X 선 회절 데이터 세트는 포항 가속기 연구소 (한국)의 빔라인 7A에서 수집되었다. 이 연구는 과학 기술부, ICT 및 미래 계획 (2015R1A1A01057574, MH)이 자금을 지원하는 국립 과학 재단 (NRF)을 통해 관리되는 기초 과학 연구 프로그램의 지원을 받았다.

1. rBC1531의 재조합 단백질 생산 및 정제 <ol><li> 재조합 BC1531 단백질 (rBC1531) - 발현 플라스미드 <ol><li> B. cereus 10 의 게놈 DNA를 준비합니다. </li><li> Bam HI 및 Sal I 제한 효소 부위를 각각 생성하기 위해 정방향 및 역방향 프라이머 (물질 목록 참조)를 사용하여 폴리머 라제 연쇄 반응 (PCR)에 의해 B. cereus 게놈 DNA의 템플레이트로부터 bc1531 유전자를 증폭시킨다. </li><li> PCR 제품과 수정 된 pET49b 벡터 (pET49bm)를 BamHI 및 Sal I을 사용하여 분해하고 11 . </li><li> 설명 된대로 10 μL 반응에서 T4 DNA 리가 제를 사용하여 1.1.3 단계에서 소화 PCR 제품과 벡터 (3 : 1 비율)를 섞는다. 18 ° C에서 30 분 동안 품어 라. </li><li> chemica 50 μL에 연결 반응 3 μL 피펫유능한 E. coli DH5α 세포를 튜브에 넣습니다. 피펫 팅을 위아래로 부드럽게 혼합하고 얼음에 30 분 동안 두십시오. 42 ° C에서 45 초 동안 열충격. Luria - Bertani (LB) 배지 1 ML을 추가하고 격렬하게 (250 rpm, 37 ° C, 45 분) 떨고있는 동안 세포를 성장. </li><li> 단계 1.1.6에서 형질 전환 한 세포 100 μL를 취해 100 μg / mL kanamycin (칸)이 들어있는 LB- 한천 플레이트에 뿌립니다. 37 ~ 18 시간 동안 ~ 18 시간 동안 품어 낸다. </li><li> 멸균 팁을 사용하여 식민지를 선택하고 100 μg / ML 칸과 LB 미디어 3 ML의 세포를 성장; 격렬히 흔들어주세요 (250 rpm, 37 ° C, 18 h). </li><li> 10 설명한대로 알칼리성 SDS의 lysis 방법을 사용하여 플라스미드 DNA를 준비합니다. </li><li> DNA sequencing 12 를 사용하여 rBC1531 발현 구조의 염기 서열을 확인합니다. </li></ol></li><li> rBC1531 단백질의 과발현 <ol><li> rBC1531-exp로 대장균 BL21 (DE3) 균주를 재조합과발현을 위해 단계 1.1.5-1.1.6에 기술 된대로 레 시온 플라스미드를 사용한다. </li><li> 식민지를 선택하고 50 μg / ML 칸 (LB + 칸)을 포함하는 LB 매체의 10 ML에서 그것을 성장; 37 ° C에서 18 시간 동안 격렬히 흔든다. </li><li> 1L의 LB + Kan 배지에 밤새 배양 10 mL를 접종하고 OD 600 (600 nm에서의 광학 밀도)이 ~ 0.7에이를 때까지 37 ℃에서 성장시킨다. </li><li> 온도를 18 ° C로 낮추고 재조합 단백질 발현을 위해 1 mM의 최종 농도에서 배양 물에 이소 프로필 β-D-1-thiogalactopyranoside (IPTG)를 첨가하기 위해 약 15 분 동안 얼음물에서 배양합니다. 18 ~ 18 ℃에서 16 ~ 18 시간 동안 배양하십시오. </li></ol></li><li> rBC1531의 정제 <ol><li> 원심 분리 (5,000 xg, 4 ° C, 30 분)에 의해 세포를 수확. 세포를 방해하지 않도록주의 깊게 상등액을 버린다. 10 MM 이미 다졸이 들어있는 인산염 완충 식염수 (PBS) 용액 50 mL에 세포를 재현 탁합니다. </li><li> 세포 lysates (시간 : 2 분 30 초, 사이클 : 5 초, 사이클 오프 : 10 초, 진폭 : 38 %)의 과열을 방지하기 위해 얼음 sonication에 의해 세포를 두 번 Lyse. </li><li> 원심 분리 (~ 25,000 xg, 4 ℃, 30 분)에 의해 세포 용 해물을 맑게한다. </li><li> 10 ML 이미 다졸 및 중력 흐름을 포함하는 60 ML 니켈 비즈 3 ML을 섞어 여분의 버퍼 2.5 X 10cm 유리 크로마토 그래피 칼럼에 평형 니켈 구슬을 해결합니다. </li><li> 피펫은 사전에 평형 니켈 구슬과 칼럼에 1.3.3에서 뜨는을 전송하고 저속 (~ 20 RPM)에서 회전 바퀴에 4 시간에 2 시간 품어. </li><li> 뜨는를 중력에 의해 배수하고 10 MM 이미 다졸을 포함하는 PBS 100 ML로 열에있는 세 번 니켈 구슬을 씻어주십시오. </li><li> 250 mM 이미 다졸을 함유 한 PBS 4 x 5 mL를 적용하여 rBC1531 단백질을 용출시켰다. </li><li> 1.3.7 단계에서 15 μL의 용리액을 취해 15 % SDS-PAGE에서이를 수행하십시오. 단백질 밴드를 시각화합니다.Coomassie blue 염색법을 사용하여 젤 10 . </li></ol></li><li> 트롬빈 단백 분해에 의한 rBC1531 단백질의 친화력 태그 제거 <ol><li> 분주를 투석 튜브 (분자량 차단 : 3 kDa)에 피펫과 트롬빈 절단 호환 버퍼 (20 MM HEPES, 산도 7.4, 150 MM NaCl 및 1.5 MM β - mercaptoethanol)의 4 L를 포함하는 비커에 튜브를 놓으십시오. 4 ° C에서 하룻밤. </li><li> 분수를 피펫과 원뿔 튜브로 전송합니다. </li><li> 280 nm에서 흡광도를 측정하고 설명 된 바와 같이 rBC1531 단백질 농도를 추정. </li><li> 0.5 mL 튜브에서 rBC1531 50 μg을 채취하고 다양한 양의 트롬빈 ( 즉, 2, 1, 0.6 및 0.3 단위)을 첨가하십시오. rBC1531과 트롬빈 반응을 20 ℃에서 ~ 3 시간 동안 배양하여 N- 말단 친 화성 태그를 절단하는데 필요한 트롬빈의 최소량을 결정한다. </li><li> rBC1531 및 트롬빈 반응을 15 %SDS-PAGE로 확인하고 N 말단 친화력 태그를 완전히 소화하고 태그가없는 rBC1531을 생산하는 트롬빈의 최소량 ( 예 : rBC1531 50 μg 당 0.3 단위의 트롬빈)을 결정합니다. </li><li> 10mg의 rBC1531 단백질과 60 단위의 트롬빈을 15 mL 튜브에 넣고 20 ℃에서 3 시간 동안 트롬빈 - 단백질 분해 반응을 일으킨다. </li><li> 설명 된대로 분자량 및 용출 부피의 표준 곡선을 만들기 위해 크기 - 제외 크로마토 그래피 (SEC) 칼럼에 겔 여과 표준을 적용하십시오. </li><li> 원심 분리 필터 튜브 (분자량 차단 : 3 kDa)에 1.4.6 단계의 트롬빈 소화 rBC1531 단백질을 넣고 4,000 ml에서 3,000 g으로 원심 분리하여 5 mL 미만의 부피로 줄입니다. </li><li> 농도가 rBC1531 단백질을 SEC 칼럼에 적용하고 튜브 당 0.5 mL로 60 개의 용출 분획물을 수집하십시오 13 . </li><li> 각 분획물 15 μL를 취하여 15 % SDS-PAGE에서 실행하고,Coomassie 염색 용액 (0.15 % (w / v) Coomassie 브릴리언트 블루, 40 % (v / v) 메탄올 및 10 % (v / v) 빙초산)을 사용하여 겔을 만들었다. </li><li> rBC1531을 포함하는 분수를 피펫 씩 하나의 튜브에 모으십시오. </li></ol></li></ol> 2. 결정화 스크리닝 및 rBC1531의 최적화 <ol><li> rBC1531 단백질 결정화를위한 스크리닝 조건 <ol><li> 1.4.8에서 설명한대로 원심 분리 필터 튜브를 사용하여 단계 1.4.11에서 rBC1531를 ~ 18.5 mg / mL까지 농축합니다. </li><li> 96- 웰 앉아 드롭 결정화 플레이트의 웰에 각 결정화 스크리닝 용액 (섹션 2.2 참조 ) 을 50 μL 씩 첨가한다. 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 놓습니다. 용액 전체 0.5 μL와 단백질 용액을 섞어서 전체 플레이트에 대한 과정을 반복하십시오. </li><li> 깨끗한 접착 필름으로 판을 덮으십시오.18 ° C에 96 - 웰 플레이트를 놓고 증기 확산을 허용합니다. </li><li> 광학 현미경을 사용하여 20 ~ 40 배율로 방울을 스캔하여 2-3 주 동안 매일 크리스탈 형성을 모니터링하십시오. </li><li> 얻은 rBC1531 단백질 결정을 사용하여 X- 선 회절 데이터 12 을 수집하십시오. </li></ol></li><li> rBC1531 결정화 조건의 최적화 <ol><li> 선택한 초기 결정화 조건 용액 ( 예 : 0.1 M sodium cacodylate, pH 6.5 및 1.0 M sodium citrate) 500 μL를 준비하고 앉은 방울을 위해 24-well crystallization plate를 채 웁니다. </li><li> 앉아있는 침대에 18.5 mg / mL rBC1531 단백질 용액 0.5 μL를 넣고 잘 용액 0.5 μL와 섞은 다음 즉시 투명 필름으로 판을 덮습니다. 플레이트를 18 ° C에 놓습니다. </li><li> 가벼운 현미경으로 1 주일 동안 결정 성장을 관찰하십시오. </li><li> pH를 변화시켜 다양한 결정화 조건을 최적화하십시오 ( 즉,., pH 5.5-6.8)를 사용하고 구연산 나트륨의 염농도 ( 즉, 0.9-1.2 M)를 변경하여 단핵 결정을 얻는다. 1 주일 동안 결정 성장을 모니터하고 X 선 회절 데이터를 수집하십시오. 12 . </li></ol></li></ol> 3. rBC1531의 뉴 클레오 시드 트리 포스파타제 (NTPase) 활성의 특성 규명 <ol><li> 무기 인산염 비례 검정의 검증 <ol><li> 피로 인산염 (100 MM)의 주식을 준비하고 반응 버퍼 (20 MM HEPES, 산도 7.4, 150 μl)에 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100 및 250 μm의 최종 농도로 희석 mM NaCl 및 2 mM MgCl 2 )로 2 번 96- 웰 플레이트에서 배양 하였다. 첫번째 판을 대조군으로 사용하십시오 (이것은 피로 포스파타제를 포함하지 않습니다). 두 번째 플레이트에 3.1.2 절에서 설명한대로 작업 플레이트로 pyrophosphatase가 포함되어 있는지 확인하십시오. </li><li> Saccharomyces cerevisiae 무기 p 0.01 단위 첨가Yrophosphatase (1 μL)를 작용 플레이트의 웰에 넣고 20 ° C에서 30-60 분 동안 배양합니다. </li><li> 몰리브덴 산 암모늄 (0.86 % v / v)과 아스코르브 산 (14 % v / v)을 7 : 3의 비율로 혼합하여 몰리브덴 산 용액을 제조한다. 몰리브덴 산 용액 16 μL를 작업 및 대조 우물에 모두 넣고 15 분 동안 기다린다. </li><li> 690 nm (OD 690 nm)에서 광학 밀도를 읽습니다. </li></ol></li><li> 비색 NTPase 분석 <ol><li> 100 mM 뉴 클레오 사이드 트리 포스페이트 (NTP) 기질을 준비하고 검정 완충액 (20 mM HEPES, pH 7.4) 중 180 μL에서 원하는 농도 ( 예 : 0, 0.2, 4.4, 11, 22, 44, 88, 132 μM) pH 7.4, 150 mM NaCl 및 2 mM MgCl 2 )에 용해시켰다. </li><li> 96- 웰 플레이트에서 반응 당 200 μL까지 단계 3.2.1에서 rBC1531 (1.5 mM) 및 NTP 기질 20 μg을 첨가하고 잘 혼합하기 위해 위아래로 피펫 팅하십시오. 뚜껑을하여 플레이트를 덮고 30 분 동안 37 ° C 배양기에 두십시오기질 가수 분해 반응을 수행한다. </li><li> 플레이트를 70 ° C의 수 욕조에 옮기고 15 분 동안 방치하여 rBC1531 매개 촉매 반응을 중지시킵니다. </li><li> S. cerevisiae 무기 pyrophosphatase (1 μL) 0.01 단위를 반응 판 (단계 3.2.3)의 각 웰에 첨가하고 20 ℃에서 30 분 동안 배양한다. 몰리브덴 산 용액 16 μL를 반응 판에 첨가하여 색상을 만듭니다 (~ 15 분). OD 690nm 에서 읽으십시오. </li><li> 12 에서 설명한대로 Michaelis-Menten 방정식을 사용하여 분석하십시오. </li></ol></li></ol>

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

저자는 공개 할 것이 없습니다.

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

재조합 단백질 발현은 제한된 단백질 양 및 유해한 오염과 같은 천연 단백질 공급원과 관련된 문제점을 극복하기 위해 널리 사용됩니다. 또한 병원성 유전자와 단백질 연구에서 추가적인 안전 예방 조치가 필요없는 대체 실험실 균주를 이용할 수 있습니다. 예를 들어, Bacillus cereus 는 Bacillus anthracis 를 가까운 진화 적 관계 로 연구하는데 유용한 모델이다. B. 탄저균은 사람과 가축에서 치명적인 흡입 탄저병을 일으키는 필수 병원체이며 잠재적으로 생물 표지 2 로 사용될 수 있습니다. 따라서 B. anthracis 에 대한 실험실 연구는 BSL-3 (생물 안전성 수준 3) 관행을 요구하는 미국 질병 통제 센터 (Centers for Disease Control)에 의해 엄격히 규제되며 실험실 구역을 음의 실내 압력으로 격리하도록 요구합니다. B. anthracis 와는 대조적으로 </eB. cereus 는 BSL-1 약제로 분류되어 안전에 대한 염려가 거의 없다. B. cereus 는 감염시 식중독을 일으키는 기회 주의적 병원균으로 의료 지원없이 치료할 수 있습니다. 그러나 B. cereus 는 B. anthracis 와 많은 중요한 유전자를 공유하기 때문에 B. cereus 1의 동족체를 사용하여 B. anthracis 단백질의 기능을 연구 할 수 있습니다. B. anthracis 의 ba1554 - ba1558 유전자 클러스터는 bc1531 - bc1535 클러스터와 잘 보존되어있다. Bacillus thuringiensis 의 bt1364-bt1368 클러스터뿐만 아니라 B. cereus 의 유전자 조직 및 염기 서열에 관한 것이다. 또한, 각 클러스터의 첫 번째 유전자 ( ba1554 , bc1531 및 bt1364 )는 절대적으로 보존되어 있습니다 ( 예 : 100 % 염기 서열 동일성). implyiBacillus 종에서 유전자 산물의 결정적인 역할. 이러한 유전자 클러스터에서의 위치 때문에, ba1554 는 추정 전사 조절 자로 오인되었다. 그러나 ba1554 산물의 아미노산 서열 분석은 MazG family에 속하는 것으로 나타 났는데, 이는 nucleotide pyrophosphohydrolase 활성을 가지고 있으며 전사 인자 활성과 관련이 없다 4 , 5 . MazG 계열에 속하는 단백질은 전체 서열과 길이가 다양하지만 EXXE 12-28 EXXD 모티프로 특징 지워지는 ~ 100 잔기의 MazG 도메인을 공유합니다 ( &quot;X&quot;는 아미노산 잔기를 의미하고 번호 X 잔기의 수를 나타낸다). MazG 도메인은 특정 촉매 활동을 직접적으로 설명하지는 않습니다. Escherichia coli (EcMazG)의 MazG 구성원은 2 개의 MazG 도메인을 보유하고 있지만C 말단 MazG 도메인은 효소 적으로 활성이다 6 . 또한, MazG 효소의 기질 특이성은 비특이적 뉴 클레오 시드 트리 포스페이트 (EcMazG의 경우)에서 특정 dCTP / dATP (인테그린 관련 MazG의 경우) 및 dUTP (dUTPases의 경우) 6 , 7 , 8 , 9로 다양합니다. 따라서 BA1554 단백질의 생물 물리 화학적 분석은 NTPase 활성을 확인하고 기질 특이성을 해독하기 위해 필요하다. 여기에 BSL-3 시설이없는 대부분의 실험실이 분자 수준에서 B. anthracis ba1554 의 ortholog 인 B. cereus bc1531 유전자의 단백질 생성물을 특성화하기 위해 따라갈 수있는 단계별 프로토콜이 제공됩니다. 간단히, 재조합 BC1531 (rBC1531)을 대장균 에서 발현 시키고 친 화성 태그를 사용하여 정제 하였다. X 선 결정학 실험에서 결정rBC1531 단백질의 zation 조건을 스크리닝하고 최적화 하였다. rBC1531의 효소 활성을 평가하기 위해, NTPase 활성을 비색계로 모니터링하여 통상적으로 사용 된 방사성 표지 된 뉴클레오타이드를 회피 하였다. 마지막으로, 얻어진 생 물리 화학적 데이터의 분석은 rBC1531 결정으로부터 X- 선 회절 데이터를 얻는 것뿐만 아니라 rBC1531의 올리고머 화 상태 및 촉매 매개 변수를 결정할 수있게했다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

진정한 병원체에서 유전자와 단백질을 연구 할 때 안전 제한과 규제를 극복하기 위해 동질성을 연구 할 수 있습니다. Bacillus anthracis 는 치명적인 흡입 탄저병을 일으키는 절대 병원균입니다. Bacillus cereus 는 B. anthracis 를 가까운 진화 관계로 연구하는 데 유용한 모델로 간주됩니다. B. anthracis 의 유전자 클러스터 ba1554 - ba1558 은 Bacillus thuringiensis 의 bt1364 - bt1368 클러스터뿐만 아니라 B. cereus 의 bc1531 - bc1535 클러스터와 잘 보존되어 있으며 Bacillus 속의 관련 유전자의 중요한 역할을 나타낸다. 이 원고는 B. cereus , bc1531 에서 ortholog의 재조합 단백질을 사용하여 B. anthracis 의 유전자 클러스터에서 첫 번째 유전자 ( ba1554 )의 단백질 생성물을 준비하고 특성화하는 방법을 설명합니다.

본 연구에서 목적 단백질의 특성화는 충분한 양의 재조합 B. cereus bc1531 (rBC1531) 단백질을, 바람직하게는 수 밀리그램 이상으로 제조함으로써 시작되었다. BC1531 단백질을 코딩하는 DNA 단편은 B. cereus 의 게놈 DNA를 주형으로 사용하는 PCR 법으로 ba1554와 동일한 orthologous gene을 포함하고 있으므로 준비 하였다. rBC1531은 대장균 에서 가용성 단백질로 과...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereus 의 B. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다.

재조합 단백질 발현, 결정화 및 생물 물리학 연구<em&gt; 바실러스</em&gt; 보존 된 뉴클레오티드 피로 인산화 효소, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

recombinant-protein-expression-crystallization-biophysical-studies

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

7.4K 조회수.  Yonsei University.  Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereus 의 B. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다. 

비디오: Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug used to treat depression and anxiety by binding to the serotonin transporter with high-affinity, blocking serotonin reuptake. Here we report an efficient procedure and a set of tools to stabilize, express, purify, and crystallize serotonin transporter-antibody complexes bound to S-citalopram and other antidepressants. Mutations which stabilize the serotonin transporter were identified using an S-citalopram binding assay. Serotonin transporter expressed in baculovirus-transduced HEK293S GnTI- cells, was reconstituted into proteoliposomes and used to raise high-affinity antibodies. We have developed a strategy to discover antibodies that are useful for structural studies. A straightforward approach for the expression of antibody fragments in Sf9 cells has also been established. Transporter-antibody complexes purified using this procedure are well-behaved and readily crystallize, producing complexes with S-citalopram that diffract X-rays to 3-4 &#197; resolution. The strategies developed here can be utilized to determine the structure of other challenging membrane proteins.

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

This manuscript describes how to screen for thermostabilizing mutations, purify the human serotonin transporter, generate high affinity antibodies, and crystallize the serotonin transporter-antibody complex bound to the antidepressant drug S-citalopram. This protocol can be adapted to the study of other challenging membrane transporters, receptors, and channels.

항온, 발현, 정제, 인간 세로토닌 전달체 결정화 바운드<em&gt; S</em&gt; 시탈 로프 람

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

연구

생화학

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a target for future development of inhibitors to decrease the virulence of the pathogen. To perform biophysical and structural characterization as well as inhibitor screening, large amounts of pure and active protein will be needed. We have developed a protocol for efficient production and purification of PPEP-1 by the use of E. coli as the expression host yielding sufficient amounts and purity of protein for crystallization and structure determination. Additionally, using microseeding, highly intergrown crystals of PPEP-1 can be grown to well-ordered crystals suitable for X-ray diffraction analysis. The methods could also be used to produce other recombinant proteins and to study the structures of other proteins producing intergrown crystals.

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Proline-proline endopeptidase-1 (PPEP-1) is a secreted metalloprotease and promising drug-target from the human pathogen Clostridium difficile. Here we describe all methods necessary for the production and structure determination of this protein.

생산, 결정화 및 구조 결정의<em&gt; C. 남과 어울리지 않는</em&gt; PPEP-1 Microseeding 및 아연 SAD를 통해

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

A Modified Yeast-one Hybrid System for Heteromeric Protein Complex-DNA Interaction Studies

Over the years, the yeast one-hybrid assay has proven to be an important technique for the identification and validation of physical interactions between proteins such as transcription factors (TFs) and their DNA target. The method presented here utilizes the underlying concept of the Y1H but is modified further to study and validate protein complexes binding to their target DNA. Hence, it is referred to as the modified yeast one-hybrid (Y1.5H) assay. This assay is cost effective and can be easily performed in a regular laboratory setting. Albeit using a heterologous system, the described method could be a valuable tool to test and validate the heteromeric protein complex binding to their DNA target(s) for functional genomics in any system of study, especially plant genomics.

The modified yeast one-hybrid assay described here is an extension of the classical yeast one-hybrid (Y1H) assay to study and validate the heteromeric protein complex-DNA interaction in a heterologous system for any functional genomics study.

이성질체 단백질 복합체 -DNA 상호 작용 연구를위한 수정 된 효모 원 하이브리드 시스템

Over the years, the yeast one-hybrid assay has proven to be an important technique for the identification and validation of physical interactions between ...

Application of Biolayer Interferometry (BLI) for Studying Protein-Protein Interactions in Transcription

A transcription factor&#160;(TF) is a protein that regulates gene expression by interacting with the RNA polymerase, another TF, and/or template DNA. GrgA is a novel transcription activator found specifically in the obligate intracellular bacterial pathogen Chlamydia. Protein pulldown assays using affinity beads have revealed that GrgA binds two &#963; factors, namely &#963;66 and &#963;28, which recognize different sets of promoters for genes whose products are differentially required at developmental stages. We have used BLI to confirm and further characterize the interactions. BLI demonstrates several advantages over pulldown: 1) It reveals real-time association and dissociation between binding partners, 2) It generates quantitative kinetic parameters, and 3) It can detect bindings that pulldown assays often fail to detect. These characteristics have enabled us to deduce the physiological roles of GrgA in gene expression regulation in Chlamydia, and possible detailed interaction mechanisms. We envision that this relatively affordable technology can be extremely useful for studying transcription and other biological processes.

Application of Biolayer Interferometry BLI for Studying Protein-Protein Interactions in Transcription

Interactions of transcription factors (TFs) with the RNA polymerase are usually studied using pulldown assays. We apply a Biolayer Interferometry (BLI) technology to characterize the interaction of GrgA with the chlamydial RNA polymerase. Compared to pulldown assays, BLI detects real-time association and dissociation, offers higher sensitivity, and is highly quantitative.

전사에서 단백질-단백질 상호 작용을 연구하기 위한 생체층 간섭측정기(BLI) 적용

A transcription factor&#160;(TF) is a protein that regulates gene expression by interacting with the RNA polymerase, another TF, and/or template DNA. GrgA ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this superfamily generally display multi-functionality, involving mainly hydrolase and decarboxylase mechanisms. This article presents a series of consecutive methods for the expression and purification of FAHD proteins, mainly FAHD protein 1 (FAHD1) orthologues among species (human, mouse, nematodes, plants, etc.). Covered methods are protein expression in E. coli, affinity chromatography, ion exchange chromatography, preparative and analytical gel filtration, crystallization, X-ray diffraction, and photometric assays. Concentrated protein of high levels of purity (&#62;98%) may be employed for crystallization or antibody production. Proteins of similar or lower quality may be employed in enzyme assays or used as antigens in detection systems (Western-Blot, ELISA). In the discussion of this work, the identified enzymatic mechanisms of FAHD1 are outlined to describe its hydrolase and decarboxylase bi-functionality in more detail.

Expression and purification of fumarylacetoacetate hydrolase domain-containing proteins is described with examples (expression in E. coli, FPLC). Purified proteins are used for crystallization and antibody production and employed for enzyme assays. Selected photometric assays are presented to display the multi-functionality of FAHD1 as oxaloacetate decarboxylase and acylpyruvate hydrolase.

Fumarylacetotate 하이드로 아세테이트 도메인 함유 단백질의 발현, 정제, 결정화 및 효소 어세포

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human cancers, is processed by farnesylation and carboxymethylation due to the presence of a &#39;CAAX&#39; box motif at the C-terminus. An engineered baculovirus system was used to express farnesylated and carboxymethylated KRAS4b in insect cells and has been described previously. Here, we describe the detailed, practical purification and biochemical characterization of the protein. Specifically, affinity and ion exchange chromatography were used to purify the protein to homogeneity. Intact and native mass spectrometry was used to validate the correct modification of KRAS4b and to verify nucleotide binding. Finally, membrane association of farnesylated and carboxymethylated KRAS4b to liposomes was measured using surface plasmon resonance spectroscopy.

Prenylation is an important modification on peripheral membrane binding proteins. Insect cells can be manipulated to produce farnesylated and carboxymethylated KRAS4b in quantities that enable biophysical measurements of protein-protein and protein-lipid interactions

완전히 가공된 재조합 KRAS4b: 판자및 메틸화 단백질을 분리하고 특성화

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

Strategic Screening and Characterization of the Visual GPCR-mini-G Protein Signaling Complex for Successful Crystallization

The key to determining crystal structures of membrane protein complexes is the quality of the sample prior to crystallization. In particular, the choice of detergent is critical, because it affects both the stability and monodispersity of the complex. We recently determined the crystal structure of an active state of bovine rhodopsin coupled to an engineered G protein, mini-Go, at 3.1 &#197; resolution. Here, we detail the procedure for optimizing the preparation of the rhodopsin&#8211;mini-Go complex. Dark-state rhodopsin was prepared in classical and neopentyl glycol (NPG) detergents, followed by complex formation with mini-Go under light exposure. The stability of the rhodopsin was assessed by ultraviolet-visible (UV-VIS) spectroscopy, which monitors the reconstitution into rhodopsin of the light-sensitive ligand, 9-cis retinal. Automated size-exclusion chromatography (SEC) was used to characterize the monodispersity of rhodopsin and the rhodopsin&#8211;mini-Go complex. SDS-polyacrylamide electrophoresis (SDS-PAGE) confirmed the formation of the complex by identifying a 1:1 molar ratio between rhodopsin and mini-Go after staining the gel with Coomassie blue. After cross-validating all this analytical data, we eliminated unsuitable detergents and continued with the best candidate detergent for large-scale preparation and crystallization. An additional problem arose from the heterogeneity of N-glycosylation. Heterologously-expressed rhodopsin was observed on SDS-PAGE to have two different N-glycosylated populations, which would probably have hindered crystallogenesis. Therefore, different deglycosylation enzymes were tested, and endoglycosidase F1 (EndoF1) produced rhodopsin with a single species of N-glycosylation. With this strategic pipeline for characterizing protein quality, preparation of the rhodopsin&#8211;mini-Go complex was optimized to deliver the crystal structure. This was only the third crystal structure of a GPCR&#8211;G protein signaling complex. This approach can also be generalized for other membrane proteins and their complexes to facilitate sample preparation and structure determination.

This report describes screening of different detergents for preparing the visual GPCR, rhodopsin, and its complex with mini-Go. Biochemical methods characterizing the quality of the complex at different stages during purification are demonstrated. This protocol can be generalized to other membrane protein complexes for their future structural studies.

성공적인 결정화를 위한 시각적 GPCR-mini-G 단백질 신호 복합체의 전략적 스크리닝 및 특성화

The key to determining crystal structures of membrane protein complexes is the quality of the sample prior to crystallization. In particular, the choice ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand its catalytic mechanism, allosteric behavior, and details of the enzymatic transformation of substrate to product in PLP-dependent enzymes. In this work, a novel expression system to produce the isolated &#945;- and isolated &#946;-subunit allowed the purification of high amounts of pure subunits and &#945;2&#946;2 StTS complex from the isolated subunits within 2 days. Purification was carried out by affinity chromatography followed by cleavage of the affinity tag, ammonium sulfate precipitation, and size exclusion chromatography (SEC). To better understand the role of key residues at the enzyme &#946;-site, site-direct mutagenesis was performed in prior structural studies. Another protocol was created to purify the wild type and mutant &#945;2&#946;2 StTS complexes. A simple, fast and efficient protocol using ammonium sulfate fractionation and SEC allowed purification of &#945;2&#946;2 StTS complex in a single day. Both purification protocols described in this work have considerable advantages when compared with previous protocols to purify the same complex using PEG 8000 and spermine to crystalize the &#945;2&#946;2 StTS complex along the purification protocol. Crystallization of wild type and some mutant forms occurs under slightly different conditions, impairing the purification of some mutants using PEG 8000 and spermine. To prepare crystals suitable for x-ray crystallographic studies several efforts were made to optimize crystallization, crystal quality and cryoprotection. The methods presented here should be generally applicable for purification of tryptophan synthase subunits and wild type and mutant &#945;2&#946;2 StTS complexes.

This article presents a series of consecutive methods for the expression and purification of Salmonella typhimurium tryptophan synthase comp this protocol a rapid system to purify the protein complex in a day. Covered methods are site-directed mutagenesis, protein expression in Escherichia coli, affinity chromatography, gel filtration chromatography, and crystallization.

PCR 돌연변이 발생, 복제, 발현, 빠른 단백질 정화 프로토콜 및 트립토판 신타제의 야생 유형 및 돌연변이 형태의 결정화

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. PRMTs can either mono- or dimethylate arginine guanidino groups symmetrically or asymmetrically. The enzymology of these proteins is a complex and intensely investigated area that requires milligram quantities of high-quality recombinant protein. The baculovirus expression vector system (BEVS) employing Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Spodoptera frugiperda 9 (Sf9) insect cells has been used for expression screening and production of many PRMTs, including PRMT 1, 2, and 4 through 9. To simultaneously screen for the expression of multiple constructs of these proteins, including domains and truncated fragments as well as the full-length proteins, we have applied scalable methods utilizing adjustable and programmable multichannel pipettes, combined with 24- and 96-well plates and blocks. Overall, these method adjustments enabled a large-scale generation of bacmid DNA, recombinant viruses, and protein expression screening. Using culture vessels with a high-fill volume of Sf9 cell suspension helped to overcome space limitations in the production pipeline for single batch large-scale protein production. Here, we describe detailed protocols for the efficient and cost-effective expression of functional PRMTs for biochemical, biophysical, and structural studies.

The baculovirus expression vector system (BEVS) is a robust platform for expression screening and production of protein arginine methyltransferases (PRMTs) to be used for biochemical, biophysical, and structural studies. Milligram quantities of material can be produced for the majority of PRMTs and other proteins of interest requiring a eukaryotic expression platform.

바쿨로바이러스 발현 벡터 시스템을 이용한 재조합 PRMT 단백질 생산

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

JUMPn: A Streamlined Application for Protein Co-Expression Clustering and Network Analysis in Proteomics

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. However, deriving biological insights from such valuable datasets is challenging. Here we introduce a systems biology-based software JUMPn, and its associated protocol to organize the proteome into protein co-expression clusters across samples and protein-protein interaction (PPI) networks connected by modules (e.g., protein complexes). Using the R/Shiny platform, the JUMPn software streamlines the analysis of co-expression clustering, pathway enrichment, and PPI module detection, with integrated data visualization and a user-friendly interface. The main steps of the protocol include installation of the JUMPn software, the definition of differentially expressed proteins or the (dys)regulated proteome, determination of meaningful co-expression clusters and PPI modules, and result visualization. While the protocol is demonstrated using an isobaric labeling-based proteome profile, JUMPn is generally applicable to a wide range of quantitative datasets (e.g., label-free proteomics). The JUMPn software and protocol thus provide a powerful tool to facilitate biological interpretation in quantitative proteomics.

We present a systems biology tool JUMPn to perform and visualize network analysis for quantitative proteomics data, with a detailed protocol including data pre-processing, co-expression clustering, pathway enrichment, and protein-protein interaction network analysis.

재조합 단백질 발현, 결정화 및 생물 물리학 연구

요약

더 많은 비디오 탐색

이 비디오의 챕터

항온, 발현, 정제, 인간 세로토닌 전달체 결정화 바운드

생산, 결정화 및 구조 결정의