Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

This work was supported by the Agriculture and Food Research Initiative Competitive Grant no. 2011-68003-30395 from the United States Department of Agriculture, National Institute of Food and Agriculture through the NoroCORE project. Funding for open access charge was provided by the United States Department of Agriculture. We would like to thank Robert Atmar (Baylor College of Medicine, Houston, TX) for kindly providing us the purified capsids and Valerie Lapham for her assistance with the TEM images. We would also like to thank Frank N. Barry for helping us start the experiments presented.

1. Plate-based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure
NOTE: A very similar ELASA protocol to the one presented here has been published29, and similar ELASA assays have previously been reported as part of research articles elsewhere17,18,22.
<ol>
	<li>Heat treatment of human norovirus GII.4 Sydney capsids
	<ol>
		<li>Obtai...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

The protocol and techniques described here provide a means of assessing human norovirus capsid integrity/functionality. These methods can be used for obtaining mechanistic insight into the effects of inactivation treatments against the virus, and can potentially supplement more traditional inactivation evaluation methods such as RT-qPCR or plaque assay. For instance, the evaluation of chemical or physical inactivation by plaque assay alone provides a measure of degree of virus inactivation but not the underlying mechanis...

Human norovirus is responsible for a considerable public health burden globally, causing about 685 million illnesses and 212,000 deaths annually1, at a cost in the billions of dollars2,3. Today, norovirus detection and quantification involves genome amplification and/or ligand-based platforms. The former is generally preferred as it is more sensitive, provides quantitative information, and has generally lower risk of false positive results4. The most common norovirus detection and quantification genome amplification technique is reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). Because it targets and amplifies a small segment of the human norovirus genome, RT-qPCR alone is not capable of discriminating between infectious and non-infectious particles, as free genomic RNA, damaged capsids containing genomes, and capsids with fatally mutated/truncated genomes can still be amplified by RT-qPCR. While two new in vitro cultivation techniques for human norovirus5,6 have been reported recently, both still rely on RT-qPCR for virus quantification and are not yet feasible methods for routine clinical/environmental testing for human noroviruses. Thus, RT-qPCR remains the gold standard for clinical/environmental testing.
Other in vitro methods have been developed in an effort to better estimate the infectivity status of norovirus particles. These methods can be generally categorized as those that address the integrity of the norovirus capsid and those evaluating genome integrity. The former approach is more popular. A commonly used method is RNase pretreatment prior to extraction of viral genomic RNA, however this does not account for viral particles that remain intact but lack the ability to bind host receptors/co-factors, as well as viral particles that have fatally mutated or have truncated or marginally damaged genomes7. Capsid integrity can also be evaluated based on the ability of the virus to bind to human norovirus co-receptor/co-factors, which are carbohydrates known as histo-blood group antigens (HBGAs). HBGAs are present in host intestinal epithelial cells as part of glycoproteins or glycolipids (among multiple other tissues) and may be secreted in bodily fluids like saliva. Enteric bacteria containing HBGA-like substances on their surfaces have also been shown to bind human norovirus8,9,10, and such interactions may promote norovirus infection5. The basic concept of utilizing HBGA binding is that only viral particles capable of binding the putative receptor/co-factor would be capable of infecting cells. Multiple studies suggest that bead-based HBGA binding preceding nucleic acid amplification is a promising method for infectivity discrimination11,12,13,14,15,16. A major challenge regarding HBGAs is that no single HBGA type can bind all human norovirus genotypes. To address this, porcine gastric mucin, which contains HBGAs, has been used in place of purified HBGA carbohydrates in the interest of ease of synthesis, consistency, and reduced cost.
A recent publication by Moore et al.17 introduced a set of new techniques for estimating human norovirus capsid integrity. In place of HBGAs, Moore et al.17 investigated binding of a broadly reactive nucleic acid aptamer (M6-2)18 and broadly reactive monoclonal antibody (NS14)19 to heat-treated GII.4 Sydney norovirus capsids (virus-like particles or VLPs) and compared this to the binding to synthetic HBGAs. Nucleic acid aptamers are short (~20 - 80 nt) single stranded nucleic acids (ssDNA or RNA) that fold into unique three-dimensional structures as a consequence of their sequence and bind a target. Because they are nucleic acids, they are less costly; easily chemically synthesized, purified, and modified; and stable to heat. Several reports of aptamers generated against noroviruses exist, with some of them showing broad reactivity to a variety of strains18,20,21,22. By way of example, Moore et al.17 demonstrated that aptamer M6-2 bound to purified, assembled human norovirus capsids (VLPs) and behaved similarly to HBGA in the reliance on the viral capsid to maintain higher order (e.g., secondary and tertiary) protein structure for binding to occur. On the other hand, a significant proportion of norovirus VLP binding to antibody NS14 remained after capsids were completely denatured. Evaluation of norovirus binding in the study by Moore et al.17 was done using a simple, plate-based method similar to ELISA, with the exception that aptamers are used in place of antibodies (hence the method was called ELASA). This high throughput experimental method was used to evaluate the effects of different treatments on the norovirus capsid, work that is valuable for understanding the mechanism of viral inactivation upon exposure to physical or chemical stressors. However, one drawback to this method is the lower sensitivity and lack of tolerance for matrix-associated contaminants at higher levels that cause non-specific binding by aptamers.
Moore et al.17 used another method, dynamic light scattering (DLS), to monitor aggregation of viral particles in response to heat treatment. DLS is commonly used to evaluate the size of nanoparticle suspensions and has been extended to proteins23,24 and viruses25,26,27. The intensity of light scattered by particles in solution fluctuates as a function of particle size, allowing for the calculation of diffusion coefficient and then particle diameter using well-established formulae. The DLS technique can distinguish the hydrodynamic diameter of dispersed particles down to the nanoscale, which allows detection of dispersed viruses, individual capsid proteins or dimers, and virus aggregates based on size27. Virus aggregation, represented by an increase in particle size, is indicative of loss of capsid integrity. As the capsid is denatured and its structure disrupted, hydrophobic residues become exposed and cause the particles to stick together and form aggregates. DLS can be used to measure particle size after a specified treatment or the kinetics of aggregation in real time17,28. This method has the advantage of allowing observation of capsid behavior in solution but requires high concentrations of purified capsid, which may not be entirely representative of the virus in its natural state.
The final method utilized by Moore et al.17 was transmission electron microscopy (TEM). Although this method lacks sensitivity and does not produce quantitative data, it allows for visualization of the effects of different treatments on the viral capsid structure. Although not yet ideal for clinical/environmental settings, the use of these methods in combination is valuable in understanding human norovirus inactivation. The purpose of this article is to provide in-depth protocols for the plate-based binding assay (ELASA), DLS, and TEM preparation methods used to investigate the effects of heat treatments on the norovirus capsid in the context of the treatments&#39; effects on capsid integrity as presented in Moore et al.17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine detection of the virus. The current detection and quantification techniques, which rely primarily on nucleic acid amplification, do not discriminate infectious from non-infectious viral particles. The purpose of this article is to present specific details on recent advances in techniques used together in order to acquire further information on the infectivity status of viral particles. One technique involves assessing binding of a norovirus ssDNA aptamer to capsids. Aptamers have the advantage of being easily synthesized and modified, and are inexpensive and stable. Another technique, dynamic light scattering (DLS), has the advantage of observing capsid behavior in solution. Electron microscopy allows for visualization of the structural integrity of the viral capsids. Although promising, there are some drawbacks to each technique, such as non-specific aptamer binding to positively-charged molecules from sample matrices, requirement of purified capsid for DLS, and poor sensitivity for electron microscopy. Nonetheless, when these techniques are used in combination, the body of data produced provides more comprehensive information on norovirus capsid integrity that can be used to infer infectivity, information which is essential for accurate evaluation of inactivation methods or interpretation of virus detection. This article provides protocols for using these methods to discriminate infectious human norovirus particles.

The structural integrity of human norovirus GII.4 Sydney capsids (VLPs) was assessed using several novel methods as presented by Moore et al.17. First, an experiment was done in which the integrity of the capsids as a function of their ability to bind a putative receptor/co-factor (HBGA) or ssDNA aptamer (M6-2) were compared (Figure 1). The results displayed have been previously presented by Moore et al.<sup class="xr...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routine detection methods utilizing viral genome amplification are limited by their inability to discriminate infectious from non-infectious particles. The purpose of this article is to provide detailed protocols for alternative methods to aid in discrimination of infectious norovirus particles using aptamer binding, dynamic light scattering, and transmission electron microscopy.

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...