This work was supported by the National Science Foundation through a CAREER Award (grant number DBI-1253293); the National Institutes of Health (NIH) (grant numbers HG007233-01, R01-EB019453-01, 1R21HG007233, DP2-AR068129-01, R01-HG008978); and the Defense Advanced Research Projects Agency Living Foundries Program (contract numbers HR0011-12-C-0065, N66001-12-C-4211, HR0011-12-C-0066).

<ol>
	<li>Navin, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumour+evolution+inferred+by+single-cell+sequencing.">Tumour evolution inferred by single-cell sequencing.</a> Nature. 472 (7341), 90-94 (2011).</li><li>Ni, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reproducible+copy+number+variation+patterns+among+single+circulating+tumor+cells+of+lung+cancer+patients.">Reproducible copy number variation patterns among single circulating tumor cells of lung cancer patients.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (52), 21083-21088 (2013).</li><li>Schmidt, H., Hensel, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+islands+in+bacterial+pathogenesis.">Pathogenicity islands in bacterial pathogenesis.</a> Clinical Microbiology Reviews. 17, 14-56 (2004).</li><li>Mart&#237;nez, J. L., Baquero, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+among+strategies+associated+with+bacterial+infection:+pathogenicity+epidemicity,+and+antibiotic+resistance.">Interactions among strategies associated with bacterial infection: pathogenicity epidemicity, and antibiotic resistance.</a> Clinical Microbiology Reviews. 15 (4), 647-679 (2002).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+genomes+from+uncultivated+environmental+microorganisms+using+FACS-based+single-cell+genomics.">Obtaining genomes from uncultivated environmental microorganisms using FACS-based single-cell genomics.</a> Nature Protocols. 9 (5), 1038-1048 (2014).</li><li>Rinke, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+the+phylogeny+and+coding+potential+of+microbial+dark+matter.">Insights into the phylogeny and coding potential of microbial dark matter.</a> Nature. 499 (7459), 431-437 (2013).</li><li>Zhang, H., Liu, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+tweezers+for+single+cells.">Optical tweezers for single cells.</a> Journal of the Royal Society Interface. 5 (24), 671-690 (2008).</li><li>Xu, L., Brito, I. L., Alm, E. J., Blainey, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virtual+microfluidics+for+digital+quantification+and+single-cell+sequencing.">Virtual microfluidics for digital quantification and single-cell sequencing.</a> Nature Methods. 13 (9), 759-762 (2016).</li><li>Gawad, C., Koh, W., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissecting+the+clonal+origins+of+childhood+acute+lymphoblastic+leukemia+by+single-cell+genomics.">Dissecting the clonal origins of childhood acute lymphoblastic leukemia by single-cell genomics.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (50), 17947-17952 (2014).</li><li>Macosko, E. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+parallel+genome-wide+expression+profiling+of+individual+cells+using+nanoliter+droplets.">Highly parallel genome-wide expression profiling of individual cells using nanoliter droplets.</a> Cell. 161 (5), 1202-1214 (2015).</li><li>Klein, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+single-cell+transcriptomics+applied+to+embryonic+stem+cells.">Droplet barcoding for single-cell transcriptomics applied to embryonic stem cells.</a> Cell. 161 (5), 1187-1201 (2015).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+single-cell+labeling+(Hi-SCL)+for+RNA-Seq+using+drop-based+microfluidics.">High-throughput single-cell labeling (Hi-SCL) for RNA-Seq using drop-based microfluidics.</a> PLoS One. 10 (5), 1-14 (2015).</li><li>Amini, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotype-resolved+whole-genome+sequencing+by+contiguity-preserving+transposition+and+combinatorial+indexing.">Haplotype-resolved whole-genome sequencing by contiguity-preserving transposition and combinatorial indexing.</a> Nature Reviews Genetics. 46 (12), 1343-1349 (2014).</li><li>Zheng, G. X. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haplotyping+germline+and+cancer+genomes+with+high-throughput+linked-read+sequencing.">Haplotyping germline and cancer genomes with high-throughput linked-read sequencing.</a> Nature Biotechnology. 34 (3), 303-311 (2016).</li><li>Lan, F., Haliburton, J. R., Yuan, A., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+barcoding+for+massively+parallel+single-molecule+deep+sequencing.">Droplet barcoding for massively parallel single-molecule deep sequencing.</a> Nature Communications. 7, 11784 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nature Biotechnology. 33 (11), 1165-1172 (2015).</li><li>Lan, F., Demaree, B., Ahmed, N., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+genome+sequencing+at+ultra-high-throughput+with+microfluidic+droplet+barcoding.">Single-cell genome sequencing at ultra-high-throughput with microfluidic droplet barcoding.</a> Nature Biotechnology. 35 (7), 640-646 (2017).</li><li>Novak, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+multiplex+gene+detection+and+sequencing+with+microfluidically+generated+agarose+emulsions.">Single-cell multiplex gene detection and sequencing with microfluidically generated agarose emulsions.</a> Angewandte Chemie Internation Edition. 50 (2), 390-395 (2011).</li><li>Gill, C., Van De Wijgert, J. H. H. M., Blow, F., Darby, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+lysis+methods+for+the+extraction+of+bacterial+DNA+for+analysis+of+the+vaginal+microbiota.">Evaluation of lysis methods for the extraction of bacterial DNA for analysis of the vaginal microbiota.</a> PLoS One. 11 (9), 1-16 (2016).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tn5+transposase+and+tagmentation+procedures+for+massively+scaled+sequencing+projects.">Tn5 transposase and tagmentation procedures for massively scaled sequencing projects.</a> Genome Research. 24 (12), 2033-2040 (2014).</li><li>Abate, A. R., Chen, C. H., Agresti, J. J., Weitz, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beating+Poisson+encapsulation+statistics+using+close-packed+ordering.">Beating Poisson encapsulation statistics using close-packed ordering.</a> Lab on a Chip. 9 (18), 2628 (2009).</li><li>Jain, A., Yang, A. H. J., Erickson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel-based+optical+waveguides+with+live+cell+encapsulation+and+integrated+microfluidics.">Gel-based optical waveguides with live cell encapsulation and integrated microfluidics.</a> Optic Letters. 37 (9), 1472 (2012).</li><li>Karbaschi, M., Shahi, P., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+chemical-free+breaking+of+microfluidic+emulsions+with+a+hand-held+antistatic+gun.">Rapid chemical-free breaking of microfluidic emulsions with a hand-held antistatic gun.</a> Biomicrofluidics. 11 (4), 1-6 (2017).</li><li>Gole, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massively+parallel+polymerase+cloning+and+genome+sequencing+of+single+cells+using+nanoliter+microwells.">Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells.</a> Nature Biotechnology. 31 (12), 1126-1132 (2013).</li><li>Chao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+analysis+reveals+significant+changes+of+microbial+compositions+and+protective+functions+during+drinking+water+treatment.">Metagenomic analysis reveals significant changes of microbial compositions and protective functions during drinking water treatment.</a> Scientific Reports. 3 (1), 3550 (2013).</li><li>Fierer, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-biome+metagenomic+analyses+of+soil+microbial+communities+and+their+functional+attributes.">Cross-biome metagenomic analyses of soil microbial communities and their functional attributes.</a> Proceedings of the National Academy of Sciences of the United States of America. 109 (52), 21390-21395 (2012).</li><li>Mande, S. S., Mohammed, M. H., Ghosh, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+metagenomic+sequences:+methods+and+challenges.">Classification of metagenomic sequences: methods and challenges.</a> Briefings in Bioinformatics. 13 (6), 669-681 (2012).</li><li>Eastburn, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+droplet+enrichment+for+targeted+sequencing.">Microfluidic droplet enrichment for targeted sequencing.</a> Nucleic Acids Research. 43 (13), e86 (2015).</li><li>Clark, I. C., Abate, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Finding+a+helix+in+a+haystack:+nucleic+acid+cytometry+with+droplet+microfluidics.">Finding a helix in a haystack: nucleic acid cytometry with droplet microfluidics.</a> Lab on a Chip. 17 (12), 2032-2045 (2017).</li></ol>

Patents pertaining to this workflow may be licensed to Mission Bio, of which Adam R. Abate is a shareholder.

The SiC-seq microfluidic workflow produces single-cell genome sequencing data from thousands of bacterial cells. Digital barcodes spliced onto the genomes of microgel-encapsulated cells allow for the in silico deconvolution of NGS data into groups of barcoded reads originating from the same cell. A control experiment with a microbial community of known composition is necessary for evaluating the purity of the barcode groups. A large fraction of low-purity groups indicates that the cell encapsulation rate is too high or that there is significant droplet cross-contamination occurring during the microfluidic processing steps. According to Poisson statistics, the barcodes and cells should be encapsulated at a target ratio of 1 particle for every 10 drops to limit the rate of multiple encapsulation events to less than 5% of all non-empty droplets. An encapsulation rate higher than this increases the rates of doublets exponentially, so the verification of the encapsulation ratio during the dropmaking process is of critical importance. Users should be particularly cautious of the encapsulation of multiple cells in a single microgel because reads from different cells sharing the same barcode sequence cannot be bioinformatically separated. In the case that 1 cell receives 2 different barcodes, the barcode group purity is unaffected although the abundance metrics are skewed when counting by barcode sequence.
Droplet cross-contamination may also arise due to suboptimal merger conditions. During a successful operation, the microfluidic merger device (Figure 5) can controllably pair 1 barcode droplet with 1 microgel and a volume of PCR reagent. Non-ideal flow rates will result in a droplet pairing at incorrect ratios: 1 barcode could be paired with 2 microgels, for example. All flow rates listed in the protocol are intended to be estimates and may need to be adjusted depending on slight variations in the device geometry and droplet sizes. Users with access to cameras with high-speed recording capabilities (&#62;10,000 frames/s) should verify the correct droplet merger at the beginning and over the course of the microfluidic operation. Users without access to a high-speed camera can collect a small volume of the merged output and manually measure the droplet sizes under a microscope. The droplet size should be uniform: an excess of unmerged barcodes or microgel drops indicates that the reinjection rates should be reduced accordingly.
Several general precautions should be taken when handling microgels and microdroplets to preserve their integrity. Microgels, though mechanically robust, must be sufficiently cooled prior to the breaking and washing steps to ensure complete gelation. Non-spherical microgels are an indication that the agarose was not given adequate time to solidify. When washing microgels, spin the suspensions down at the required speeds to avoid a loss of product. Agarose hydrogel has a refractive index closely matching that of water and may be difficult to see in a tube22, so users should carefully identify the gel-liquid boundary prior to aspiration. Water-in-oil droplets are susceptible to coalescence by the build-up of static forces23 on laboratory gloves and tubing. For this reason, we recommend loading the droplet reinjection syringes with bare hands and treating all the reinjection lines with an anti-static gun prior to the pump priming. Large coalesced droplets can be removed by slowly rotating the emulsions in a syringe and manually aspirating the larger drops, which accumulate near the top due to their larger buoyant force.
SiC-seq is the first technology to demonstrate single-cell genome sequencing of &#62;50,000 bacterial cells. This platform offers significant advantages in throughput over existing approaches and enables a deeper sampling of heterogeneous microbial communities. To date, microfluidic technologies for single-cell genome sequencing have employed microchambers9 and microwells24 for cell isolation and amplification, but with throughputs in the range of only tens to hundreds of cells. The flow sorting of single cells into wellplates5,6 requires no specialized microfluidic instrumentation but possesses a similarly low throughput. Given that soil and water samples from the environment commonly have alpha diversities of &#62;1,000 at the species level25,26, SiC-seq is highly advantageous by virtue of its ability to sample a far greater number of organisms. The SiC-seq workflow is adaptable to cell inputs from laboratory culture, the natural environment, or a living host. A cell sample need only be in an aqueous suspension and free of large particles (&#62;10 &#181;m) to be suitable for microfluidic encapsulation. For example, the method has been previously applied to a sample of seawater using a series of wash and filtering steps to pre-process the cells prior to encapsulation17.
The SiC-seq protocol generates a relatively sparse amount of sequencing data from each single cell and may not be suitable for all applications. Some bioinformatics algorithms such as de novo genome assembly or single nucleotide variant (SNV) calling require higher coverage depths to work effectively. Instead, barcode groups can be clustered in silico by taxonomic binning methods27 so that algorithms can be applied on larger sets of reads. The relatively low overall barcoding efficiency of the SiC-seq workflow may also present challenges in cases where the availability of the input sample is low. SiC-seq relies on a Poisson-distributed barcode encapsulation step, therefore approximately 10% of the cells receive a molecular barcode and are amplified during the final library preparation step. While this is comparable to other microdroplet-based barcoding schemes10, users working with precious cell samples may have difficulty achieving the adequate library yield for sequencing and may need to increase the number of PCR cycles in the final amplification step. Another potential solution for users with microfluidic expertise is to sort positive barcode droplets after the digital PCR step, thus bringing the overall barcoding efficiency to &#62;85%28.
A potential future direction for SiC-seq technology is adapting the workflow for use with mammalian cells, paving the way for new clinical single-cell studies. As an example, an analysis of the copy number variation among single cancer cells may further our understanding of the role of heterogeneity in cancer pathology2. Alternatively, integrating SiC-seq with existing methods to probe and enrich DNA sequences of interest29 would enable the targeted single-cell sequencing of subpopulations or rare strains of cells. With environmental samples, genes from within a known metabolic pathway could be targeted and analyzed contextually alongside neighboring genes to identify novel genomic islands. From within a human host environment, low-titer pathogenic bacteria samples could be isolated and sequenced at the single-cell level to examine more closely their genotypic origins of virulence.

The genome serves as a blueprint of cellular identity and function, containing the entirety of an organism&#39;s coding potential. An understanding of cellular biology at the genome level can explain the observed phenotypic diversity within heterogeneous cell populations. This heterogeneity is apparent in biological systems and has broad implications for human health and disease. For example, gene copy number variations among tumor cells are linked to the evolution and spread of cancer1,2. In bacterial infections, pathogenicity islands present in a small fraction of genomes can be horizontally transferred and lead to the proliferation of antibiotic-resistant bacteria3,4. A primary challenge in studying genomes at the single-cell level is the low quantities of DNA available, as well as the need to analyze thousands of cells to sample the full diversity of genotypes. For these reasons, limitations in experimental throughput have hindered the effectiveness of single-cell studies, biasing results towards the most abundant cells. Single-cell isolation techniques such as flow sorting5,6, optical tweezers7, embedment in bulk gels8, and microfluidics9 are capable of processing hundreds of cells for sequencing; however, this represents only a small fraction of most samples. A method for single-cell genome sequencing with substantially higher throughput would allow deeper and more complete profiling of cell populations, thereby elucidating the role of genotypic diversity within these communities.
Droplet microfluidics enables the high-throughput manipulation of cells and biological reagents within millions of picoliter-scale reactors. To date, microdroplet technologies have been used to study differential expression patterns among cells from heterogeneous tissues10,11,12, deeply sequence long molecules13,14,15, and conduct chromatin immunoprecipitation sequencing (ChiP-seq) analyses on single cells16. Indeed, microdroplets are capable of high-throughput, compartmentalized operations, making them amenable to applications in single-cell genomics. The development of this technology presents its own unique technological challenges, however. Cells must be lysed, purified, and amplified with minimal bias, to uniformly sample cell populations. Additionally, unlike polyadenylated mRNA transcripts in mammalian cells, there is no comparable molecular motif in the genome to facilitate the capture of the target nucleic acid. For these reasons, single-cell genome sequencing has been difficult to implement in microdroplet platforms.
In this work, we provide a detailed protocol of our previously reported single-cell microfluidic approach capable of sequencing the genomes of tens of thousands of cells in a single experiment17. With this technology, called SiC-seq, bacterial cells are encapsulated in micron-scale hydrogels and individually lysed, tagmented, and merged with a microdroplet containing a unique oligonucleotide barcode, which is spliced onto the cell&#39;s genomic DNA via a single overlap extension polymerase chain reaction (PCR). The hydrogels serve as isolated containers in which high-molecular-weight genomic DNA is sterically encased, allowing smaller molecules such as detergents and lytic enzymes to access and purify DNA prior to barcoding18. This protocol processes &#62;50,000 single cells in a matter of hours, resulting in a barcoded library ready for sequencing. Following the sequencing, the reads are demultiplexed according to their single-cell barcode sequence, resulting in a dataset comprised of millions of reads, each with a cellular index.

<table border="0" cellpadding="0" cellspacing="0" width="1218">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3&#34; silicon wafers, P type, virgin test grade</td>
			<td style="width:245px;">University Wafers</td>
			<td style="width:163px;">447</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SU-8 3025 photoresist</td>
			<td style="width:245px;">Microchem</td>
			<td style="width:163px;">17030192</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Spin coater</td>
			<td style="width:245px;">Specialty Coating Systems</td>
			<td style="width:163px;">G3P-8</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Photomasks</td>
			<td style="width:245px;">CadArt Servcies</td>
			<td style="width:163px;">(custom)</td>
			<td>See Supplemental Files for mask designs</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PGMEA developer</td>
			<td>Sigma-Aldrich</td>
			<td>484431</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isopropanol</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>109827</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sylgard 184 silicone elastomer kit</td>
			<td style="width:245px;">Krayden</td>
			<td style="width:163px;">4019862</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Degassing chamber</td>
			<td style="width:245px;">Bel-Art</td>
			<td style="width:163px;">42025</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">0.75 mm biopsy punch</td>
			<td>World Precision Instruments</td>
			<td>504529</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Glass microscope slides (75 mm x 50 mm)</td>
			<td style="width:245px;">Corning</td>
			<td>294775X50</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Aquapel (hydrophobic glass treatment)</td>
			<td style="width:245px;">Pittsburgh Glass Works</td>
			<td>47100</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PE-2 polyethylene tubing</td>
			<td style="width:245px;">Scientific Commodities</td>
			<td>B31695-PE/2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1 mL syringes</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">309628</td>
			<td style="width:297px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">27 gauge needles</td>
			<td style="width:245px;">BD</td>
			<td style="width:163px;">305109</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Syringe pump</td>
			<td style="width:245px;">New Era Pump Systems</td>
			<td>NE-501</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Novec HFE-7500 fluorinated oil (HFE)</td>
			<td style="width:245px;">3M</td>
			<td style="width:163px;">98-0212-2928-5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">FC-40 fluorinated oil</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">F9755</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">PEG-PFPE surfactant</td>
			<td style="width:245px;">Ran Biotechnologies</td>
			<td style="width:163px;">008-FluoroSurfactant</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Space heater</td>
			<td style="width:245px;">Lasko&#160;</td>
			<td style="width:163px;">CD09250&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Agarose, low gelling temperature</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">a9414</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">TE (10X)</td>
			<td style="width:245px;">Rockland</td>
			<td style="width:163px;">mb-007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PBS 1X, pH 7.4</td>
			<td style="width:245px;">E&#38;K Scientific Products</td>
			<td>EK-65083</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">OptiPrep (density gradient medium)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">d1556</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">1H,1H,2H-Perfluoro-1-Octanol (PFO)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">370533</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Span 80 (sorbitane monooleate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">s6760</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Hexane</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">139386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tween 20 (polysorbate 20)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">p2287</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysozyme Type IV</td>
			<td style="width:245px;">MP Biomedicals</td>
			<td style="width:163px;">195303</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Mutanolysin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>M9901</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zymolyase (yeast lytic enzyme)</td>
			<td style="width:245px;">Zymo Research</td>
			<td style="width:163px;">e1004</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lysostaphin</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>L7386</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Sodium chloride</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">EDTA</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>E6758</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Tris-HCl, pH 7.5, 1M</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">15567-027</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Dithiothreitol (DTT)</td>
			<td style="width:245px;">Teknova</td>
			<td style="width:163px;">d9750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Lithium dodecyl sulfate</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">L9781</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Proteinase K</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">P8107S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ethanol, 200 Proof (100%)</td>
			<td style="width:245px;">Koptec</td>
			<td>V1001</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">SYBR Green I (nucleic acid stain)</td>
			<td style="width:245px;">Invitrogen</td>
			<td style="width:163px;">S7563</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">PEG 6k</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td>81260</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Triton X-100 (octylphenol ethoxylate)</td>
			<td style="width:245px;">Sigma-Aldrich</td>
			<td style="width:163px;">t8787</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Nextera DNA Library Prep Kit</td>
			<td style="width:245px;">Illumina</td>
			<td>FC-121-1030</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Phusion Hot Start Flex Master Mix (High-Fidelity Hot Start Master Mix)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m05365</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Platinum Multiplex PCR Master Mix (Taq Master Mix)</td>
			<td style="width:245px;">Applied Biosystems</td>
			<td style="width:163px;">4464263</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Warmstart 2.0 Bst Polymerase (isothermal polymerase)</td>
			<td style="width:245px;">New England Biosciences</td>
			<td style="width:163px;">m0538m</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">NT buffer from Nextera XT kit (neutralization buffer)</td>
			<td style="width:245px;">Illumina</td>
			<td style="width:163px;">FC-131-1024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Cold cathode fluorescent inverter</td>
			<td style="width:245px;">(custom)</td>
			<td style="width:163px;">(custom)</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">DC power supply</td>
			<td style="width:245px;">Mastech</td>
			<td>HY1503D</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">Zerostat 3 anti-static gun</td>
			<td style="width:245px;">Milty</td>
			<td>5036694022153</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:513px;">3D-printed centrifuge syringe holder</td>
			<td style="width:245px;">(custom)</td>
			<td>(custom)</td>
			<td>See Supplemental Files for 3D print file</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo DNA Clean &#38; Concentrator-5</td>
			<td style="width:245px;">Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
	</tbody>
</table>

an ultrahigh-throughput microfluidic platform for single-cell genome sequencing

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of cellular heterogeneity in biological systems. However, single-cell sequencing of large populations has been hampered by limitations in processing genomes for sequencing. In this paper, we describe a method for single-cell genome sequencing (SiC-seq) which uses droplet microfluidics to isolate, amplify, and barcode the genomes of single cells. Cell encapsulation in microgels allows the compartmentalized purification and tagmentation of DNA, while a microfluidic merger efficiently pairs each genome with a unique single-cell oligonucleotide barcode, allowing &gt;50,000 single cells to be sequenced per run. The sequencing data is demultiplexed by barcode, generating groups of reads originating from single cells. As a high-throughput and low-bias method of single-cell sequencing, SiC-seq will enable a broader range of genomic studies targeted at diverse cell populations.

The SiC-seq experimental workflow contains 3 PDMS microfluidic devices fabricated using a soft lithography procedure (Figure 1). A co-flow dropmaker (Figure 3A) generates 25 &#181;m of digital barcode droplets for labeling genomic DNA with a unique single-cell identifier. The barcode oligonucleotides consist of a 15 bp degenerate sequence flanked by PCR handles for amplification (Table 2, BAR primer). The barcodes are diluted to a femtomolar concentration to achieve the single-molecule encapsulation, and all droplets receive either 0 or 1 barcode fragment(s). The droplets containing a barcode are amplified, yielding many copies of double-stranded barcode amplicons. A nucleic acid stain is used to verify the successful amplification and quantify the encapsulation rate of the barcode fragments (Figure 4B). The microgels are generated by co-flowing a bacterial cell suspension and a molten agarose gel at equal flow rates (Figure 2A). The agarose is prepared at twice the desired final concentration, as the co-flow dropmaking process effectively dilutes the aqueous solutions by a factor of 2. As the agarose cools, it solidifies into a 25 &#181;m diameter microgel occupying the spherical volume of the droplet.
A series of wash and lysis steps purifies the high-molecular-weight genomic DNA in the microgels (Figure 2B). After breaking the emulsions, aqueous washes are carried out in large volumes to dilute out trace organic solvents which can inhibit the downstream enzymatic treatments. The washed microgels are observed under a microscope to verify the cell encapsulation rate (Figure 4A). A cocktail of enzymes with broad lytic activity is added to the microgel suspension to digest the cell walls of the bacteria and eukaryotic microbes19. A second treatment with Proteinase K and detergent degrades the proteins and solubilizes cell debris.
Tagmentation of the purified DNA is carried out in droplets to avoid potential cross-contamination resulting from the diffusion of small tagmented DNA fragments between the microgels18. A droplet encapsulation device (Figure 3B) compartmentalizes each microgel with a buffer and tagmentation enzyme, which simultaneously fragments double-stranded DNA while also &#34;tagging&#34; it with a preloaded oligonucleotide20. The microgels are loaded into the droplets as close-packed particles, achieving encapsulation rates approaching 1 microgel for every drop with few doublets21 (Figure 4C).
In the final step of the microfluidic workflow (Figure 2C), a device performs a double merger operation combining 1 barcode drop, 1 microgel-containing drop, and the amplification mix in a controlled two-step process. First, a droplet containing PCR reagent is paired and merged with a barcode drop in the region shown in yellow (Figure 5). Saltwater electrodes in the microfluidic channel produce a high electric field gradient which triggers the droplet merger. In a similar manner, the first merged droplet is paired with a microgel droplet and merged a second time in the region shown in red. The droplets are collected and thermal cycled off-chip in a single-overlap extension (SOE) PCR. The overlapping complementary ends of the barcode and the tagmented genomic DNA allow fusion and exponential amplification of only properly barcoded constructs.
The sequencing data is first filtered by a read quality and then parsed by grouping the reads according to their 15-bp single-cell barcode sequence. For a barcode group to be considered valid, it should contain a minimum number of reads; this thresholding limits the analysis to cells with a useful amount of sequencing data and removes the PCR-mutated barcode &#34;orphans&#34; from the dataset. In this sample run, the minimum is set to 7.5 kbps per group (50 reads of 150 bp each). A histogram of the barcode counts versus the group size shows that a significant portion of the valid barcode groups is just above the threshold size (Figure 6A).
In a control experiment where the microbial community composition is known, the purity and relative abundance metrics are used to evaluate the quality of a SiC-seq run. Here, a synthetic 10-cell community consisting of 3 gram-negative bacteria, 5 gram-positive bacteria, and 2 yeasts is analyzed. The purity of a given barcode group is defined as the number of reads mapping to the most common genome in the group divided by the total number of reads in the group. The vast majority of the barcode groups have purities greater than 0.95 (Figure 6B). Relative abundance of the cell types is calculated by counting the raw reads and by counting the barcode groups, where the groups are assigned a cell type corresponding to the consensus of its member reads (Figure 6C). The abundance of reads and barcode groups track in roughly equal proportions, indicating that the cell populations are being sampled such that certain species are not contained in disproportionately small or large barcode groups. Plotting the aggregate coverage of all barcode groups from a single species indicates a high coverage across the entire genome, with few or no dropout regions (Figure 7). The uniformity of coverage can be verified with a frequency distribution of normalized coverage values, with most values centered around the average (Figure 7, inset).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57598/57598fig1.jpg" /> 
Figure 1: Fabrication of microfluidic devices by photolithography. (A) Master molds with a single feature height are fabricated by spin coating a layer of SU-8 photoresist onto a silicon wafer. The photoresist is then patterned with a photolithographic mask and UV light, crosslinking the exposed SU-8. Finally, uncrosslinked SU-8 is dissolved in a developer bath. The resulting mold is used to cast PDMS which is bonded to a glass slide to produce the complete microfluidic device. (B) For a double-layer device, the fabrication similarly begins with spin coating and exposure steps. These steps are then repeated to create a two-layer device. <a href="/files/ftp_upload/57598/57598fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57598/57598fig2.jpg" /> 
Figure 2: Overview of the SiC-seq workflow. (A) A microbial suspension is co-flowed with molten agarose in a dropmaker device to encapsulate single cells in microgels. (B) The microgels are subjected to a series of washes to purify the bacterial genomic DNA. Lytic enzymes digest the cell walls of gram-positive bacteria and yeasts, and detergent solubilizes the cellular debris. The microgels are re-encapsulated into droplets for the tagmentation to reduce cross-contamination. (C) The microfluidic merger combines a digital PCR barcode, a tagmented microgel genome, and an amplification mix at a rate &#62;1 kHz. Off-chip SOE-PCR splices a unique single-cell barcode onto the tagmented genome and selectively amplifies fully barcoded constructs. <a href="/files/ftp_upload/57598/57598fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57598/57598fig3.jpg" /> 
Figure 3: Microfluidic devices for dropmaking and microgel re-encapsulation. (A) This panel shows a co-flow dropmaker (25 &#181;m of feature height). Cells and molten agarose are introduced into the device at equal flow rates to produce 25 &#181;m droplets at a 25 &#181;m x 25 &#181;m junction. For the digital barcode dropmaking, the cell inlet is plugged, and a PCR mix is introduced into the agarose inlet. (B) This panel shows a microgel re-encapsulation device (25 &#181;m of feature height). The microgels flow into a funnel-shaped inlet to maintain their close-packed ordering and receive a volume of tagmentation mix prior to the re-encapsulation at a 25 &#181;m x 30 &#181;m junction. <a href="/files/ftp_upload/57598/57598fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57598/57598fig4.jpg" /> 
Figure 4: Micrographs of droplets and microgels. (A) This panel shows washed 25 &#181;m microgels prior to enzymatic lysis. The bacteria are fluorescently stained for the quantification of the encapsulation rate. Poisson loading statistics dictate that the cells should be encapsulated at a rate of 1 in 10 drops or less to minimize the frequency of multiple-encapsulation events. (B) This panel shows a fluorescence microscopy image of 25 &#181;m digital barcode droplets treated with a nucleic acid stain. The droplets containing amplified barcode fragments produce a strong fluorescence signal. (C) This panel shows microgels re-encapsulated in 50 &#181;m drops. The close-packing of the microgels allows for encapsulation rates approaching 1 gel per drop with few doublets. <a href="/files/ftp_upload/57598/57598fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57598/57598fig5.jpg" /> 
Figure 5: Microfluidic double merger device for single-cell genome barcoding. A two-step merger operation pairs barcode droplets with tagmented genomes at a high-throughput. A droplet of PCR mix is first generated and merged with a barcode droplet in the region shown in yellow using saltwater electrodes. Next, a droplet containing a microgel is introduced and merged a second time in the region shown in red. Oil inlets allow for precise control of the spacing between the reinjected droplets. The barcode reinjection chamber and its spacer oil are placed on the shorter 25 &#181;m layer, shaded in blue. All other device features belong to the thicker layer with 45 &#181;m of total height. <a href="/files/ftp_upload/57598/57598fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57598/57598fig6.jpg" /> 
Figure 6: Barcode group metrics for a 10-cell synthetic microbial community. (A) This panel shows the distribution of the barcode group sizes. The number of groups of a given size decreases exponentially as the group size increases. A minimum threshold of 7.5 kbps per group limits the analysis to groups with a sufficient amount of information and removes the PCR-mutated sequence &#34;orphans.&#34; (B) This panel shows the distribution of barcode group purities. The vast majority (&#62;90%) of groups are of very high purity (&#62;95%). (C) This panel shows the relative abundance of 10 species calculated at the read and barcode group level. The 2 counting methods produce similar results, indicating that the barcode group sizes are consistent across species. <a href="/files/ftp_upload/57598/57598fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/57598/57598fig7.jpg" /> 
Figure 7: Aggregate genomic coverage of Bacillus subtilis barcode groups. The reads from all the barcode groups mapping to the bacterium B. subtilis (N = 9,398) are pooled and analyzed in aggregate. A circular coverage map illustrates the coverage uniformity of the SiC-seq reads, with no observable dropout regions. A dashed line around the circumference indicates the average coverage (5.55x). The inset histogram of the relative coverage frequencies shows that a bulk of the bases are covered at a depth near the genome-wide average, represented by the dashed line. <a href="/files/ftp_upload/57598/57598fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Device</td>
			<td>1st Layer Height (&#181;m)</td>
			<td>1st Layer Spin Speed (rpm)</td>
			<td>2nd Layer Height (&#181;m)</td>
			<td>2nd Layer Spin Speed (rpm)</td>
		</tr>
		<tr>
			<td>Co-flow dropmaker</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
		<tr>
			<td>Gel re-encapsulator</td>
			<td>25</td>
			<td>4000</td>
			<td>N/A</td>
			<td>N/A</td>
		</tr>
		<tr>
			<td>Double merger</td>
			<td>25</td>
			<td>4000</td>
			<td>20</td>
			<td>5000</td>
		</tr>
	</tbody>
</table>
Table 1: Microfluidic device fabrication parameters. This table shows a listing of the microfluidic devices used in the SiC-seq workflow with their required speeds for photoresist spin coating (based on the manufacturer&#39;s specifications for SU-8 3025).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Label</td>
			<td colspan="5">Sequence (5&#39; &#62; 3&#39;)</td>
		</tr>
		<tr>
			<td>BAR</td>
			<td colspan="5">GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAGNNNNNNNNNNNNNNNTAAGCCAGCCCCGACACT</td>
		</tr>
		<tr>
			<td>DNA_BAR</td>
			<td colspan="5">CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
		<tr>
			<td>P7_BAR</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG</td>
		</tr>
		<tr>
			<td>P5_DNA</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC</td>
		</tr>
		<tr>
			<td>I7_READ</td>
			<td colspan="5">GCCCACGAGACGTGTCGGGGCTGGCTTA</td>
		</tr>
	</tbody>
</table>
Table 2: Primer sequences.
Supplemental File 1: <a href="/files/ftp_upload/57598/Suppl_File_1-SiC-seq_device_masks.dwg" target="_blank">Please click here to download this file.</a>
Supplemental File 2: <a href="/files/ftp_upload/57598/Suppl_File_2-centrifuge_syringe_holder_1mL.dwg" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing at JoVE.com

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing &gt;50,000 single-cell genomes from diverse cell populations.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

an-ultrahigh-throughput-microfluidic-platform-for-single-cell-genome

Research

JoVE Journal

Bioengineering

17.5K Views.  University of California, San Francisco. Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing >50,000 single-cell genomes from diverse cell populations.

Video: An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

High-throughput Protein Expression Generator Using a Microfluidic Platform

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and high-fidelity measurements of large systems. Microfluidics promises to fulfill many of these requirements, such as performing high-throughput screening experiments on-chip, encompassing biochemical, biophysical, and cell-based assays1. Since the early days of microfluidics devices, this field has drastically evolved, leading to the development of microfluidic large-scale integration2,3. This technology allows for the integration of thousands of micromechanical valves on a single device with a postage-sized footprint (Figure 1). We have developed a high-throughput microfluidic platform for generating in vitro expression of protein arrays (Figure 2) named PING (Protein Interaction Network Generator). These arrays can serve as a template for many experiments such as protein-protein 4, protein-RNA5 or protein-DNA6 interactions.
The device consist of thousands of reaction chambers, which are individually programmed using a microarrayer. Aligning of these printed microarrays to microfluidics devices programs each chamber with a single spot eliminating potential contamination or cross-reactivity Moreover, generating microarrays using standard microarray spotting techniques is also very modular, allowing for the arraying of proteins7, DNA8, small molecules, and even colloidal suspensions. The potential impact of microfluidics on biological sciences is significant. A number of microfluidics based assays have already provided novel insights into the structure and function of biological systems, and the field of microfluidics will continue to impact biology.

We present a microfluidic approach for the expression of protein arrays. The device consists of thousands of reaction chambers controlled by micro-mechanical valves. The microfluidic device is mated to a microarray-printed gene library. These genes are then transcribed and translated on-chip, resulting in a protein array ready for experimental use.

Rapidly increasing fields, such as systems biology, require the development and implementation of new technologies, enabling high-throughput and ...

Microfluidic Picoliter Bioreactor for Microbial Single-cell Analysis: Fabrication, System Setup, and Operation

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described in detail. The PLBR can be utilized for the analysis of single bacteria and microcolonies to investigate biotechnological and microbiological related questions concerning, e.g.&#160;cell growth, morphology, stress response, and metabolite or protein production on single-cell level. The device features continuous media flow enabling constant environmental conditions for perturbation studies, but in addition allows fast medium changes as well as oscillating conditions to mimic any desired environmental situation. To fabricate the single use devices, a silicon wafer containing sub micrometer sized SU-8 structures served as the replication mold for rapid polydimethylsiloxane casting. Chips were cut, assembled, connected, and set up onto a high resolution and fully automated microscope suited for time-lapse imaging, a powerful tool for spatio-temporal cell analysis. Here, the biotechnological platform organism Corynebacterium glutamicum&#160;was seeded into the PLBR and cell growth and intracellular fluorescence were followed over several hours unraveling time dependent population heterogeneity on single-cell level, not possible with conventional analysis methods such as flow cytometry. Besides insights into device fabrication, furthermore, the preparation of the preculture, loading, trapping of bacteria, and the PLBR cultivation of single cells and colonies is demonstrated. These devices will add a new dimension in microbiological research to analyze time dependent phenomena of single bacteria under tight environmental control. Due to the simple and relatively short fabrication process the technology can be easily adapted at any microfluidics lab and simply tailored towards specific needs.

In this protocol the fabrication, setup and basic operation of a microfluidic picoliter bioreactor (PLBR) for single-cell analysis of prokaryotic microorganisms is introduced. Industrially relevant microorganisms were analyzed as proof of principle allowing insights into growth rate, morphology, and phenotypic heterogeneity over certain time periods, hardly possible with conventional methods.

In this protocol the fabrication, experimental setup and basic operation of the recently introduced microfluidic picoliter bioreactor (PLBR) is described ...

Cell Squeezing as a Robust, Microfluidic Intracellular Delivery Platform

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This technology has shown potential in addressing previously challenging applications; including, delivery to primary immune cells, cell reprogramming, carbon nanotube, and quantum dot delivery. This vector-free microfluidic platform relies on mechanical disruption of the cell membrane to facilitate cytosolic delivery of the target material. Herein, we describe the detailed method of use for these microfluidic devices including, device assembly, cell preparation, and system operation. This delivery approach requires a brief optimization of device type and operating conditions for previously unreported applications. The provided instructions are generalizable to most cell types and delivery materials as this system does not require specialized buffers or chemical modification/conjugation steps. This work also provides recommendations on how to improve device performance and trouble-shoot potential issues related to clogging, low delivery efficiencies, and cell viability.

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This protocol provides detailed steps on how to use the system for a broad range of applications.

Rapid mechanical deformation of cells has emerged as a promising, vector-free method for intracellular delivery of macromolecules and nanomaterials. This ...

Microfluidic Platform for Measuring Neutrophil Chemotaxis from Unprocessed Whole Blood

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher neutrophil counts in the blood are usually an indicator of ongoing infections, while low neutrophil counts are a warning sign for higher risks for infections. To accomplish their functions, neutrophils also have to be able to move effectively from the blood where they spend most of their life, into tissues, where infections occur. Consequently, any defects in the ability of neutrophils to migrate can increase the risks for infections, even when neutrophils are present in appropriate numbers in the blood. However, measuring neutrophil migration ability in the clinic is a challenging task, which is time consuming, requires large volume of blood, and expert knowledge. To address these limitations, we designed a robust microfluidic assays for neutrophil migration, which requires a single droplet of unprocessed blood, circumvents the need for neutrophil separation, and is easy to quantify on a simple microscope. In this assay, neutrophils migrate directly from the blood droplet, through small channels, towards the source of chemoattractant. To prevent the granular flow of red blood cells through the same channels, we implemented mechanical filters with right angle turns that selectively block the advance of red blood cells. We validated the assay by comparing neutrophil migration from blood droplets collected from finger prick and venous blood. We also compared these whole blood (WB) sources with neutrophil migration from samples of purified neutrophils and found consistent speed and directionality between the three sources. This microfluidic platform will enable the study of human neutrophil migration in the clinic and the research setting to help advance our understanding of neutrophil functions in health and disease.

This protocol details an assay designed to measure human neutrophil chemotaxis from one droplet of whole blood with robust reproducibility. This approach circumvents the need for neutrophil separation and requires only a few minutes of assay preparation time. The microfluidic chip enables the repeated measure of neutrophil chemotaxis over time in infants or small mammals, where sample volume is limited.

Neutrophils play an essential role in protection against infections and their numbers in the blood are frequently measured in the clinic. Higher ...

The Multi-organ Chip - A Microfluidic Platform for Long-term Multi-tissue Coculture

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need for new solutions for substance testing. Many drugs that have been removed from the market due to drug-induced liver injury released their toxic potential only after several doses of chronic testing in humans. However, a controlled microenvironment is pivotal for long-term multiple dosing experiments,&#160;as even minor alterations in extracellular conditions may greatly influence the cell physiology. We focused within our research program on the generation of a microengineered bioreactor, which can be dynamically perfused by an on-chip pump and combines at least two culture spaces for multi-organ applications. This circulatory system mimics the in vivo conditions of primary cell cultures better and assures a steadier,&#160;more quantifiable extracellular relay of signals to the cells. 
For demonstration purposes, human liver equivalents, generated by aggregating differentiated HepaRG cells with human hepatic stellate cells in hanging drop plates, were cocultured with human skin punch biopsies for up to 28 days inside the microbioreactor. The use of cell culture inserts enables the skin to be cultured at an air-liquid interface, allowing topical substance exposure. The microbioreactor system is capable of supporting these cocultures at near physiologic fluid flow and volume-to-liquid ratios, ensuring stable and organotypic culture conditions. The possibility of long-term cultures enables the repeated exposure to substances. Furthermore, a vascularization of the microfluidic channel circuit using human dermal microvascular endothelial cells yields a physiologically more relevant vascular model.

Here, we present a protocol to coculture primary cells, tissue models and punch biopsies in a microfluidic multi-organ chip for up to 28 days. Human dermal microvascular endothelial cells, liver aggregates and skin biopsies were successfully combined in a common media circulation.

The ever growing amount of new substances released onto the market and the limited predictability of current in vitro test systems has led to a high need ...

A Microfluidic Platform for High-throughput Single-cell Isolation and Culture

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet high-throughput, method to perform single-cell culture experiments. Here, we report a microfluidic chip-based strategy for high-efficiency single-cell isolation (~77%) and demonstrate its capability of performing long-term single-cell culture (up to 7 d) and cellular heterogeneity analysis using clonogenic assay. These applications were demonstrated with KT98 mouse neural stem cells, and A549 and MDA-MB-435 human cancer cells. High single-cell isolation efficiency and long-term culture capability are achieved by using different sizes of microwells on the top and bottom of the microfluidic channel. The small microwell array is designed for precisely isolating single-cells, and the large microwell array is used for single-cell clonal culture in the microfluidic chip. This microfluidic platform constitutes an attractive approach for single-cell culture applications, due to its flexibility of adjustable cell culture spaces for different culture strategies, without decreasing isolation efficiency.

Here, we present a protocol for isolating and culturing single cells with a microfluidic platform, which utilizes a new microwell design concept to allow for high-efficiency single cell isolation and long-term clonal culture.

Studying the heterogeneity of single cells is crucial for many biological questions, but is technically difficult. Thus, there is a need for a simple, yet ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by their natural environment, root hair morphology and function are difficult to study and often excluded from plant research. In recent years, microfluidic platforms have offered a way to visualize root systems at high resolution without disturbing the roots during transfer to an imaging system. The microfluidic platform presented here builds on previous plant-on-a-chip research by incorporating a two-layer device to confine the Arabidopsis thaliana main root to the same optical plane as the root hairs. This design enables the quantification of root hairs on a cellular and organelle level and also prevents z-axis drifting during the addition of experimental treatments. We describe how to store the devices in a contained and hydrated environment, without the need for fluidic pumps, while maintaining a gnotobiotic environment for the seedling. After the optical imaging experiment, the device may be disassembled and used as a substrate for atomic force or scanning electron microscopy while keeping fine root structures intact.

Imaging the Root Hair Morphology of Arabidopsis Seedlings in a Two-layer Microfluidic Platform

This article demonstrates how to culture Arabidopsis thaliana seedlings in a two-layer microfluidic platform that confines the main root and root hairs to a single optical plane. This platform can be used for real-time optical imaging of fine root morphology as well as for high-resolution imaging by other means.

Root hairs increase root surface area for better water uptake and nutrient absorption by the plant. Because they are small in size and often obscured by ...

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved useful as a convenient live imaging platform providing capabilities for precise control of experimental conditions in real time. In this article, we demonstrate live imaging of individual worms employing WormSpa, a previously-published custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes. To illustrate the capability, we performed proof-of-principle experiments in which worms were infected in the device with pathogenic bacteria, and the dynamics of expression of immune response genes and egg laying were monitored continuously in individual animals. The simple design and operation of this device make it suitable for users with no previous experience with microfluidic-based experiments. We propose that this approach will be useful for many researchers interested in longitudinal observations of biological processes under well-defined conditions.

A Microfluidic Platform for Longitudinal Imaging in Caenorhabditis elegans

In this article, we demonstrate live imaging of individual worms employing a custom microfluidic device. In the device, multiple worms are individually confined to separate chambers, allowing multiplexed longitudinal surveillance of various biological processes.

In the last decade, microfluidic techniques have been applied to study small animals, including the nematode Caenorhabditis elegans, and have proved ...

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...