We thank all the members of the Iwasaki lab for critical reading of the manuscript. This work was supported in part by a Grant-in-Aid for Scientific Research on Innovative Areas (#26113005 to S.N. and JP17H05679 to S.I.); a Grant-in-Aid for Young Scientists (A) (JP17H04998 to S.I.) from the Ministry of Education, Science, Sports, and Culture of Japan (MEXT); and the Pioneering Projects &#34;Cellular Evolution&#34; and all RIKEN project &#34;Disease and Epigenome&#34; from RIKEN (to S.N. and S.I.).

All methods described herein have been approved by the safety division of RIKEN (H27-EP071) and conducted with relevant guidelines and regulations.
1. Tissue dissection
<ol>
	<li>Dissect the tissues of interest into small pieces (approximately &#60;3 mm2) using fine spring scissors. 
	Note: Larger tissue fragments take longer to freeze, and smaller pieces will carry over larger volumes of buffer, both of which may affect the results.</li>
	<li>Add the dissected tissue fragments to a clean container filled with liquid nitrogen and collect them into 2 mL tubes (1 piece per tube) filled with liquid nitrogen. 
	Note: Tubes with a hydrophilic surface are recommended for this step.</li>
	<li>Place the tubes at -80 &#176;C for &#62; 5 min with the cap open to evaporate the remaining liquid nitrogen. 
	Note: After closing the cap, tissue fragments can be stored at -80 &#176;C for one month before use.</li>
</ol>
2. Cell fixation
Note: We used a handy cryogenic grinder for this step. An alternative apparatus can be used.
<ol>
	<li>Place the 2 mL-protein low binding tubes containing the tissue samples on a metal ice rack chilled in liquid nitrogen.</li>
	<li>Place a metal bullet in a 1.5 mL-tube and chill with liquid nitrogen. Place it on the metal ice rack.</li>
	<li>Open the 2 mL-tube and place the prechilled metal bullet into the tube. Close the cap, set the 2 mL-tubes into the tube holder of a handy cryogenic grinder, and immediately dip the assembled tube holder in liquid nitrogen for 1 min.</li>
	<li>Insert the frozen tube holder into the outer cassette of the handy cryogenic grinder and shake vigorously 60 times for 30 s.</li>
	<li>Disassemble the tube holder, remove the metal bullet, and place the 2 mL-tube on a sample cooler prechilled at -20 &#176;C.</li>
	<li>Place the sample cooler at -20 &#176;C for 15 min to prevent freezing of the fixative in the next step.</li>
	<li>Bring the sample cooler to the bench, open the lid of the tube, and immediately drip 900 &#181;L of 1% formaldehyde into it. After pipetting several times, transfer the suspension into new 2 mL-tube containing 900 &#181;L of 1% formaldehyde and fix for 10 min with gentle rotation in an incubator set at 23 &#176;C. 
	CAUTION: Formaldehyde is toxic and harmful.</li>
	<li>To stop the fixation reaction, add 100 &#181;L of 2.5 M glycine to each tube and centrifuge for 5 min at 3,000 x g at 4 &#176;C. Discard the supernatant.</li>
	<li>Add 1 mL of ice-cold phosphate-buffered saline (PBS), centrifuge for 5 min at 3,000 x g at 4 &#176;C, and discard the supernatant. Repeat this step twice (3 washes in total). 
	Note: Fixed samples can be flash-frozen by liquid nitrogen and stored at -80 &#176;C.</li>
	<li>Add 500 &#181;L of Lysis Buffer 1 (50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 7.5), 140 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0), 10% w/v glycerol, 0.5% w/v NP-40, 0.25% w/v Triton X-100, and 0.1x protease inhibitor cocktail) to the pellet, pipet several times, and rotate for 10 min at 4 &#176;C. 
	NOTE: Lysis Buffer 1 should be filtered and stored at 4 &#176;C before use.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 1 mL of Lysis Buffer 2 (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA (pH 8.0), 0.5 mM EGTA, and 0.1x protease inhibitor cocktail) to the pellet, vortex, and rotate for 10 min at 4 &#176;C. 
	NOTE: Lysis Buffer 2 should be filtered and stored at 4 &#176;C before use.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 800 &#181;L of radioimmunoprecipitation assay (RIPA) buffer with 1x protease inhibitor cocktail to the pellet and resuspend the pellet by pipetting.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 500 &#181;L of RIPA buffer with 1x protease inhibitor cocktail.</li>
	<li>Centrifuge for 5 min at 3,000 x g at 4 &#176;C and discard the supernatant.</li>
	<li>Add 1 mL of RIPA buffer with 1x protease inhibitor cocktail. Immediately proceed to the next step.</li>
</ol>
3. Chromatin Shearing
<ol>
	<li>Transfer the lysate to a sonicator tube and then place the tube on an ultrasonicator.</li>
	<li>Shear the chromatin with the following settings: temperature: 4 &#176;C; peak incident power: 175 W; duty factor: 10%; cycles/burst: 200; and time: 2,400 s.</li>
	<li>Transfer the sample to a 1.5 mL-protein low binding tube and centrifuge for 5 min at 20,000 x g at 4 &#176;C.</li>
	<li>Collect the supernatant into a new protein low binding tube. 
	Note: The sample can be flash-frozen in liquid nitrogen and stored at -80 &#176;C.</li>
</ol>
4. Quality check of DNA (Reverse Crosslinking)
<ol>
	<li>Mix 20 &#181;L of the lysate and 180 &#181;L of ChIP Elution Buffer (10 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5 mM EDTA (pH 8.0), and 1% w/v sodium dodecyl sulfate (SDS)) in a polymerase chain reaction (PCR) tube. Incubate the sample at 65 &#176;C in a thermal cycler for 6 h with the thermal cycler lid open. Keep the lid of the thermal cycler open to avoid over-denaturation. 
	Note: The ChIP Elution Buffer should be filtered and stored at room temperature before use. This incubation can be extended to overnight.</li>
	<li>Add 1 &#181;L of 10 mg/mL RNase A, vortex, and incubate at 37 &#176;C for 30 min.</li>
	<li>Add 6.5 &#181;L of 15 mg/mL proteinase K, vortex, and incubate at 55 &#176;C for 60 min.</li>
	<li>Transfer the reaction to a DNA low binding tube, add 4 &#181;L of 5 mg/mL glycogen, and vortex. Then, add 200 &#181;L of phenol/chloroform/isoamyl alcohol (25:24:1) and centrifuge for 5 min at 18,000 x g at room temperature.</li>
	<li>Transfer the supernatant to a new DNA low binding tube. Add 200 &#181;L of Tris-EDTA-NaCl buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), and 200 mM NaCl) to the remaining phenol/chloroform/isoamyl alcohol solution and centrifuge for 5 min at 18,000 x g at room temperature. Collect the supernatant and mix with the first supernatant.</li>
	<li>Add 900 &#181;L of ice-cold ethanol and incubate for 1 h at -20 &#176;C. 
	Note: This incubation can be extended to 4- 6 h.</li>
	<li>Centrifuge for 30 min at 18,000 x g at 4 &#176;C.</li>
	<li>Discard the supernatant. Add 1 mL of ice-cold 75% ethanol to the pellet and centrifuge for 30 min at 18,000 x g at 4 &#176;C. Repeat this step (two washes in total).</li>
	<li>Discard the supernatant thoroughly and air-dry for 1 min at room temperature.</li>
	<li>Add 50 &#181;L of Tris-EDTA (TE) buffer and dissolve the DNA by incubating it at room temperature for 30 min or at 4 &#176;C overnight. Avoid vortexing or pipetting. Keep this DNA as &#8220;input&#8221; and use it for library preparation if necessary.</li>
	<li>Measure the DNA concentration with a fluorometer according to the manufacturer&#8217;s instruction (see Table of Materials) and check the size distribution with a microfluidic electrophoresis machine (see representative data shown in Figure 2A). Use 10 ng or less DNA for this assay. 
	Note: Fragments of 100&#8211;500 base pairs (bp) should make up 50% or more of the DNA.</li>
</ol>
5. Affinity purification by anti-FLAG antibody
Note: For neuron tChIP-Seq, brain tissues from 8 mice are typically used for one sample of tChIP-Seq to prepare 2 ng of purified DNA by tandem immune-purification (see Step 7.1). In our hands, 0.1 ng of DNA still provided high-quality DNA libraries for ChIP-Seq (Kadota, unpublished). Thus, in theory, a single mouse may be sufficient to perform neuron tChIP-Seq. The required amount should be optimized for the tissue and cell type of interest. For the negative control of the imumuno-purification experiment, brain tissue lysate from mice without any H2B-FLAG expression should be prepared and used.
<ol>
	<li>Pipette 200 &#181;L of the magnetic beads conjugated to sheep anti-mouse immunoglobulin G (IgG) into a protein low binding tube.</li>
	<li>Place the tube onto a magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and vortex. Repeat this step (two washes in total).</li>
	<li>Add 20 &#181;L of 1 mg/mL anti-FLAG antibody and rotate for 5 h at 4 &#176;C. 
	Note: This incubation can be extended to overnight.</li>
	<li>Wash the beads following Step 5.2. Place the beads into a 15-mL tube.</li>
	<li>Resuspend the beads in 1110 &#181;L of RIPA buffer and then add 900 &#181;L of 10x blocking reagent, 180 &#181;L of 50x Denhardt&#8217;s solution, 10 &#181;L of 100x protease inhibitor cocktail, and 6.8 mL of the lysate prepared in Step 3. Split this mixture into 5 protein low binding tubes. Rotate for 6 h at 4 &#176;C. 
	Note: This incubation can be extended to overnight.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 5 times (6 washes in total). Pool all the beads into a single protein low binding tube.</li>
	<li>Add 200 &#181;L of ChIP Elution Buffer and rotate for 15 min at room temperature. Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2B and C). Immediately proceed to the next step.</li>
</ol>
6. Affinity Purification by Anti-H3K4me3 Antibody and Reverse Crosslinking
Note: The following bead preparation Steps (6.1&#8211;6.4) should be performed before Step 5.7.
<ol>
	<li>Pipette 40 &#181;L of magnetic beads conjugated to sheep anti-mouse IgG into a 2 mL-protein low binding tube.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of ice-cold PBS, and gently mix. Repeat this step (two washes in total).</li>
	<li>Add 4 &#181;L of 1 mg/mL anti-H3K4me3 antibody and rotate for 6 h at 4 &#176;C.</li>
	<li>Wash the beads following Step 6.2. Place the beads into a 2 mL-protein low binding tube.</li>
	<li>Resuspend the beads in 1558 &#181;L of RIPA buffer and then add 200 &#181;L of 10x blocking reagent, 40 &#181;L of 50x Denhardt&#8217;s solution, 2 &#181;L of 100x protease inhibitor cocktail, and 200 &#181;L of the eluate prepared in Step 5.7. Rotate overnight at 4 &#176;C. 
	Note: The SDS in the ChIP elution buffer was diluted more than 10 times in this incubation.</li>
	<li>Place the tube onto the magnetic stand and wait for 1 min for the supernatant to become clear. Discard the supernatant, add 1 mL of RIPA buffer, and gently mix. Repeat this step 4 times (5 washes in total). After the last wash, transfer the beads into a DNA low binding tube, and discard the supernatant.</li>
	<li>Add 200 &#181;L of ChIP Elution Buffer and rotate for 15 min at room temperature. Transfer the eluate to a new DNA low bindingTube. 
	Note: The eluate can be stored at -80 &#176;C.</li>
	<li>Follow Step 4 for decrosslinking of the DNA. Resuspend the purified DNA in 20 &#181;L of TE buffer.</li>
	<li>Check the quality of the DNA as described in Step 4.11 (see representative data shown in Figure 2D). (optional) Perform enrichment analysis by quantitative PCR as described previously2. Ten-fold or greater enrichment should be observed.</li>
</ol>
7. Library Construction
<ol>
	<li>For each input and ChIP DNA sample, calculate the proportion of DNA in the 100&#8211;500-bp region using the smear analysis function of the software for the microfluidic electrophoresis machine. Estimate the sample volume required to obtain 2 ng of 100&#8211;500 bp DNA. Use 20 ng DNA in the 100&#8211;500-bp range as the &#8220;input&#8221; sample.</li>
	<li>Pipette DNA samples into 8-strip PCR tubes and add H2O to bring the total volume to 10 &#181;L. (optional) If the volume of DNA exceeds 10 &#181;L, proportionally scale-up the following end-repair reaction and the size selection.</li>
	<li>Prepare end-repair master mix (see Table of Materials). Add 4 &#181;L of end-repair master mix to the DNA and incubate for 30 min at 20 &#176;C.</li>
	<li>Add 36 &#181;L of 10 mM Tris-Cl, pH 8.5 and 0.6x volume (30 &#181;L) of solid phase reversible immobilization (SPRI) magnetic beads and incubate for 5 min at room temperature.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Transfer the supernatant to a new tube, add 1.2x volumes (60 &#181;L) of SPRI magnetic beads, and incubate 5 min at room temperature.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Wash the beads twice with 200 &#181;L of 80% EtOH, holding the tube still on the magnet.</li>
	<li>Briefly centrifuge the tube to collect the residual EtOH at the bottom and place it back on the magnet. Remove the residual EtOH thoroughly.</li>
	<li>Leave the tube lid open for 1-2 min to allow the EtOH to evaporate.</li>
	<li>Close the lid and keep the tube on ice. 
	Note: Now you have obtained size-selected DNA of 100&#8211;500 bp on the beads. Further details about double size selection can be found on the manufacturer&#8217;s website (www.beckman.com).</li>
	<li>Prepare A-tailing master mix (see Table of Materials).</li>
	<li>Resuspend the beads (from Step 7.10) with 10 &#181;L of A-tailing master mix and incubate for 30 min at 30 &#176;C.</li>
	<li>Add 1.8x volume (18 &#181;L) of polyethylene glycol (PEG)/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.11 to purify the DNA.</li>
	<li>Prepare ligation buffer mix (see Table of Materials).</li>
	<li>Pipette 8 &#181;L of ligation buffer mix onto the beads (from Step 7.14), add 1 &#181;L of 1 &#181;M adapter, and resuspend the beads. Use 1 &#181;L of 5 &#181;M adapter for the input sample. Consider using different adapters for each sample for multiplexing.</li>
	<li>Add 1 &#181;L of DNA Ligase and incubate for 15 min at 20 &#176;C.</li>
	<li>Add 1.0x volume (10 &#181;L) of PEG/NaCl solution, resuspend the beads, and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 25 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Add 1.0x volume (25 &#181;L) of PEG/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 11 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Collect the supernatant into a new 8-strip PCR tube.</li>
	<li>Prepare real-time PCR master mix (see Materials for details).</li>
	<li>Pipette 8.5 &#181;L of real-time PCR master mix in a 384-well quantitative PCR (qPCR) plate and add 1.5 &#181;L of the adapter ligated DNA (from Step 7.26).</li>
	<li>Pipette 10 &#181;L of each fluorescent standard in empty wells.</li>
	<li>Perform real-time PCR with the following programm: (98 &#176;C for 45 s) x 1 cycle, (98 &#176;C for 15 s, 60 &#176;C for 30 s, 72 &#176;C for 30 s) x 20 cycles, and (72 &#176;C for 60 s) x 1 cycle.</li>
	<li>Determine the number of PCR cycles needed to reach the fluorescence intensity of the Fluorescent Standard 2.</li>
	<li>Prepare the PCR master mix (see Table of Materials).</li>
	<li>Pipette 11.5 &#181;L of the PCR master mix into the remaining adapter-ligated DNA (from Step 7.26) and perform PCR as indicated in Step 7.30 with the PCR cycles determined in Step 7.31.</li>
	<li>Add 1.0x volume (20 &#181;L) of PEG/NaCl solution and incubate for 5 min at room temperature.</li>
	<li>Follow Steps 7.7-7.10 to purify the DNA.</li>
	<li>Pipette 20 &#181;L of 10 mM Tris-Cl, pH 8.5 into the tube and resuspend the beads.</li>
	<li>Place the tube on a magnetic stand and wait until the supernatant becomes clear.</li>
	<li>Collect the supernatant into a new 1.5 mL-DNA low binding tube.</li>
	<li>Check the quality of the library as described in Step 4.11 (see representative data shown in Figure 2E and F). Use 1 &#181;L of the library DNA sample. (optional) Perform enrichment analysis by qPCR as described previously 2. Ten-fold or greater enrichment should be observed.</li>
</ol>
8. Sequencing
<ol>
	<li>Sequence the libraries in a next-generation sequencer (see representative data shown in Figure 3). 
	Note: The sequence depth sufficient for the data analysis will vary depending on the genome size of the organism3. For human and mouse, we recommend obtaining at least 20-40 million single-end reads. According to the yield of reads, multiplexing might be cost effective.</li>
</ol>

<ol>
	<li>Mito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+survey+of+epigenetic+modifications+by+tandem+chromatin+immunoprecipitation+sequencing.">Cell type-specific survey of epigenetic modifications by tandem chromatin immunoprecipitation sequencing.</a> Scientific Reports. 8 (1), 1143 (2018).</li><li>Kadota, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+binding+landscape+in+jawless+fish+with+reference+to+Hox+cluster+evolution.">CTCF binding landscape in jawless fish with reference to Hox cluster evolution.</a> Scientific Reports. 7 (1), 4957 (2017).</li><li>Jung, Y. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+sequencing+depth+in+ChIP-seq+experiments.">Impact of sequencing depth in ChIP-seq experiments.</a> Nucleic Acids Research. 42 (9), (2014).</li><li>Becker, P. B., Workman, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleosome+remodeling+and+epigenetics.">Nucleosome remodeling and epigenetics.</a> Cold Spring Harbor Perspectives in Biology. 5 (9), a017905 (2013).</li><li>Kidder, B. L., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+library+preparation+for+next-generation+sequencing+analysis+of+genome-wide+epigenetic+and+transcriptional+landscapes+in+embryonic+stem+cells.">Efficient library preparation for next-generation sequencing analysis of genome-wide epigenetic and transcriptional landscapes in embryonic stem cells.</a> Methods in Molecular Biology. , 3-20 (2014).</li><li>Gilfillan, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Limitations+and+possibilities+of+low+cell+number+ChIP-seq.">Limitations and possibilities of low cell number ChIP-seq.</a> BMC Genomics. 13, 645 (2012).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nature Methods. 12 (10), 963-965 (2015).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA-sequencing+transcriptome+and+splicing+database+of+glia,+neurons,+and+vascular+cells+of+the+cerebral+cortex.">An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex.</a> Journal of Neuroscience. 34 (36), 11929-11947 (2014).</li><li>Hornstein, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ligation-free+ribosome+profiling+of+cell+type-specific+translation+in+the+brain.">Ligation-free ribosome profiling of cell type-specific translation in the brain.</a> Genome Biology. 17 (1), 149 (2016).</li><li>Zhao, Y., Garcia, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+catalog+of+currently+documented+histone+modifications.">Comprehensive catalog of currently documented histone modifications.</a> Cold Spring Harbor Perspectives in Biology. 7 (9), a025064 (2015).</li><li>Hoffman, E. A., Frey, B. L., Smith, L. M., Auble, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde+crosslinking:+a+tool+for+the+study+of+chromatin+complexes.">Formaldehyde crosslinking: a tool for the study of chromatin complexes.</a> The Journal of Biological Chemistry. 290 (44), 26404-26411 (2015).</li></ol>

The authors have nothing to disclose.

Our protocol was optimized for the neurons of the mouse brain, in which the expression of FLAG-tagged H2B is induced by tamoxifen injection. Promoters used for H2B expression, starting tissue materials, and the amount of the tissues are pivotal parameters for successful tChIP-Seq. Thus, the optimization of these factors should be considered for each cell type of interest.
A critical step among the procedures used in this protocol is the DNA shearing to achieve a chromatin length of 100-500 bp<...

Tissues of animals consist of diverse cell types. The gene regulation in each cell defines the cell type. Chromatin modifications - DNA methylation and histone modification - underlie the cell-type specificity of gene expression. Thus, the measurement of epigenetic regulation in each cell type has been desired, but it has been a technical challenge.
To investigate the epigenetics in a particular cell type, tandem chromatin immunoprecipitation sequencing (tChIP-Seq) was recently developed (Figure 1)1. In tChIP, epitope-tagged core histone protein H2B is expressed from a cell-type-specific promoter. This feature allows the isolation of chromatins from the cells of interest, although the material starts from a mixture of various cell types. Following ChIP-Seq &#8212; chromatin purification via a modified-histone mark and next-generation deep sequencing of isolated DNA &#8212; we can monitor the epigenetic status of the targeted cell type in a genome-wide manner.
Using this technique, we recently investigated neuron-specific trimethylation of histone H3 protein at lysine 4 (H3K4me3) marks. In that study, we developed a knock-in mouse in which C-terminally FLAG-tagged H2B protein was expressed upon Cre-mediated recombination (Rosa26CAG floxed-pA H2B-FLAG). By crossing with a mouse possessing the Cre-endoplasmic reticulum (ER) gene under the control of the CamK2a promoter, the obtained mouse line induced H2B-FLAG in active neurons upon tamoxifen injection (Camk2aH2B-FLAG)1. Starting from the brain of the established mouse line, we performed tChIP-Seq with anti-H3K4me3 antibody. Since H3K4me3 marks often correspond to promoter regions, we could discover hundreds of mRNAs specifically expressed in neurons1.
Here, we describe a typical tChIP-Seq method that covers the steps from tissue dissection to library construction (Figure 1). The final goal of this protocol is to share our best practices for the performance of tChIP-Seq and the future application of this method to other cell types and histone modifications.

<table><tbody><tr><td>Protein LoBind tube, 2 mL</td><td>Eppendorf</td><td>No.&amp;nbsp;0030108132</td><td>For cell lysis</td></tr><tr><td>Protein LoBind tube, 1.5 mL</td><td>Eppendorf</td><td>No.&amp;nbsp;0030108116</td><td>For ChIP and library preparation</td></tr><tr><td>DNA LoBind tube, 1.5 mL</td><td>Eppendorf</td><td>No.&amp;nbsp;0030108051</td><td>For ChIP and library preparation</td></tr><tr><td>8-strip PCR tube</td><td>BIO-BIK</td><td>3247-00</td><td>For ChIP and library preparation</td></tr><tr><td>SK Mill</td><td>TOKKEN</td><td>SK-200</td><td>Handy cryogenic grinder to make cell powder for fixation</td></tr><tr><td>Metal bullet</td><td>TOKKEN</td><td>SK-100-DLC10</td><td>Accessory of SK Mill</td></tr><tr><td>2 mL stainless steel tube</td><td>TOKKEN</td><td>TK-AM5-SUS</td><td>An option for cell lysis</td></tr><tr><td>2 mL stainless steel tube holder</td><td>TOKKEN</td><td>SK-100-TL</td><td>An option for cell lysis</td></tr><tr><td>16% formaldehyde (w/v), methanol-free</td><td>Pierce</td><td>28906</td><td>To fix cells. Prepare 1% solution before use.</td></tr><tr><td>Glycine</td><td>Nacalai Tesque</td><td>17109-35</td><td>Prepare 2.5 M stock</td></tr><tr><td>D-PBS (-)(1x)</td><td>Nacalai Tesque</td><td>14249-24</td><td>For washing lysate and purified DNA</td></tr><tr><td>HEPES</td><td>Nacalai Tesque</td><td>02443-05</td><td>For Lysis buffer 1. Prepare 1 M, pH 7.5 stock.</td></tr><tr><td>5 M NaCl, molecular biology grade</td><td>Nacalai Tesque</td><td>06900-14</td><td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td></tr><tr><td>0.5 M EDTA, molecular biology grade</td><td>Wako Pure Chemical Industries, Ltd.</td><td>311-90075</td><td>For Lysis buffer 1, Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer</td></tr><tr><td>Glycerol</td><td>Wako Pure Chemical Industries, Ltd.</td><td>072-04945</td><td>For lysis buffer 1</td></tr><tr><td>NP-40</td><td>Nacalai Tesque</td><td>25223-75</td><td>For lysis buffer 1</td></tr><tr><td>Triton X-100, molecular biology grade</td><td>Nacalai Tesque</td><td>12967-32</td><td>For Lysis buffer 1</td></tr><tr><td>Tris</td><td>Nacalai Tesque</td><td>35406-91</td><td>For Lysis buffer 2, ChIP Elution Buffer, and Tris-EDTA-NaCl Buffer. Prepare 1 M, pH 8.0 stock.</td></tr><tr><td>0.1 M EGTA pH neutral</td><td>Nacalai Tesque</td><td>08947-35</td><td>For Lysis Buffer 2</td></tr><tr><td>Protease inhibitor cocktail (100x)</td><td>Nacalai Tesque</td><td>25955-24</td><td>To block degradation of protein</td></tr><tr><td>RIPA buffer</td><td>Thermo Fisher Scientific</td><td>89900</td><td>For cell lysis and washing</td></tr><tr><td>milliTUBE 1 mL AFA Fiber</td><td>Covaris</td><td>520130</td><td>Sonicator tube. Accessory of Focused-ultrasonicator</td></tr><tr><td>Focused-ultrasonicator</td><td>Covaris</td><td>S220 or E220</td><td>To digest DNA into adequate size for ChIP-Seq</td></tr><tr><td>UltraPure 10% SDS</td><td>Thermo Fisher Scientific</td><td>15553-027</td><td>For ChIP Elution Buffer</td></tr><tr><td>RNase A</td><td>Nacalai Tesque</td><td>30141-14</td><td>To purify DNA from lysate</td></tr><tr><td>Proteinase K, recombinant, PCR Grade</td><td>Sigma-Aldrich</td><td>3115887001</td><td>To purify DNA from lysate</td></tr><tr><td>Ethanol</td><td>Wako Pure Chemical Industries, Ltd.</td><td>054-07225</td><td>Make 70% solution</td></tr><tr><td>Monoclonal anti-FLAG M2 antibody produced in mouse</td><td>Sigma-Aldrich</td><td>F1804</td><td>To purify chromatin expressed in cells of interest</td></tr><tr><td>Dynabead M-280 Sheep Anti-Mouse IgG</td><td>Thermo Fisher Scientific</td><td>11201D</td><td>This can be used for anti-FLAG IP and anti-H3K4me3 IP</td></tr><tr><td>Anti-tri-methyl histone H3 (K4), mouse monoclonal antibody</td><td>Wako Pure Chemical Industries, Ltd.</td><td>301-34811</td><td>Any other antibody that works for ChIP analysis will work</td></tr><tr><td>10x Blocking Reagent</td><td>Sigma-Aldrich</td><td>11096176001</td><td>For blocking during affinity purification</td></tr><tr><td>Denhardt&amp;rsquo;s solution</td><td>Nacalai Tesque</td><td>10727-74</td><td>For blocking during affinity purification</td></tr><tr><td>Glycogen (5 mg/ml)</td><td>Thermo Fisher Scientific</td><td>AM9510</td><td>To purify DNA from lysate</td></tr><tr><td>Qubit 2.0 Fluorometer</td><td>Thermo Fisher Scientific</td><td>Q32866</td><td>For quantification of isolated DNA</td></tr><tr><td>Qubit dsDNA HS Assay Kit</td><td>Thermo Fisher Scientific</td><td>Q32851</td><td>For quantification of isolated DNA</td></tr><tr><td>0.5 mL tube</td><td>Axygen</td><td>10011-830</td><td>For quantification by Qubit</td></tr><tr><td>Phenol/chloroform/isoamyl alcohol (25:24:1)</td><td>Nacalai Tesque</td><td>25970-56</td><td>To purify DNA from lysate</td></tr><tr><td>AMPure XP beads</td><td>Beckman Coulter</td><td>A63881</td><td>SPRI magnetic beads for library preparation</td></tr><tr><td>Metal ice rack</td><td>Funakoshi</td><td>IR-1</td><td>To keep the cell lysate frozen</td></tr><tr><td>Sample Cooler</td><td>New England Biolabs</td><td>T7771S</td><td>Helps fix cells with minimal damage</td></tr><tr><td>2100 Bioanalyzer</td><td>Agilent Technologies</td><td>G2939BA</td><td>To check the quality of isolated DNA fragments. Another fragment analyzer can be used.</td></tr><tr><td>Bioanalyzer 2100 Expert Software</td><td>Agilent Technologies</td><td>G2946CA</td><td>Supplied with the Bioanalyzer</td></tr><tr><td>High Sensitivity DNA Kit</td><td>Agilent Technologies</td><td>5067-4626</td><td>To check the quality of the isolated DNA fragments</td></tr><tr><td>KAPA LTP Library Preparation Kit</td><td>Roche</td><td>07961898001</td><td>Supplied with 10x KAPA End Repair Buffer, KAPA End Repair Enzyme Mix, KAPA A-Tailing Buffer, KAPA A-Tailing Enzyme, KAPA Ligation Buffer, KAPA DNA Ligase, and PEG/NaCl solution</td></tr><tr><td>NEXTflex DNA Barcodes</td><td>BIOO Scientific</td><td>NOVA-514101</td><td>Adapter for library preparation. Supplied with DNA Barcode Adapters and Primer Mix.</td></tr><tr><td>KAPA Real-Time Library Amplification Kit</td><td>Roche</td><td>07959028001</td><td>Supplied with 2x KAPA HiFi HS real-time PCR Master Mix, PCR Primer Mix, and Fluorescent Standards</td></tr><tr><td>2x KAPA HiFi HotStart ReadyMix</td><td>Roche</td><td>KM2602</td><td>For library preparation. Additionally, this enzyme may be required for the KAPA Real-Time Library Amplification Kit</td></tr><tr><td>Buffer EB</td><td>Qiagen</td><td>19086</td><td>10 mM Tris-Cl, pH 8.5 for elution of DNA</td></tr><tr><td>386-well qPCR plate</td><td>Thermo Fisher Scientific</td><td>4309849</td><td>For real-time PCR</td></tr><tr><td>QuantStudio 7 Flex Real-Time PCR System</td><td>Thermo Fisher Scientific</td><td>4485701</td><td>To quantify DNA</td></tr><tr><td>MicroAmp Optical Adhesive Film</td><td>Thermo Fisher Scientific</td><td>4311971</td><td>For real-time PCR</td></tr><tr><td>MicroAmp Clear Adhesive Film</td><td>Thermo Fisher Scientific</td><td>4306311</td><td>For plate sealing</td></tr><tr><td>End-repair master mix</td><td></td><td></td><td>Combine 1.4 &amp;micro;L of 10x KAPA End Repair Buffer, 1 &amp;micro;L of KAPA End Repair Enzyme Mix, and 1.6 &amp;micro;L of H&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>A-taling master mix</td><td></td><td></td><td>Combine 1 &amp;micro;L of KAPA A-Tailing Buffer, 0.6 &amp;micro;L of KAPA A-Tailing Enzyme, and 8.4 &amp;micro;L of H&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>Ligation buffer mix</td><td></td><td></td><td>Combine 2 &amp;micro;L of KAPA ligation buffer and 6 &amp;micro;L of H&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>Real-time PCR master mix</td><td></td><td></td><td>Combine 5 &amp;micro;L of 2x KAPA HiFi HS real-time PCR Master Mix, 0.35 &amp;micro;L of PCR Primer Mix (10 &amp;micro;M each of forward primer AATGATACGGCGACCACCGAG and reverse primer CAAGCAGAAGACGGCATACGAG), and 3.15 &amp;micro;L of H&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>PCR master mix</td><td></td><td></td><td>Combine 10 &amp;micro;L of 2x KAPA HiFi Ready Mix, 0.9 &amp;micro;L of PCR Primer Mix, and 0.6 &amp;micro;L of H&lt;sub&gt;2&lt;/sub&gt;O</td></tr><tr><td>Integrative Genomics Viewer</td><td>Broad Institute</td><td>IGV_2.3.88</td><td>Genome browser to visualize sequencing data</td></tr><tr><td>DNA olgionucleotide: 5&amp;prime;-GCCTACGCAGGTCTTGCTGAC-3&amp;prime;</td><td>Eurofins Genomics</td><td></td><td>A primer to amplify the promoter region of GAPDH</td></tr><tr><td>DNA olgionucleotide: 5&amp;prime;-CGAGCGCTGACCTTGAGGTC-3&amp;prime;</td><td>Eurofins Genomics</td><td></td><td>A primer to amplify the promoter region of GAPDH</td></tr><tr><td>SYBR Premix Ex Taq</td><td>Takara</td><td>RR420L</td><td>To quantify the DNA corresponding to the GADPH promoter region</td></tr><tr><td>Thermal Cycler Dice</td><td>Takara</td><td>TP870</td><td>To quantify the DNA corresponding to the GADPH promoter region</td></tr></tbody></table>

tchip-seq: cell-type-specific epigenome profiling

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological functions have been extensively studied. Indeed, the advent of next-generation deep sequencing and chromatin immunoprecipitation (ChIP) via specific histone modification antibodies has revolutionized our view of epigenetic regulation across the genome. Conversely, tissues typically consist of diverse cell types, and their complex mixture poses analytic challenges to investigating the epigenome in a particular cell type. To address the cell type-specific chromatin state in a genome-wide manner, we recently developed tandem chromatin immunoprecipitation sequencing (tChIP-Seq), which is based on the selective purification of chromatin by tagged core histone proteins from cell types of interest, followed by ChIP-Seq. The goal of this protocol is the introduction of best practices of tChIP-Seq. This technique provides a versatile tool for tissue-specific epigenome investigation in diverse histone modifications and model organisms.

Here, we describe the tissue dissection, fixation, cell lysis, tandem purification of chromatin, and DNA library preparation for next-generation sequencers. During the procedures, one can test the quality of the DNA, which is the key to successful sequencing, at multiple steps (Figure 2). Since a single nucleosome is typically surrounded by 147 bp DNA 4, sheared DNA should not be shorter than that size. Immediately after ultrasonicatio...

Watch this Scientific Journal Video about TChIP-Seq: Cell-Type-Specific Epigenome Profiling at JoVE.com

TChIP-Seq: Cell-Type-Specific Epigenome Profiling

We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Epigenetic regulation plays central roles in gene expression. Since histone modification was discovered in the 1960s, its physiological and pathological ...

tchip-seq-cell-type-specific-epigenome-profiling

Research

Education

JoVE Core

JoVE Journal

Cell Biology

Biology

Unit 1

Control of Gene Expression

SCIENTISTS IN ACTION

7.6K Views.  RIKEN. We describe a step-by-step protocol for tandem chromatin immunoprecipitation sequencing (tChIP-Seq) that enables the analysis of cell-type-specific genome-wide histone modification.

Video: TChIP-Seq: Cell-Type-Specific Epigenome Profiling

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Genetics

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Cancer Research

Epigenetic Regulation of Cardiac Differentiation of Embryonic Stem Cells and Tissues

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated by transcription factors which bind genomic regulatory regions including enhancers and promoters of cardiac constitutive genes. DNA is wrapped around histones that are subjected to chemical modifications. Modifications of histones further lead to repressed, activated or poised gene transcription, thus bringing another level of fine tuning regulation of gene transcription. Embryonic Stem cells (ES cells) recapitulate within embryoid bodies (i.e., cell aggregates) or in 2D culture the early steps of cardiac development. They provide in principle enough material for chromatin immunoprecipitation (ChIP), a technology broadly used to identify gene regulatory regions. Furthermore, human ES cells represent a human cell model of cardiogenesis. At later stages of development, mouse embryonic tissues allow for investigating specific epigenetic landscapes required for determination of cell identity. Herein, we describe protocols of ChIP, sequential ChIP followed by PCR or ChIP-sequencing using ES cells, embryoid bodies and cardiac specific embryonic regions. These protocols allow to investigating the epigenetic regulation of cardiac gene transcription.

A fine tuning regulation of gene transcription underlies embryonic cell fate decision. Herein, we describe chromatin immunoprecipitation assays used to investigate epigenetic regulation of both cardiac differentiation of stem cells and cardiac development of mouse embryos.

Specific gene transcription is a key biological process that underlies cell fate decision during embryonic development. The biological process is mediated ...

Developmental Biology

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease (ChIP-Exo)

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled with high-throughput sequencing (ChIP-seq) is widely used to identify genome-wide binding locations of DNA-binding proteins. However, the ChIP-seq method is limited by its heterogeneity in length of sonicated DNA fragments and non-specific background DNA, resulting in low mapping resolution and uncertainty in DNA-binding sites. To overcome these limitations, the combination of ChIP with exonuclease digestion (ChIP-exo) utilizes 5&#8217; to 3&#8217; exonuclease digestion to trim the heterogeneously sized immunoprecipitated DNA to the protein-DNA crosslinking site. Exonuclease treatment also eliminates non-specific background DNA. The library-prepared and exonuclease-digested DNA can be sent for high-throughput sequencing. The ChIP-exo method allows for near base-pair mapping resolution with greater detection sensitivity and reduced background signal. An optimized ChIP-exo protocol for mammalian cells and next-generation sequencing is described below.

High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease ChIP-Exo

Precise determination of protein-binding locations across the genome is important for understanding gene regulation. Here we describe a&#160;genomic mapping method that treats chromatin-immunoprecipitated DNA with exonuclease digestion (ChIP-exo) followed by high-throughput sequencing. This method detects protein-DNA interactions with near base-pair mapping resolution and high signal-to-noise ratio in mammalian neurons.

Identification of specific protein-DNA interactions on the genome is important for understanding gene regulation. Chromatin immunoprecipitation coupled ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Automating ChIP-seq Experiments to Generate Epigenetic Profiles on 10,000 HeLa Cells

Chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) is a technique of choice for studying protein-DNA interactions. ChIP-seq has been used for mapping protein-DNA interactions and allocating histones modifications. The procedure is tedious and time consuming, and one of the major limitations is the requirement for high amounts of starting material, usually millions of cells. Automation of chromatin immunoprecipitation assays is possible when the procedure is based on the use of magnetic beads. Successful automated protocols of chromatin immunoprecipitation and library preparation have been specifically designed on a commercially available robotic liquid handling system dedicated mainly to automate epigenetic assays. First, validation of automated ChIP-seq assays using antibodies directed against various histone modifications was shown, followed by optimization of the automated protocols to perform chromatin immunoprecipitation and library preparation starting with low cell numbers. The goal of these experiments is to provide a valuable tool for future epigenetic analysis of specific cell types, sub-populations, and biopsy samples.

Methods for mapping in vivo protein-DNA interactions are becoming crucial for every aspect of genomic research but they are laborious, costly, and time consuming. Here a commercially available robotic liquid handling system that automates chromatin immunoprecipitation for mapping in vivo protein-DNA interactions with limited amounts of cells is presented.

Chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) is a technique of choice for studying protein-DNA interactions. ChIP-seq ...

The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5&#39; DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

Here, we present a protocol to achieve near base pair resolution of protein-DNA interactions. This is obtained by exonuclease treatment of DNA fragments selectively enriched by chromatin immunoprecipitation (ChIP-exo) followed by high throughput sequencing.

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA ...

A Semiautomated ChIP-Seq Procedure for Large-scale Epigenetic Studies

Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) is a powerful and widely used approach to profile chromatin DNA associated with specific histone modifications, such as H3K27ac, to help identify cis-regulatory DNA elements. The manual process to complete a ChIP-Seq is labor intensive, technically challenging, and often requires large-cell numbers (&#62;100,000 cells). The method described here helps to overcome those challenges. A complete semiautomated, microscaled H3K27ac ChIP-Seq procedure including cell fixation, chromatin shearing, immunoprecipitation, and sequencing library preparation, for batch of 48 samples for cell number inputs less than 100,000 cells is described in detail. The semiautonomous platform reduces technical variability, improves signal-to-noise ratios, and drastically reduces labor. The system can thereby reduce costs by allowing for reduced reaction volumes, limiting the number of expensive reagents such as enzymes, magnetic beads, antibodies, and hands-on time required. These improvements to the ChIP-Seq method suit perfectly for large-scale epigenetic studies of clinical samples with limited cell numbers in a highly reproducible manner.

This paper describes a semiautomated, microscaled ChIP-Seq protocol of DNA regions associated with a specific histone modification (H3K27ac) using a ChIP liquid-handler platform, followed by library preparation using tagmentation. The procedure includes control assessment for quality and quantity purposes and can be adopted to other histone modifications or transcription factors.

Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) is a powerful and widely used approach to profile chromatin DNA associated with specific ...