Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

The X-ray diffraction datasets were collected at beamline 7A of the Pohang Accelerator Laboratory (Korea). This study was supported by the Basic Science Research Program administered through the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT &amp; Future Planning (2015R1A1A01057574 to MH).

1. Recombinant Protein Production and Purification of rBC1531
<ol>
	<li>Preparation of a recombinant BC1531 protein (rBC1531)-expression plasmid
	<ol>
		<li>Prepare genomic DNA of B. cereus10.</li>
		<li>Amplify the bc1531 gene from a template of B. cereus genomic DNA by polymerase chain reaction (PCR), using forward and reverse primers (see the Materials List) to create BamHI and SalI restriction enzyme sites, respectively<sup class=...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

Recombinant protein expression is widely used to overcome problems associated with natural protein sources, such as limited protein quantities and harmful contamination. Moreover, in studies of pathogenic genes and proteins, an alternative laboratory strain that does not require additional safety precautions can be utilized. For example, Bacillus cereus is a useful model for studying Bacillus anthracis due to their close evolutionary relationship1.
B. anthracis is an obligate pathogen that causes fatal inhalational anthrax in humans and livestock and can potentially be used as a bioweapon2. Thus, laboratory studies on B. anthracis are strictly regulated by the US Centers for Disease Control, requiring biosafety level 3 (BSL-3) practices, which mandate that the laboratory area be segregated with negative room pressure. In contrast to B. anthracis, B. cereus is categorized as a BSL-1 agent and thus has minimal safety concerns. B. cereus is an opportunistic pathogen that, upon infection, causes food poisoning that can be treated without medical assistance. However, because B. cereus shares many critical genes with B. anthracis, the functions of B. anthracis proteins can be studied using the corresponding homologs of B. cereus1.
The ba1554 - ba1558 gene cluster of B. anthracis is highly conserved with the bc1531- bc1535 cluster of B. cereus, as well as with the bt1364-bt1368 cluster of Bacillus thuringiensis, in terms of gene organization and sequence. Furthermore, the first genes (ba1554, bc1531, and bt1364) of the respective clusters are absolutely conserved (i.e., 100% nucleotide sequence identity), implying a critical role of the gene product in the Bacillus species. Due to its location in these gene clusters, ba1554 was misidentified as a putative transcription regulator3. However, amino acid sequence analysis of the ba1554 product indicates that it belongs to the MazG family, which has nucleotide pyrophosphohydrolase activity and is not associated with transcription factor activity4,5. Although proteins belonging to the MazG family are diverse with respect to overall sequence and length, they share a common ~100-residue MazG domain characterized by an EXXE12-28EXXD motif (&#34;X&#34; stands for any amino acid residue, and the number indicates the number of X residues).
The MazG domain does not always directly account for a certain catalytic activity. A MazG member from Escherichia coli (EcMazG) possesses two MazG domains, but only the C-terminal MazG domain is enzymatically active6. Moreover, the substrate specificity of MazG enzymes varies from non-specific nucleoside triphosphates (for EcMazG) to specific dCTP/dATP (for integrin-associated MazG) and dUTP (for dUTPases)6,7,8,9. Therefore, biophysicochemical analyses of the BA1554 protein are necessary to confirm its NTPase activity and to decipher its substrate specificity.
Here, we provide a step-by-step protocol that most laboratories without a BSL-3 facility can follow to characterize the protein product of the B. cereus bc1531 gene, which is an ortholog of B. anthracis ba1554, at the molecular level. Briefly, recombinant BC1531 (rBC1531) was expressed in E. coli and purified using an affinity tag. For X-ray crystallographic experiments, the crystallization conditions of the rBC1531 protein were screened and optimized. To assess the enzymatic activity of rBC1531, NTPase activity was monitored colorimetrically to avoid radioactively labeled nucleotides that have been conventionally used. Finally, analyses of the obtained biophysicochemical data enabled us to determine the oligomerization state and catalytic parameters of rBC1531, as well as to obtain X-ray diffraction data from the rBC1531 crystal.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis is an obligate pathogen that causes fatal inhalational anthrax. Bacillus cereus is considered a useful model for studying B. anthracis due to its close evolutionary relationship. The gene cluster ba1554 - ba1558 of B. anthracis is highly conserved with the bc1531- bc1535 cluster in B. cereus, as well as with the bt1364-bt1368 cluster in Bacillus thuringiensis, indicating the critical role of the associated genes in the Bacillus genus. This manuscript describes methods to prepare and characterize a protein product of the first gene (ba1554) from the gene cluster in B. anthracis using a recombinant protein of its ortholog in B. cereus, bc1531.

Characterization of the protein of interest in this study began by preparing a sufficient quantity of recombinant B. cereus bc1531 (rBC1531) protein, preferably more than several milligrams. The DNA fragment encoding the BC1531 protein was prepared by PCR using the genomic DNA of B. cereus as a template, as it contains orthologous genes identical to ba1554. rBC1531 was overexpressed as a soluble protein in E. coli cells. The rBC1531 protein was expresse...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis is the obligate pathogen of fatal inhalational anthrax, so studies of its genes and proteins are strictly regulated. An alternative approach is to study orthologous genes. We describe biophysicochemical studies of a B. anthracis ortholog in B. cereus, bc1531, requiring minimal experimental equipment and lacking serious safety concerns.

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...