C) In the presence of ATP or ATP&#404;S, the specific bend angle distribution (black) shows a significant shift (P = 2.5 x 10-7) to an average bend angle of ~65&#176;. This DNA bending at the lesion site was independent of the type of lesion (CPD or fluorescein adduct) or the presence or absence of a DNA bubble5. Figure was reproduced from reference5. The inset in (C) demonstrates how bend angles (180&#176;-&#946;) were determined. <a href="http://cloudflare.jove.com/files/ftp_upload/55501/55501fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>number</td>
			<td colspan="3">sequence</td>
			<td>description</td>
		</tr>
		<tr>
			<td>1</td>
			<td colspan="3">GGTCGACTCTAGAGGATCAGATCT 
			GGTACCTCTAGACTCGAGGCATGC</td>
			<td>bottom&#160;</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="3">/Phos/GCATGCCTCGTCAAATCTGGT 
			ACCAGATCTGATCCTCTAGAGTCGFCC</td>
			<td>F / 5&#39; bubble</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">/Phos/GCAFGCCTCGAGTCTAGAGGT 
			ACCAGATCTCTAAAGTAAGAGTCGACC</td>
			<td>F / 3&#39; bubble</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="3">/Phos/GCATGCCTCGTCAAATCTGGT 
			ACCAGATCTGATCCTCTAGAT-TCGACC</td>
			<td>CPD/5&#39;bubble</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="3">/Phos/GCATGCT-TCGAGTCTAGAGGT 
			ACCAGATCTCTAAAGTAAGAGTCGACC</td>
			<td>CPD/3&#39;bubble</td>
		</tr>
		<tr>
			<td>6</td>
			<td colspan="3">/Phos/GCA TGCCTCGAGTCTAGACTCF 
			TTCCATCTGATCCTCTAGAGTCGACC</td>
			<td>F / bubble</td>
		</tr>
	</tbody>
</table>
Table 1: DNA oligonucleotides for DNA substrate preparation. All oligonucleotides are 48 nt long and top strands (oligonucleotides 2-6) were obtained phosphorylated at their 5&#39; end for ligation into the gapped DNA (see Protocol 1.1). F = fluorescein adducted thymine, T-T = cyclobutane pyrimidine (thymine) dimer (CPD), non-complementary regions (DNA bubble forming regions) are underlined. F containing oligonucleotides were obtained from Integrated DNA Technologies (IDT), CPD containing oligonucleotides were kindly provided by Thomas Carell&#39;s laboratory (Ludwig-Maximilian University Munich, Germany).

Watch this Scientific Journal Video about Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair at JoVE.com

Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair | Genetics | Video

Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair

Here, the study of different DNA lesion recognition approaches via single molecule AFM imaging is demonstrated with the nucleotide excision repair system as an example. The procedures of DNA and protein sample preparations and experimental as well as analytical details for the AFM experiments are described.

AFM imaging is a powerful technique for the study of protein-DNA interactions. This single molecule method allows the simultaneous resolution of different ...

atomic-force-microscopy-investigations-dna-lesion-recognition

Nanyang Technological University

Education

Research

JoVE Core

JoVE Journal

Molecular Biology

Biology

Genetics

Unit 1

DNA Structure and Function

DNA Repair and Recombination

SCIENTISTS IN ACTION

9.4K Views.  University of Würzburg. Here, the study of different DNA lesion recognition approaches via single molecule AFM imaging is demonstrated with the nucleotide excision repair system as an example. The procedures of DNA and protein sample preparations and experimental as well as analytical details for the AFM experiments are described.

Video: Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

Confocal fluorescence microscopy and laser micro-irradiation offer tools for inducing DNA damage and monitoring the response of DNA repair proteins in selected sub-nuclear areas. This technique has significantly advanced our knowledge of damage detection, signaling, and recruitment. This manuscript demonstrates these technologies to examine single and double strand break repair.

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular ...

Cancer Research

Laser Microirradiation to Study In Vivo Cellular Responses to Simple and Complex DNA Damage

DNA damage induces specific signaling and repair responses in the cell, which is critical for protection of genome integrity. Laser microirradiation became a valuable experimental tool to investigate the DNA damage response (DDR) in vivo. It allows real-time high-resolution single-cell analysis of macromolecular dynamics in response to laser-induced damage confined to a submicrometer region in the cell nucleus. However, various laser conditions have been used without appreciation of differences in the types of damage induced. As a result, the nature of the damage is often not well characterized or controlled, causing apparent inconsistencies in the recruitment or modification profiles. We demonstrated that different irradiation conditions (i.e., different wavelengths as well as different input powers (irradiances) of a femtosecond (fs) near-infrared (NIR) laser) induced distinct DDR and repair protein assemblies. This reflects the type of DNA damage produced. This protocol describes how titration of laser input power allows induction of different amounts and complexities of DNA damage, which can easily be monitored by detection of base and crosslinking damages, differential poly (ADP-ribose) (PAR) signaling, and pathway-specific repair factor assemblies at damage sites. Once the damage conditions are determined, it is possible to investigate the effects of different damage complexity and differential damage signaling as well as depletion of upstream factor(s) on any factor of interest.

Laser Microirradiation to Study In Vivo Cellular Responses to Simple and Complex DNA Damage

The goal of this protocol is to describe how to use laser microirradiation to induce different types of DNA damage, including relatively simple strand breaks and complex damage, to study DNA damage signaling and repair factor assembly at damage sites in vivo.

DNA damage induces specific signaling and repair responses in the cell, which is critical for protection of genome integrity. Laser microirradiation ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Characterizing DNA Repair Processes at Transient and Long-lasting Double-strand DNA Breaks by Immunofluorescence Microscopy

The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair complexes. This process is regulated by a myriad of proteins that promote the association and disassociation of proteins to these lesions. Thanks in large part to the ability to perform functional screens of a vast library of proteins, there is a greater appreciation of the genes necessary for the double-strand DNA break repair. Often knockout or chemical inhibitor screens identify proteins involved in repair processes by using increased toxicity as a marker for a protein that is required for DSB repair. Although useful for identifying novel cellular proteins involved in maintaining genome fidelity, functional analysis requires the determination of whether the protein of interest promotes localization, formation, or resolution of repair complexes. 
The accumulation of repair proteins can be readily detected as distinct nuclear foci by immunofluorescence microscopy. Thus, association and disassociation of these proteins at sites of DNA damage can be accessed by observing these nuclear foci at representative intervals after the induction of double-strand DNA breaks. This approach can also identify mis-localized repair factor proteins, if repair defects do not simultaneously occur with incomplete delays in repair. In this scenario, long-lasting double-strand DNA breaks can be engineered by expressing a rare cutting endonuclease (e.g., I-SceI) in cells where the recognition site for the said enzyme has been integrated into the cellular genome. The resulting lesion is particularly hard to resolve as faithful repair will reintroduce the enzyme's recognition site, prompting another round of cleavage. As a result, differences in the kinetics of repair are eliminated. If repair complexes are not formed, localization has been impeded. This protocol describes the methodology necessary to identify changes in repair kinetics as well as repair protein localization.

Repair of double-strand DNA breaks is a dynamic process, requiring not only formation of repair complexes at the breaks, but also their resolution after the lesion is addressed. Here, we use immunofluorescence microscopy for transient and long-lasting double-stranded breaks as a tool to dissect this genome maintenance mechanism.

The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair ...

Quantitative, Real-time Analysis of Base Excision Repair Activity in Cell Lysates Utilizing Lesion-specific Molecular Beacons

We describe a method for the quantitative, real-time measurement of DNA glycosylase and AP endonuclease activities in cell nuclear lysates using base excision repair (BER) molecular beacons. The substrate (beacon) is comprised of a deoxyoligonucleotide containing a single base lesion with a 6-Carboxyfluorescein (6-FAM) moiety conjugated to the 5'end and a Dabcyl moiety conjugated to the 3' end of the oligonucleotide. The BER molecular beacon is 43 bases in length and the sequence is designed to promote the formation of a stem-loop structure with 13 nucleotides in the loop and 15 base pairs in the stem1,2. When folded in this configuration the 6-FAM moiety is quenched by Dabcyl in a non-fluorescent manner via F&ouml;rster Resonance Energy Transfer (FRET)3,4. The lesion is positioned such that following base lesion removal and strand scission the remaining 5 base oligonucleotide containing the 6-FAM moiety is released from the stem. Release and detachment from the quencher (Dabcyl) results in an increase of fluorescence that is proportionate to the level of DNA repair. By collecting multiple reads of the fluorescence values, real-time assessment of BER activity is possible. The use of standard quantitative real-time PCR instruments allows the simultaneous analysis of numerous samples. The design of these BER molecular beacons, with a single base lesion, is amenable to kinetic analyses, BER quantification and inhibitor validation and is adaptable for quantification of DNA Repair activity in tissue and tumor cell lysates or with purified proteins. The analysis of BER activity in tumor lysates or tissue aspirates using these molecular beacons may be applicable to functional biomarker measurements. Further, the analysis of BER activity with purified proteins using this quantitative assay provides a rapid, high-throughput method for the discovery and validation of BER inhibitors.

We describe a method for the quantitative, real-time measurement of DNA glycosylase and AP endonuclease activities in cell nuclear lysates. The assay yields rates of DNA Repair activity amenable to kinetic analysis and is adaptable for quantification of DNA Repair activity in tissue and tumor lysates or with purified proteins.

We describe a method for the quantitative, real-time measurement of DNA glycosylase and AP endonuclease activities in cell nuclear lysates using base ...

Visualization of miniSOG Tagged DNA Repair Proteins in Combination with Electron Spectroscopic Imaging (ESI)

The limits to optical resolution and the challenge of identifying specific protein populations in transmission electron microscopy have been obstacles in cell biology. Many phenomena cannot be explained by in vitro analysis in simplified systems and need additional structural information in situ, particularly in the range between 1 nm and 0.1 &#181;m, in order to be fully understood. Here, electron spectroscopic imaging, a transmission electron microscopy technique that allows simultaneous mapping of the distribution of proteins and nucleic acids, and an expression tag, miniSOG, are combined to study the structure and organization of DNA double-strand break repair foci.

Visualization of miniSOG Tagged DNA Repair Proteins in Combination with Electron Spectroscopic Imaging ESI

Electron spectroscopic imaging can image and distinguish nucleic acid from protein at nanometer resolution. It can be combined with the miniSOG system, which is able to specifically label tagged proteins in transmission electron microscopy samples. We illustrate the use of these technologies using double-strand break repair foci as an example.

The limits to optical resolution and the challenge of identifying specific protein populations in transmission electron microscopy have been obstacles in ...

Advanced Confocal Microscopy Techniques to Study Protein-protein Interactions and Kinetics at DNA Lesions

Local microirradiation with lasers represents a useful tool for studies of DNA-repair-related processes in live cells. Here, we describe a methodological approach to analyzing protein kinetics at DNA lesions over time or protein-protein interactions on locally microirradiated chromatin. We also show how to recognize individual phases of the cell cycle using the Fucci cellular system to study cell-cycle-dependent protein kinetics at DNA lesions. A methodological description of the use of two UV lasers (355 nm and 405 nm) to induce different types of DNA damage is also presented. Only the cells microirradiated by the 405-nm diode laser proceeded through mitosis normally and were devoid of cyclobutane pyrimidine dimers (CPDs). We also show how microirradiated cells can be fixed at a given time point to perform immunodetection of the endogenous proteins of interest. For the DNA repair studies, we additionally describe the use of biophysical methods including FRAP (Fluorescence Recovery After Photobleaching) and FLIM (Fluorescence Lifetime Imaging Microscopy) in cells with spontaneously occurring DNA damage foci. We also show an application of FLIM-FRET (Fluorescence Resonance Energy Transfer) in experimental studies of protein-protein interactions.

Laser microirradiation is a useful tool for studies of DNA repair in living cells. A methodological approach for the use of UVA lasers to induce various DNA lesions is shown. We have optimized a method for local microirradiation that maintains the normal cell cycle; thus, irradiated cells proceed through mitosis.

Local microirradiation with lasers represents a useful tool for studies of DNA-repair-related processes in live cells. Here, we describe a methodological ...

Visualization of DNA Repair Proteins Interaction by Immunofluorescence

Mammalian cells are constantly exposed to chemicals, radiations, and naturally occurring metabolic by-products, which create specific types of DNA insults. Genotoxic agents can damage the DNA backbone, break it, or modify the chemical nature of individual bases. Following DNA insult, DNA damage response (DDR) pathways are activated and proteins involved in the repair are recruited. A plethora of factors are involved in sensing the type of damage and activating the appropriate repair response. Failure to correctly activate and recruit DDR factors can lead to genomic instability, which underlies many human pathologies including cancer. Studies of DDR proteins can provide insights into genotoxic drug response and cellular mechanisms of drug resistance.
There are two major ways of visualizing&#160;proteins in vivo: direct observation, by tagging the protein of interest with a fluorescent protein and following it by live imaging, or indirect immunofluorescence on fixed samples. While visualization of fluorescently tagged proteins allows precise monitoring over time, direct tagging in N- or C-terminus can interfere with the protein localization or function. Observation of proteins in their unmodified, endogenous version is preferred. When DNA repair proteins are recruited to the DNA insult, their concentration increases locally and they form groups, or &#8220;foci&#8221;, that can be visualized by indirect immunofluorescence using specific antibodies.
Although detection of protein foci does not provide a definitive proof of direct interaction, co-localization of proteins in cells indicates that they regroup to the site of damage and can inform of the sequence of events required for complex formation. Careful analysis of foci spatial overlap in cells expressing wild type or mutant versions of a protein can provide precious clues on functional domains important for DNA repair function. Last, co-localization of proteins indicates possible direct interactions that can be verified by co-immunoprecipitation in cells, or direct pulldown using purified proteins.

Following DNA damage, human cells activate essential repair pathways to restore the integrity of their genome. Here, we describe the method of indirect immunofluorescence as a means to detect DNA repair proteins, analyze their spatial and temporal recruitment, and help interrogate protein-protein interaction at the sites of DNA damage.

Mammalian cells are constantly exposed to chemicals, radiations, and naturally occurring metabolic by-products, which create specific types of DNA ...

Laser Micro-Irradiation to Study DNA Recruitment During S Phase

DNA damage repair maintains the genetic integrity of cells in a highly reactive environment. Cells may accumulate various types of DNA damage due to both endogenous and exogenous sources such as metabolic activities or UV radiation. Without DNA repair, the cell's genetic code becomes compromised, undermining the structures and functions of proteins and potentially causing disease. 
Understanding the spatiotemporal dynamics of the different DNA repair pathways in various cell cycle phases is crucial in the field of DNA damage repair. Current fluorescent microscopy techniques provide great tools to measure the recruitment kinetics of different repair proteins after DNA damage induction. DNA synthesis during the S phase of the cell cycle is a peculiar point in cell fate regarding DNA repair. It provides a unique window to screen the entire genome for mistakes. At the same time, DNA synthesis errors also pose a threat to DNA integrity that is not encountered in non-dividing cells. Therefore, DNA repair processes differ significantly in S phase as compared to other phases of the cell cycle, and those differences are poorly understood. 
The following protocol describes the preparation of cell lines and the measurement of dynamics of DNA repair proteins in S phase at locally induced DNA damage sites, using a laser-scanning confocal microscope equipped with a 405 nm laser line. Tagged PCNA (with mPlum) is used as a cell cycle marker combined with an AcGFP-labeled repair protein of interest (i.e., EXO1b) to measure the DNA damage recruitment in S phase.

This protocol describes a non-invasive method to efficiently identify S-phase cells for downstream microscopy studies, such as measuring DNA repair protein recruitment by laser micro-irradiation.

DNA damage repair maintains the genetic integrity of cells in a highly reactive environment. Cells may accumulate various types of DNA damage due to both ...

Nucleotide Excision Repair

<h4>Overview</h4>

Exposure to mutagens can damage DNA and result in bulky lesions that distort the double-helix structure or impede proper transcription. Damaged DNA can be detected and repaired in a process called nucleotide excision repair (NER). NER employs a set of specialized proteins that first scan DNA to detect a damaged region. Next, NER proteins separate the strands and excise the damaged area. Finally, they coordinate the replacement with new, matching nucleotides.

<h4>DNA distortion and damage</h4>

Cells are regularly exposed to mutagens&mdash;factors in the environment which can damage DNA and generate mutations. UV radiation is one of the most common mutagens and is estimated to introduce a significant number of changes to DNA. These include bends or kinks in the structure which can block DNA replication or transcription. If these errors are not fixed, the damage can cause mutations which in turn can result in cancer or disease depending on which sequences are disrupted.

<h4>Identification and repair of damaged regions</h4>

Nucleotide excision repair relies on specific protein complexes to recognize damaged regions of DNA and flag them for removal and repair. In prokaryotes, the process involves three proteins&mdash;UvrA, UvrB, and UvrC. The first two proteins work together as a complex, traveling along the DNA strands to detect any physical aberrations.

Once identified, the strands at the damaged location are separated, and endonuclease enzymes such as UvrC cut and excise the affected region. DNA polymerase fills the gap with new nucleotides, and then the DNA ligase enzyme seals the edges between the new and old DNA.

<h4>Mutations in NER have severe consequences</h4>

In prokaryotes, the NER complex consists of the three Uvr proteins, but in eukaryotes, more than a dozen proteins operate to regulate DNA repair. In humans, mutations in the NER pathway can cause diseases such as xeroderma pigmentosum (XP), which is associated with a 2000-fold increase in the incidence of skin cancer. Individuals suffering from XP are highly sensitive to UV exposure and can develop severe skin burns after just a few minutes of exposure to sunlight. Additionally, XP patients can show signs of premature aging and often develop neurological abnormalities. Without a properly working repair mechanism, DNA damage can accumulate and lead to abnormal cell death or potentially cancerous tumors.

DNA Damage and Nucleotide Excision Repair

Overview

Exposure to mutagens can damage DNA and result in bulky lesions that distort the double-helix structure or impede proper transcription. Damaged ...

Atomic Force Microscopy Investigations of DNA Lesion Recognition in Nucleotide Excision Repair

Summary

Explore More Videos

Chapters in this video

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

Laser Microirradiation to Study In Vivo Cellular Responses to Simple and Complex DNA Damage

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

Characterizing DNA Repair Processes at Transient and Long-lasting Double-strand DNA Breaks by Immunofluorescence Microscopy

Quantitative, Real-time Analysis of Base Excision Repair Activity in Cell Lysates Utilizing Lesion-specific Molecular Beacons

Visualization of miniSOG Tagged DNA Repair Proteins in Combination with Electron Spectroscopic Imaging (ESI)

Advanced Confocal Microscopy Techniques to Study Protein-protein Interactions and Kinetics at DNA Lesions

Visualization of DNA Repair Proteins Interaction by Immunofluorescence

Laser Micro-Irradiation to Study DNA Recruitment During S Phase

Nucleotide Excision Repair