This work was supported by &#34;The Sanitation Value Chain: Designing Sanitation Systems as Eco-Community Value System&#34; Project, ResearchInstitute for Humanity and Nature (RIHN, Project No.14200107).

1. Medium Preparation
<ol>
	<li>To make a cell culture medium (serum-containing medium), add 4.7 g of Eagle&#8217;s MEM powder to 500 mL of distilled water. Autoclave at 120 &#176;C for 20 min and let the medium cool to room temperature. Add fetal bovine serum (final concentration: 10%), L-Glutamine (2 mM), Penicillin Streptomycin (1%) and sodium bicarbonate (1.125 g/L). Store at 4 &#176;C for 1 month.</li>
	<li>Prepare the serum-free medium for the virus propagation as described in step 1.1, but without the fetal bovine serum. Store at 4 &#176;C for 1 month.</li>
	<li>For the plaque assay, sterilize 100 mL of Eagle&#8217;s MEM medium (non-containing phenol red) by autoclaving. Let the medium cool to room temperature, and then add 2% FBS, 2% Penicillin Streptomycin, 4 mM L-Glutamine, and 2.25 g/L NaHCO3. Store at 4 &#176;C.</li>
	<li>For the plaque assay, sterilize 100 mL of 2.5% agarose gel by autoclave. Prepare the gel the same day the plaque assay is conducted. Store the gel at 47 &#176;C in a water bath.</li>
</ol>
2. Cell Culture
<ol>
	<li>Remove a cryotube containing MA104 cell lines from the liquid nitrogen container. Place the cryotube in a water bath at 37 &#176;C to thaw the cells. Add 1 mL of the cell suspension to 20 mL of the serum-containing medium in a T75 flask. Incubate the flask in an incubator at 37 &#176;C and 5% CO2 for 2 or 3 days. 
	NOTE: The final cell concentration in the suspension is about 106 cells/mL.</li>
	<li>Once the cell monolayer reaches 80% confluency, remove the supernatant and wash the cells twice with 5 mL of 1x Dulbecco&#8217;s PBS (phosphate buffered saline).</li>
	<li>Add 4 mL of 0.05% trypsin-EDTA to the flask and incubate at 37 &#176;C for 5 min to detach the cells from the flask. Transfer the cell suspension to a 15 mL tube and centrifuge at 190 x g for 5 min.</li>
	<li>Discard the supernatant and resuspend the pelleted cells (106 cells) in 1 mL of serum-containing medium prepared in 1.1. Dilute the resuspended cells at 100-fold with the medium.</li>
	<li>Add 3 mL of the diluted cell suspension to each well of 6-well (for the plaque assay) or 24-well plates (for the cell-binding assay), respectively. Incubate the plates in an incubator at 37 &#176;C and 5% CO2 under the saturated vapor for 2 or 3 days. 
	NOTE: A T75 flask is suitable to collect the time-course samples because the sample volume of the supernatant (1 mL) can be ignored compared to the total supernatant volume (30 mL). Meanwhile, the infectious titer of the virus in each supernatant is measured by the plaque assay, which is usually conducted using a 6-well plate. A 24-well plate is utilized for the cell-binding assay.</li>
</ol>
3. Specific Growth Rate of Rotavirus
NOTE: Rhesus rotavirus (RRV, genotype: G3P[3]) is utilized in this protocol because RRV can rapidly and easily form plaques with MA104 cells.
<ol>
	<li>Place a tube containing 1 mL of the virus suspension (107 pfu/mL) in a serum-free medium stored at -80 &#176;C in a water bath at 37 &#176;C to thaw. Add 1 &#181;g/&#181;L trypsin from porcine pancreas to 1 mL of the virus suspension (final trypsin concentration is 4 &#181;g/mL) and then vortex. Incubate the virus suspension at 37 &#176;C and 5% CO2 under the saturated vapor for 30 min. 
	NOTE: Trypsin from the other sources can be used, but the effect on rotavirus infectivity needs to be tested in advance.</li>
	<li>Dilute the activated virus suspension with a serum-free medium to adjust the multiplicity of infection (MOI) to 0.1 pfu/cell.</li>
	<li>Add 1 mL of diluted virus suspension to MA104 cell lines (80% confluent) in a T75 flask 3 days after the cell plating (2.1), incubate at 37 &#176;C for 1 h, and gently shake the flask every 15 min.</li>
	<li>Then, add 30 mL of a serum-free medium containing 0.13 &#181;g/mL of trypsin from a porcine pancreas to the flask. Incubate the flask at 37 &#176;C and 5% CO2 under the saturated vapor.</li>
	<li>Collect 1 mL of the supernatant in the flask at 0, 6, 12, 18, 24, and 36 (and/or 48) h post-infection (hpi) and replace the supernatant in the 1.5 mL tubes using a pipette.</li>
	<li>Conduct the freeze (-80 &#176;C) and melt in a water bath at 37 &#176;C cycle three times. Then centrifuge the tubes at 12,600 x g for 10 min at 4 &#176;C. Collect the supernatant.</li>
	<li>Filter the supernatant with a distilled 0.2 &#181;m filter to remove the cell fraction. Store the supernatant -80 &#176;C in the refrigerator until applying it to the plaque assay for measuring the virus titer.</li>
	<li>Place the tubes containing the collected supernatant (step 3.5) in a water bath at 37 &#176;C. Add 4 &#181;g/mL trypsin to a 1 mL of 10-fold diluted sample and incubate at 37 &#176;C for 30 min.</li>
	<li>During the 30 min incubation in 3.8, to begin the plaque assay for measuring the virus titer obtained from time course samples (step 3.5), wash the MA104 cells twice in a 6-well plate with 2 mL of 1x PBS after removing the serum-containing medium.</li>
	<li>Serially dilute the incubated samples with a serum-free medium and inoculate 1 mL of the diluted sample into each well. Incubate the plate for 90 min at 37 &#176;C and 5% CO2 under the saturated vapor, and gently shake the plate every 15 min.</li>
	<li>After incubation, remove the inoculum from the 6-well plate. Add 4 &#181;g/mL trypsin to the medium prepared in (step 1.3). Gently but immediately add 3 mL of the medium mixed with agarose gel (the ratio is 1:1) to each well.</li>
	<li>Keep the plate at room temperature for more than 10 min (until the agarose gel becomes solid) and incubate for 2 days at 37 &#176;C and 5% CO2 under the saturated vapor. 
	NOTE: Pour the medium mixed with agar from the edge of the well.</li>
	<li>Add 1 mL of the 0.015% neutral red solution diluted with 1x PBS to each well and incubate at 37 &#176;C and 5% CO2 under the saturated vapor. Remove the dye after 3 h and incubate for 1 day at 37 &#176;C and 5% CO2 under the saturated vapor.</li>
	<li>The next day, count the number of plaques in each well and calculate the pfu/mL. Carefully check the cell confluence before the plaque assay to assure the plaque numbers.</li>
</ol>
4. Cell-binding Assay
NOTE: This protocol is based on Gilling&#8217;s report13.
<ol>
	<li>Add 1 &#181;g/&#181;L trypsin from a porcine pancreas to 1 mL of the virus suspension (final trypsin concentration is 4 &#181;g/mL) and then vortex (in the same manner as in 2.1). Dilute the virus suspension with a serum-free medium to adjust the MOI of 1 pfu/cell.</li>
	<li>Then, wash the MA104 cells twice on 24-well plate with 1 ml of Tris-buffered saline (TBS; 2.53 g/L Tris base, 6.54 g/L NaCl, 0.3 g/L KCl, 0.046 g/l Na2HPO4 to reach 1 L with distilled water).</li>
	<li>Inoculate 100 &#181;L of diluted virus suspension to each well of a 24-well plate with cells, and incubate at 4 &#176;C for 90 min, with gentle shaking every 15 min.</li>
	<li>Remove the virus inoculum and wash the cells twice with 1 mL of TBS. To extract the double-stranded (ds) RNA of the rotavirus, add 140 &#181;L of 1x PBS and 560 &#181;L of the RNA extraction buffer (see Table of Materials) to each well. Mix adequately with a pipette (about 10x or until the haze or contaminant of cells in the buffer is not seen).</li>
	<li>After recovering the double stranded RNA (dsRNA) according to the manufacturer&#8217;s protocol, place the 1.5 mL tubes containing the dsRNA extract on a heat block at 95 &#176;C for 5 min to denature the dsRNA, and then immediately place the tubes on ice and incubate for more than 2 min.</li>
	<li>Synthesize the cDNA by using a reverse transcription kit (see Table of Materials). Add 4 &#181;L of denatured viral RNA solution to a PCR tube containing 16 &#181;l of mixture (Table 1) and mix it carefully with a pipette so as not to generate bubbles. Spin down the tubes.</li>
	<li>Perform the reverse transcription with a thermal cycler under the condition shown in Table 2. If the cDNA is not used immediately, store the PCR tube containing the cDNA at -20 &#176;C for up to 1 year.</li>
	<li>Use the primers for quantitative PCR (Forward; 5&#8217;-ACCATCTACACATGACCCTC-3&#8217;, Reverse; 5&#8217;-GGTCACATAACGCCCC-3&#8217;)14 and a probe inserting a quencher (qPCR Probes; 5&#8217;-/FAM/ATGAGCACA/quencher/ATAGTTAAAAGCTAACACTGTCAA/TAMRA/-3&#8217;), targeting the 963 &#8211; 1049 region of NSP3 genome segment of rotavirus (ST3 strain, GenBank: X81436). 
	NOTE: Quencher is inserted into the probe designed by Zeng et al.14</li>
	<li>Dilute the standard plasmid serially (101 to 106 copies/mL) with PCR grade water to the qPCR mixture (Table 3) and make the master mix (20 &#181;L/sample) for qPCR following Table 4.</li>
	<li>Add 20 &#181;L of the master mix to the well of a 96-well PCR plate, and then mix 5 &#181;L of cDNA samples or 5 &#181;L of the standard plasmid by pipetting 10 times. Start the reaction of the qPCR system according to the conditions shown in Table 4.</li>
	<li>To calculate the rotavirus genome bound to the MA104 cell surface, conduct linear regression between Ct values and the known genome number of a standard plasmid, and estimate the sample&#8217;s genome number. Then calculate the ratio of virion numbers binding to cells (Gt) to those in the initial inoculum (G0).</li>
</ol>

<ol>
	<li>Domingo, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rna+Virus+Mutations.">Rna Virus Mutations.</a> Annual review of microbiology. 51, 151-178 (1997).</li><li>Gouvea, V., Brantly, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Is+rotavirus+a+population+of+reassortants?.">Is rotavirus a population of reassortants?.</a> Trends in Microbiology. 3, 159-162 (1995).</li><li>Rachmadi, A. T., Kitajima, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Free-chlorine+disinfection+as+a+selection+pressure+on+norovirus.">Free-chlorine disinfection as a selection pressure on norovirus.</a> Applied and Environmental Microbiology. 84, (2018).</li><li>Ghosh, S., Kobayashi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genomic+analysis+of+rotavirus+strains:+current+status+and+future+prospects.">Whole-genomic analysis of rotavirus strains: current status and future prospects.</a> Future Microbiology. 6, 1049-1065 (2011).</li><li>Tate, J. E., Burton, A. H., Boschi-Pinto, C., Steele, A. D., Duque, J., Parashar, U. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2008+estimate+of+worldwide+rotavirus-associated+mortality+in+children+younger+than+5+years+before+the+introduction+of+universal+rotavirus+vaccination+programmes:+A+systematic+review+and+meta-analysis.">2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: A systematic review and meta-analysis.</a> The Lancet Infectious Diseases. 12, 136-141 (2008).</li><li>Franco, M. A., Angel, J., Greenberg, H. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunity+and+correlates+of+protection+for+rotavirus+vaccines.">Immunity and correlates of protection for rotavirus vaccines.</a> Vaccine. 24, 2718-2731 (2006).</li><li>Santos, N., Hoshino, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+distribution+of+rotavirus+serotypes/+genotypes+and+its+implication+for+the+development+and+implementation+of+an+effective+rotavirus+vaccine.">Global distribution of rotavirus serotypes/ genotypes and its implication for the development and implementation of an effective rotavirus vaccine.</a> Reviews in Medical Virology. 15, 29-56 (2005).</li><li>Matthijnssens, J., Heylen, E., Zeller, M., Rahman, M., Lemey, P., Van Ranst, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylodynamic+analyses+of+rotavirus+genotypes+G9+and+G12+underscore+their+potential+for+swift+global+spread.">Phylodynamic analyses of rotavirus genotypes G9 and G12 underscore their potential for swift global spread.</a> Molecular Biology and Evolution. 27, 2431-2436 (2010).</li><li>Mukhopadhya, I., Murdoch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+molecular+epidemiology+of+rotavirus+infection+after+introduction+of+monovalent+rotavirus+vaccination+in+Scotland.">Changing molecular epidemiology of rotavirus infection after introduction of monovalent rotavirus vaccination in Scotland.</a> Vaccine. 35, 156-163 (2017).</li><li>Londrigan, S. L., Hewish, M. J., Thomson, M. J., Sanders, G. M., Mustafa, H., Coulson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+of+rotaviruses+in+continuous+human+and+monkey+cell+lines+that+vary+in+their+expression+of+integrins.">Growth of rotaviruses in continuous human and monkey cell lines that vary in their expression of integrins.</a> Journal of General Virology. 81, 2203-2213 (2000).</li><li>Hewish, M. J., Takada, Y., Coulson, B. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrins+a2b1+and+a4b1+can+mediate+SA11+rotavirus+attachment+and+entry+into+cells.">Integrins a2b1 and a4b1 can mediate SA11 rotavirus attachment and entry into cells.</a> Journal of Virology. 74, 228-236 (2000).</li><li>Zwietering, M. H., Jongenburger, I., Rombouts, F. M., van't Riet, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+of+the+bacterial+growth+curve.">Modeling of the bacterial growth curve.</a> Applied and Environmental Microbiology. 56, 1875-1881 (1990).</li><li>Gilling, D. H., Kitajima, M., Torrey, J. R., Bright, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+antiviral+action+of+plant+antimicrobials+against+murine+norovirus.">Mechanisms of antiviral action of plant antimicrobials against murine norovirus.</a> Applied and Environmental Microbiology. 80, 4898-4910 (2014).</li><li>Zeng, S. Q., Halkosalo, A., Salminen, M., Szakal, E. D., Puustinen, L., Vesikari, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+quantitative+RT-PCR+for+the+detection+of+rotavirus+in+acute+gastroenteritis.">One-step quantitative RT-PCR for the detection of rotavirus in acute gastroenteritis.</a> Journal of Virological Methods. 153, 238-240 (2008).</li><li>Rolsma, M. D., Gelberg, H. B., Kuhlenschmidt, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assay+for+evaluation+of+rotavirus-cell+interactions:+identification+of+an+enterocyte+ganglioside+fraction+that+mediates+group+A+porcine+rotavirus+recognition.">Assay for evaluation of rotavirus-cell interactions: identification of an enterocyte ganglioside fraction that mediates group A porcine rotavirus recognition.</a> Journal of Virology. 68, 258-268 (1994).</li><li>Br&#252;ssow, H., Hilpert, H., Walther, I., Sidoti, J., Mietens, C., Bachmann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bovine+milk+immunoglobulins+for+passive+immunity+to+infantile+rotavirus+gastroenteritis.">Bovine milk immunoglobulins for passive immunity to infantile rotavirus gastroenteritis.</a> Journal of Clinical Microbiology. 25, 982-986 (1987).</li><li>Outzen, H., Berglund, G. I., Smal&#229;s, A. O., Willassen, N. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+and+pH+sensitivity+of+trypsins+from+Atlantic+salmon+(Salmo+salar)+in+comparison+with+bovine+and+porcine+trypsin.">Temperature and pH sensitivity of trypsins from Atlantic salmon (Salmo salar) in comparison with bovine and porcine trypsin.</a> Comparative Biochemistry and Physiology - B Biochemistry and Molecular Biology. 115B, 33-45 (1996).</li><li>Saxena, K., Blutt, S. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Intestinal+Enteroids:+a+New+Model+To+Study+Human+Rotavirus+Infection,+Host+Restriction,+and+Pathophysiology.">Human Intestinal Enteroids: a New Model To Study Human Rotavirus Infection, Host Restriction, and Pathophysiology.</a> Journal of Virology. 90, 43-56 (2016).</li><li>Yin, Y., Bijvelds, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+rotavirus+infection+and+antiviral+therapy+using+primary+intestinal+organoids.">Modeling rotavirus infection and antiviral therapy using primary intestinal organoids.</a> Antiviral Research. 123, 120-131 (2015).</li></ol>

The authors have nothing to disclose.

Our protocol for measuring the specific growth rate is easier than previous ones and can be adapted for other viruses unless their cell culture system has not yet been established. In this study, we used RRV (G3P[3]) because this strain can form plaques easier than human rotaviruses when using MA104 cell lines. Some human rotavirus strains cannot form plaque in this cell line. Therefore, instead of the plaque assay, the focus forming unit (FFU) assay15 or median tissue culture infectious dose (TCID50) assay can be applied for many rotavirus strains16. The presented protocol for determining the specific growth rate can be used for other virus types but is not suitable for viruses for which no established cell culture system is established. Before starting the experiment for the specific growth rate, it is better to know in advance when the virus infectious titer starts to increase and reaches the stationary phase in a preliminary test. If too many plaques are present, the plaque assay should be conducted again after changing the dilution rate of the virus samples. The hours post-infection (hpi) to collect samples are also important because the slope of the exponential growth phase may be underestimated if the proper time point to reach the stationary phase is missed. In the approximation by the modified Gompertz model, a coefficient of determination should always be calculated and checked. If the fitness to the modified Gompertz model is low, other growth models such as the modified logistic model12 may be preferable.
In handling cells, when removing the medium or virus inoculum, the PBS for washing or agarose gel for plaque assay must be promptly added to each well of a cell culture plate to prevent the cells from dryness. At the same time, you must gently pour PBS or agarose to cells not to detach from wells. This step is the most important in both assays (step 3.9 and 3.11). If the plaque assay has too many samples, we recommend subdividing the agarose gel (100 mL each maximum is recommended) into several medium bottles and keeping the bottles warm until just before use since agarose gel is solidified within about 10 min at room temperature. Since trypsin is vulnerable to high temperatures17, a trypsin solution should be added to a medium and agarose for the plaque assay after adequately cooling down.
In the cell-binding assay, the incubation for virus binding to cells must be done at 4 &#176;C to prevent invasion of the cells. According to Gilling&#39;s method13, cells are prone to drying at low temperatures, so gentle shaking is necessary every 15 min during incubation. The RNA extraction kit utilized here can be substituted for other kits. The slope of the standard curve in RT-qPCR should be approximately 3.3, and the coefficient of determination should be more than 0.98. Compared to the fluorescence microscope to visualize the localization of viruses in cells, the assay is more rapid and easier to use because binding of fluorescent substances to viruses is not necessary.
Recently, human intestinal enteroid (HIE), exhibiting a similar cellular composition and function as human gastrointestinal epithelium, has become available for rotavirus propagation18. The use of HIE may enable us to evaluate the specific growth rate and cell-binding ability of non-culturable strains of rotavirus. Also, both experiments described here may be applied to the evaluation of drug effects on both phenotypes19. The protocols presented here make it possible to quantitatively discuss the changes in phenotype parameter values of rotavirus strains under varied conditions.

RNA viruses form a genetically diverse population, known as quasispecies1, because of their mutation rate,2 which is higher than that of DNA-based organisms. Population structure in quasispecies is affected by the population genetic factors, including mutation, selection pressure, and genetic drift. Strains within a single genetic lineage may show different phenotypes because of the genetic diversity. For example, Rachmadi et al. showed that free chlorine sensitivity was different among murine norovirus strains that originated from a plaque-purified strain S7-PP33.
Rotaviruses (genus rotavirus in reoviridae family) are non-enveloped ds RNA viruses forming quasispecies2. In addition to the population genetic factors described above, genome reassortment affects the genetic diversity of rotavirus because this virus has 11 segmented genomes4. Rotaviruses cause diarrhea mainly among infants, and infant deaths in 2013 were estimated about 250,0005. Two vaccines are in use in several countries and have been effective in reducing the burden of rotavirus infection, but some researchers are now discussing the presence of vaccine-escape mutants6,7,8,9. The characterization of these mutants is important to understand the vaccine-escape mechanisms.
Here, we present protocols for two assays for evaluating the specific growth rate and cell-binding ability of rotavirus in order to understand the phenotypic differences among strains/mutants. The growth curve of rotaviruses has been presented in previous reports10, but growth parameters such as specific growth rate are not usually measured. A cell-binding assay conducted previously involves the immunofluorescent staining technique11. We show here easier methods of using the plaque assay and RT-qPCR, which allow us to quantitatively discuss the difference in viral phenotypes. These methods are appropriate for the characterization of rotavirus phenotypes and may finally contribute to the construction of new vaccines effective for multiple genotypes.

<table><tbody><tr><td>7500 Real Time PCR System</td><td>Applied Biosystems</td><td></td><td>qPCR</td></tr><tr><td>Agar-EPI</td><td>Nakalai Tesque, Inc</td><td>01101-34</td><td>Plaque assay</td></tr><tr><td>Disodium Hydrogenphosphate</td><td>Wako Pure Chemical Corporation</td><td>194-02875</td><td>Cell binding assay</td></tr><tr><td>Eagle&#039;s MEM &quot;Nissui&quot; &lt;img alt=&quot;One&quot; src=&quot;/files/ftp_upload/58821/01.jpg&quot;/&gt;</td><td>Nissui Pharmaceutical Co., Ltd</td><td>_05900</td><td>Cell culture</td></tr><tr><td>Eagle&#039;s MEM &quot;Nissui&quot; &lt;img alt=&quot;Two&quot; src=&quot;/files/ftp_upload/58821/02.jpg&quot;/&gt;</td><td>Nissui Pharmaceutical Co., Ltd</td><td>_05901</td><td>Plaque assay</td></tr><tr><td>EasYFlask 75 cm2</td><td>Thermo Scientific</td><td>156499</td><td>Cell culture</td></tr><tr><td>Fetal bovine Serim, qualified, USDA-approved regions</td><td>Gibco</td><td>10437028</td><td>Cell culture and Plaque assay</td></tr><tr><td>Forward / Reverse primers</td><td>Eurofins Genomics</td><td></td><td>qPCR</td></tr><tr><td>L-Glutamine, 200 mM Solution</td><td>Gibco</td><td>2530081</td><td>Cell culture and Plaque assay</td></tr><tr><td>Neutral Red</td><td>Wako Pure Chemical Corporation</td><td>140-00932</td><td>Plaque assay</td></tr><tr><td>PBS (-) &quot;Nissui&quot;</td><td>Nissui Pharmaceutical Co., Ltd</td><td>_05913</td><td>Cell culture and Plaque assay</td></tr><tr><td>Penicillin-Streptomycin, Liguid</td><td>Gibco</td><td>15140122</td><td>Cell culture and Plaque assay</td></tr><tr><td>Potassium Chloride</td><td>Wako Pure Chemical Corporation</td><td>163-03545</td><td>Cell binding assay</td></tr><tr><td>Premix ExTaq (Perfect Real Time)</td><td>TAKARA Bio Inc.</td><td>RR039A</td><td>qPCR</td></tr><tr><td>PrimeScriptTN RT reagent Kit (Perfect Real Time)</td><td>TAKARA Bio Inc.</td><td>RR037A</td><td>cDNA synthesis</td></tr><tr><td>PrimeTime qPCR Probes</td><td>Medical and Biological Laboratories Co., Ltd.</td><td></td><td>qPCR</td></tr><tr><td>QIAamp Viral RNA Mini Kit</td><td>QIAGEN</td><td>52904</td><td>RNA extraction</td></tr><tr><td>Sodium Bicarbonate</td><td>Wako Pure Chemical Corporation</td><td>199-05985</td><td>Cell culture and Plaque assay</td></tr><tr><td>Sodium Chloride</td><td>Wako Pure Chemical Corporation</td><td>198-01675</td><td>Cell binding assay</td></tr><tr><td>Tissue culture plates 24-well plate</td><td>TPP</td><td>92024</td><td>Cell binding assay</td></tr><tr><td>Tissue culture plates 6-well plate</td><td>TPP</td><td>92006</td><td>Plaque assay</td></tr><tr><td>Trizma base</td><td>SIGMA-ALDRICH</td><td>T1503</td><td>Cell binding assay</td></tr><tr><td>Trypsin from porcine pancrease</td><td>SIGMA-ALDRICH</td><td>T0303-1G</td><td>Activate for rotavirus</td></tr><tr><td>Trypsin-EDTA (0.05 %), phenol red</td><td>Gibco</td><td>25300054</td><td>Cell culture</td></tr><tr><td>Vertical 96-Well Thermal Cycler</td><td>Applied Biosystems</td><td></td><td>cDNA synthesis</td></tr></tbody></table>

assays for the specific growth rate and cell-binding ability of rotavirus

Rotavirus is the main etiological factor for infantile diarrhea. It is a double-stranded (ds) RNA virus and forms a genetically diverse population, known as quasispecies, owing to their high mutation rate. Here, we describe how to measure the specific growth rate and the cell-binding ability of rotavirus as its phenotypes. Rotavirus is treated with trypsin to recognize the cell receptor and then inoculated into MA104 cell culture. The supernatant, including viral progenies, is collected intermittently. The plaque assay is used to confirm the virus titer (plaque-forming unit: pfu) of each collected supernatant. The specific growth rate is estimated by fitting time-course data of pfu/mL to the modified Gompertz model. In the assay of cell-binding, MA104 cells in a 24-well plate are infected with rotavirus and incubated for 90 min at 4 &#176;C for rotavirus adsorption to cell receptors. A low temperature restrains rotavirus from invading the host cell. After washing to remove unbound virions, RNA is extracted from virions attached to cell receptors followed by cDNA synthesis and reverse-transcription quantitative PCR (RT-qPCR). These protocols can be applied for investigating the phenotypic differences among viral strains.

An overview of two protocols for the specific growth rate and cell-binding assay of plaque- purified RRV strains is shown in Figure 1A and 2A, respectively.
In the assay for the specific growth rate, the final virus titer reaches more than 107 pfu/mL when propagating on the T75 flask. If the maximum concentration is lower than 107 pfu/mL, the MA104 cell may not have become confluent or RRV was not activated well by trypsin. Some growth models are available for estimating the specific growth rate using the infectious unit data. In this protocol, the modified Gompertz model12 is employed as an example; 
<img alt="Equation" src="/files/ftp_upload/58821/58821eq1.jpg" />
where N0 (104 pfu/mL in this study) and Nt (104 to 108 pfu/mL) are the virus infectious titer (pfu/mL) at 0 and t (example: 0, 6, 12, 18, 24, 36) hpi, respectively, A is the asymptotic value [log(N&#8734;/N0)] (example: 3 to 4), &#181; is the specific growth rate [1/h], e is the Napier&#39;s constant and &#955; is the lag period [h]. Model parameters are obtained by the solver function of the analysis software, which minimizes the sum of squares of the difference between the observed and modeled values. In the example in Figure 1B, the specific growth rate (&#181;) is estimated to be 0.197 [1/h] and the lag period (&#955;) is 6.61 [h] by applying the least square method to a modified Gompertz model, and the relative virus titer at the stationary phase to the initial titer (log scale) (A) is 3.15 [log (N&#8734;/N0)]. We have tested 6 rotavirus clones in total, and the estimated values of the specific growth rate ranged from 0.19 to 0.27 [1/h]. These estimated values are reliable because the coefficient of determination values in the model fitting is more than 0.98.
RRV virions binding to cell surfaces were about 103 copies/mL (binding efficiency was around 1%) when using a 24-well plate for the cell-binding assay (Figure 2B). The assay is usually conducted three times for every sample, and if a large variance in the copy number is observed in a sample, some problems such as over-washing and insufficient activation of RRV by trypsin may occur. The Ct value of qPCR exceeding about 36.0 is not preferable and is regarded to be below a detection limit in our qPCR condition.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Volume/ 1 reaction</td>
		</tr>
		<tr>
			<td>5 x PrimeScript Buffer</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>PrimeScript RT Enzyme Mix I</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Oligo dT Primer</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Random 6 mers</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>Deionized distilled water</td>
			<td>6.0 &#181;L</td>
		</tr>
		<tr>
			<td>ssRNA sample</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>20.0 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 1: Master mix composition for cDNA synthesis of rotavirus genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature [&#176;C]</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>37</td>
			<td>15 min</td>
		</tr>
		<tr>
			<td>42</td>
			<td>15 min</td>
		</tr>
		<tr>
			<td>85</td>
			<td>5 s</td>
		</tr>
		<tr>
			<td>4</td>
			<td>&#8734;</td>
		</tr>
	</tbody>
</table>
Table 2: Reaction condition for cDNA synthesis of rotavirus genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Volume/1 reaction</td>
		</tr>
		<tr>
			<td>Premix Taq</td>
			<td>12.5 &#181;L</td>
		</tr>
		<tr>
			<td>Forward primer (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse primer (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Probe (10 &#181;M)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Reference Dye II</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Deionized distilled water</td>
			<td>5.5 &#181;L</td>
		</tr>
		<tr>
			<td>cDNA sample</td>
			<td>5.0 &#181;L</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 3: Master mix composition for quantitative PCR of rotavirus A genome.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature [&#176;C]</td>
			<td>Time</td>
			<td></td>
		</tr>
		<tr>
			<td>95</td>
			<td>5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>94</td>
			<td>20 s</td>
			<td rowspan="2">45 cycle</td>
		</tr>
		<tr>
			<td>60</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72</td>
			<td>5 min</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4: Reaction condition for quantitative PCR of rotavirus A genome.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58821/58821fig1.jpg" /> 
Figure 1: Schematic overview of the estimation of rotavirus growth and the growth curve of rotavirus.&#160;(A) The infectious unit of rotavirus is measured with the plaque assay. (B) The curve (blue line) was approximated by the modified Gompertz model based on observed data in our laboratory (white circle). The specific growth rate [&#181;]; 0.197 [h-1], lag period (&#955;); 6.61 [h], the relative virus titer at the stationary phase to the initial titer (log scale) (A); 3.15 [log (N&#8734;/N0)]. <a href="https://www.jove.com/files/ftp_upload/58821/58821fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58821/58821fig2.jpg" /> 
Figure 2: Schematic overview and representative result of the cell-binding assay of five RRV strains purified from plaques in our laboratory.&#160;(A) A cell culture plate inoculated with rotavirus is incubated at 4 &#176;C for inhibiting the virus invasion into cells. After incubation and removing the unbound viral particles to cells, quantify the number of genomes originating from bound viral particles to the cell surface with RT-qPCR. (B) The result of the cell-binding assay was displayed as binding efficiency (%), which was the ratio of bound viral particles to those present in the inoculum. Bold bar: median, end of boxes: quartile deviation, end of line: maximum and minimum. <a href="https://www.jove.com/files/ftp_upload/58821/58821fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus at JoVE.com

Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus

Here we present two protocols, one for measuring the specific growth rate and the other for the cell-binding ability of rotavirus using the plaque assay and RT-qPCR. These protocols are available for confirming the differences in phenotypes between rotavirus strains.

Rotavirus is the main etiological factor for infantile diarrhea. It is a double-stranded (ds) RNA virus and forms a genetically diverse population, known ...

assays-for-specific-growth-rate-cell-binding-ability

Research

JoVE Journal

Immunology and Infection

8.5K Views.  Tohoku University. Here we present two protocols, one for measuring the specific growth rate and the other for the cell-binding ability of rotavirus using the plaque assay and RT-qPCR. These protocols are available for confirming the differences in phenotypes between rotavirus strains.

Video: Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of discrete plaques (infectious units and cellular dead zones) in cell culture. Here we demonstrate how to perform a basic plaque assay, and how differing overlays and techniques can affect plaque formation and production. Typically solid or semisolid overlay substrates, such as agarose or carboxymethyl cellulose, have been used to restrict viral spread, preventing indiscriminate infection through the liquid growth medium. Immobilized overlays restrict cellular infection to the immediately surrounding monolayer, allowing the formation of discrete countable foci and subsequent plaque formation. To overcome the difficulties inherent in using traditional overlays, a novel liquid overlay utilizing microcrystalline cellulose and carboxymethyl cellulose sodium has been increasingly used as a replacement in the standard plaque assay. Liquid overlay plaque assays can be readily performed in either standard 6 or 12 well plate formats as per traditional techniques and require no special equipment. Due to its liquid state and subsequent ease of application and removal, microculture plate formats may alternatively be utilized as a rapid, accurate and high throughput alternative to larger scale viral titrations. Use of a non heated viscous liquid polymer offers the opportunity to streamline work, conserves reagents, incubator space, and increases operational safety when used in traditional or high containment labs as no reagent heating or glassware are required. Liquid overlays may also prove more sensitive than traditional&#160;overlays for certain heat labile viruses.

Plaque assays are the gold standard for viral quantification, utilizing entrapping overlays on host cellular monolayers to determine viral titers. While various semisolid overlays have traditionally been used, here we demonstrate plaque techniques comparing semisolid overlays to a novel liquid microcrystalline cellulose among several families of viruses.

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to extrapolate viral replication fitness, ranging from the number of viral particles per infectious unit, growth rate in cell culture, and relative fitness derived from multiple-cycle growth competition assays. Growth competition assays provide a particularly sensitive measurement of fitness since the viruses are competing for cellular targets under identical growth conditions. There are several experimental factors to consider when conducting growth competition assays, including the multiplicity of infection (MOI), sampling times, and viral detection and fitness calculation methods. Each factor can affect the end result and hence must be considered carefully during the experimental design. The protocol presented here includes steps from constructing a new recombinant HIV-1 clone to performing growth competition assays and analyzing the experimental results. This protocol utilizes experimental parameter values previously shown to yield consistent and robust results. Alternatives are discussed, as some parameters need to be adjusted according to the cell type and viruses being studied. The protocol contains two alternative viral detection methods to provide flexibility as the availability of instruments, reagents and expertise varies between laboratories.

Growth competition between nearly isogenic viruses provides a sensitive measurement for determining relative replication fitness. The protocols described here include the construction of recombinant HIV-1 clones, virus propagation and growth competition and analysis methods optimized to yield sensitive and consistent results.

In vitro fitness assays are essential tools for determining viral replication fitness for viruses such as HIV-1. Various measurements have been used to ...

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral particles to host cells. While virus-cell attachment can be measured through the use of virions labeled with biotin, radioactive isotopes, or fluorescent dyes, these approaches typically require high multiplicities of infection (MOI) to enable detection of bound virus. We describe a quantitative (q)RT-PCR-based assay that measures Junin virus strain Candid 1 attachment via quantitation of virion-packaged viral genomic RNA. This assay has several advantages including its extreme sensitivity and ability to measure attachment over a large dynamic range of MOIs without the need to purify or label input virus. Importantly, this approach can be easily tailored for use with other viruses through the use of virus-specific qRT-PCR reagents. Further, this assay can be modified to permit measurement of particle endocytosis and genome uncoating. In conclusion, we describe a simple, yet robust assay for highly sensitive measurement of arenavirus-cell attachment.

The first step in the arenavirus life cycle is attachment of viral particles to host cells. We report a quantitative (q)RT-PCR-based assay for ultrasensitive detection and quantitation of arenavirus attachment events.

Arenaviruses are a family of enveloped RNA viruses that cause severe human disease. The first step in the arenavirus life cycle is attachment of viral ...

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine detection of the virus. The current detection and quantification techniques, which rely primarily on nucleic acid amplification, do not discriminate infectious from non-infectious viral particles. The purpose of this article is to present specific details on recent advances in techniques used together in order to acquire further information on the infectivity status of viral particles. One technique involves assessing binding of a norovirus ssDNA aptamer to capsids. Aptamers have the advantage of being easily synthesized and modified, and are inexpensive and stable. Another technique, dynamic light scattering (DLS), has the advantage of observing capsid behavior in solution. Electron microscopy allows for visualization of the structural integrity of the viral capsids. Although promising, there are some drawbacks to each technique, such as non-specific aptamer binding to positively-charged molecules from sample matrices, requirement of purified capsid for DLS, and poor sensitivity for electron microscopy. Nonetheless, when these techniques are used in combination, the body of data produced provides more comprehensive information on norovirus capsid integrity that can be used to infer infectivity, information which is essential for accurate evaluation of inactivation methods or interpretation of virus detection. This article provides protocols for using these methods to discriminate infectious human norovirus particles.

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routine detection methods utilizing viral genome amplification are limited by their inability to discriminate infectious from non-infectious particles. The purpose of this article is to provide detailed protocols for alternative methods to aid in discrimination of infectious norovirus particles using aptamer binding, dynamic light scattering, and transmission electron microscopy.

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Simplified Reverse Genetics Method to Recover Recombinant Rotaviruses Expressing Reporter Proteins

Rotaviruses are a large and evolving population of segmented double-stranded RNA viruses that cause severe gastroenteritis in the young of many mammalian and avian host species, including humans. With the recent advent of rotavirus reverse genetics systems, it has become possible to use directed mutagenesis to explore rotavirus biology, modify and optimize existing rotavirus vaccines, and develop rotavirus multitarget vaccine vectors. In this report, we describe a simplified reverse genetics system that allows the efficient and reliable recovery of recombinant rotaviruses. The system is based on co-transfection of T7 transcription vectors expressing full-length rotavirus (+)RNAs and a CMV vector encoding an RNA capping enzyme into BHK cells constitutively producing T7 RNA polymerase (BHK-T7). Recombinant rotaviruses are amplified by overseeding the transfected BHK-T7 cells with MA104 cells, a monkey kidney cell line that is highly permissive for virus growth. In this report, we also describe an approach for generating recombinant rotaviruses that express a separate fluorescent reporter protein through the introduction of a 2A translational stop-restart element into genome segment 7 (NSP3). This approach avoids deleting or modifying any of the viral open reading frames, thus allowing the production of recombinant rotaviruses that retain fully functional viral proteins while expressing a fluorescent protein.

Generation of recombinant rotaviruses from plasmid DNA provides an essential tool for the study of rotavirus replication and pathogenesis, and the development of rotavirus expression vectors and vaccines. Herein, we describe a simplified reverse genetics approach for generating recombinant rotaviruses, including strains expressing fluorescent reporter proteins.

Rotaviruses are a large and evolving population of segmented double-stranded RNA viruses that cause severe gastroenteritis in the young of many mammalian ...

An Improved and High Throughput Respiratory Syncytial Virus (RSV) Micro-neutralization Assay

Respiratory syncytial virus-specific neutralizing antibodies (RSV NAbs) are an important marker of protection against RSV. A number of different assay formats are currently in use worldwide so there is a need for an accurate and high-throughput method for measuring RSV NAbs. We describe here an imaging-based micro-neutralization assay that has been tested on RSV subgroup A and can also be adapted for RSV subgroup B and different sample types. This method is highly reproducible, with inter-assay variations for the reference antiserum being less than 10%. We believe this assay can be readily established in many laboratories worldwide at relatively low cost. Development of an improved, high-throughput assay that measures RSV NAbs represents a significant step forward for the standardization of this method internationally as well as being critical for the evaluation of novel RSV vaccine candidates in the future.

An Improved and High Throughput Respiratory Syncytial Virus RSV Micro-neutralization Assay

This study describes a high throughput, imaging-based micro-neutralization assay to determine the titer of neutralizing antibodies specific for respiratory syncytial virus (RSV). This assay format has been tested on different sample types.

Respiratory syncytial virus-specific neutralizing antibodies (RSV NAbs) are an important marker of protection against RSV. A number of different assay ...

Medicine

An Assay to Quantify the Binding of Human Norovirus VLPs to Intestinal Bacteria

Source: Madrigal, J. L., et al. <a href="https://app.jove.com/v/61048">Quantifying Human Norovirus Virus-like Particles Binding to Commensal Bacteria Using Flow Cytometry.</a> J. Vis. Exp. (2020).
This video demonstrates an assay for quantifying human norovirus virus-like particles (VLPs) binding to human intestinal bacteria. The bacterial suspensions are mixed with the VLPs and incubated to allow the formation of VLP-bacteria complexes. The complexes are then labeled with fluorophore-tagged VLP-specific antibodies, followed by flow cytometry-based visualization and quantification to identify the percentage of VLP-bound bacteria.

1. VLP-bacteria Attachment Assay
CAUTION: Human norovirus VLPs are a biosafety level (BSL)-2 hazard, and all work involving VLPs should be performed in a ...

JoVE Encyclopedia of Experiments

Immunology

Antibody-Based Technologies

Characterization and Functional Analysis

Cellular Impedance-Based Survival Kinetics Assay to Assess Virus Survival

Source: Labadie, T. et al., <a href="https://app.jove.com/v/61133">Monitoring Influenza Virus Survival Outside the Host Using Real-Time Cell Analysis.</a> J. Vis. Exp. (2021).
This video describes a cellular impedance-based technique to study the survival kinetics of viruses that induce cytopathic effects. The method measures the electrical impedance of virus-infected adherent cells pre-treated with saline.

Source: Labadie, T. et al., Monitoring Influenza Virus Survival Outside the Host Using Real-Time Cell Analysis. J. Vis. Exp. (2021).
This video describes ...

Assays for the Specific Growth Rate and Cell-binding Ability of Rotavirus

Summary

Explore More Videos

Chapters in this video

Assays for the Identification of Novel Antivirals against Bluetongue Virus

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Pairwise Growth Competition Assay for Determining the Replication Fitness of Human Immunodeficiency Viruses

Highly Sensitive Assay for Measurement of Arenavirus-cell Attachment

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

Simplified Reverse Genetics Method to Recover Recombinant Rotaviruses Expressing Reporter Proteins

An Improved and High Throughput Respiratory Syncytial Virus (RSV) Micro-neutralization Assay

An Assay to Quantify the Binding of Human Norovirus VLPs to Intestinal Bacteria

Cellular Impedance-Based Survival Kinetics Assay to Assess Virus Survival