We appreciate and thank the technical assistance of Xiaohong He, Ricardo Marius, Julia Petryk, Bradley Austin, and Christiano Tanese De Souza. We also thank Mina Ghahremani for Graphic Design. We would also like to thank all the individuals who participated and donated their blood samples for this study. DWC is supported in part by uOttawa Faculty and Department of Medicine.

NOTE: The protocol described below adheres to all ethics guidelines according to protocol code 20200371-01H.
1. Production and evaluation of the HiBiT-RBD bioreporter
<ol>
	<li>Producing a sufficient quantity of HiBiT-RBD bioreporter
	<ol>
		<li>Prepare for cell culture
		<ol>
			<li>Prepare complete Dulbecco&#39;s modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Then, warm the media in a 37 &#176;C water bath.</li>
			<li>Turn the biological safety cabinet (BSC) on, and use 70% v/v ethanol for sterilizing the cabinet surface.</li>
		</ol>
		</li>
		<li>Culture the cell line.
		<ol>
			<li>Take out the cell line from -80 &#176;C or liquid nitrogen, and thaw it in a 37 &#176;C water bath. 
			NOTE: An appropriate cell line is easy to maintain in culture, has high transfection efficiency, and is suitable for exogenous protein production. Human embryonic kidney, HEK293 cells were used for this protocol.</li>
			<li>Mix the thawed cells with at least 10 mL of complete medium, pipette the cell suspension to a 10 cm Petri dish, and swirl the plate to distribute cells in the dish uniformly. Place the dish in a cell culture incubator at 37 &#176;C, 5% CO2, and 85-95% humidity.</li>
			<li>Observe the cells under the microscope until the confluency level reaches 80-90%. At high confluency, remove the medium, wash the cells with warm phosphate-buffered saline (PBS), and add 1 mL of 0.25% trypsin-ethylenediamine tetraacetic acid to detach the cells from the surface. 
			NOTE: The HEK293 cells are fairly easily detached. Hence, the washing step should be done very gently to prevent accidental detachment and loss of cells.</li>
			<li>After approximately 5 min, look at the cells under a microscope. If all cells are floating, add at least 4 mL of medium, and transfer the cell suspension into a new sterile tube. Count the cells using a hemocytometer, and add 1 &#215; 106 cells into each well of a 6-well plate for transfection. 
			NOTE: After 24 h, cells should be at 80% or more confluent.</li>
		</ol>
		</li>
		<li>Transfection of the HiBiT-RBD plasmid
		<ol>
			<li>Use 1 &#181;g of the HiBiT-RBD expression plasmid with a suitable transfection reagent. Incubate for 10-15 min at room temperature, and then add the total volume to each well of the plate, drop-wise. 
			NOTE: Follow the manufacturer&#39;s transfection protocol. In this case, a mixture (a specified amount) of the transfection reagent with DMEM was added to the diluted plasmid (1 &#181;g) in DMEM (see the Table of Materials). Use a marker containing (e.g., green fluorescent protein [GFP]) plasmid as a control to monitor the transfection efficiency.</li>
			<li>On the next day, replace the medium containing the transfection mixture with complete medium. Observe the transfection control well 48 h after transfection. 
			NOTE: If the transfection was positive and efficient (more than 80% GFP-positive), the cells should be ready for harvesting the HiBiT-RBD bioreporter. The construct also contains His-tag, which can be used to obtain purified protein in place of the total supernatant.</li>
			<li>Collect the supernatant in 1.5 mL microtubes. Add 500 &#181;L of 1x passive lysis buffer (PLB) to the cells; incubate and shake the plate for 15 min at room temperature for cell lysis. 
			NOTE: The supernatant and the lysate solution can be preserved at -20 &#176;C with minor loss of integrity for at least 6 months. According to Azad et al.22, the reporter is stable at a wide range of pH (4-12) and temperature (4-42 &#176;C).</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Evaluation of the luminescent signal from the bioreporter by luciferase assay
	<ol>
		<li>Preparing the reaction components
		<ol>
			<li>Use the supernatant as the source of the bioreporter. 
			NOTE: Both supernatant and lysate contain the HiBiT-RBD bioreporter and can be used for the assay. However, the supernatant is recommended as the source due to reasons explained in the following notes.</li>
			<li>Dilute the LgBiT and substrate to 1x before use (stock concentration is 100x). 
			NOTE: See the Table of Materials for details about the LgBiT.</li>
		</ol>
		</li>
		<li>Luciferase assay
		<ol>
			<li>Transfer 50 &#181;L of the supernatant from each well or tube to a 96-well plate, and add 50 &#181;L of 1x LgBiT to each well. Incubate for 5 min at room temperature.</li>
			<li>Open the luminometer software, add 50 &#181;L of 1x substrate (furimazine) to each well, place the plate in the luminometer, and run the software. 
			&#8203;NOTE: Add the substrate immediately before reading the plate to prevent consumption of the substrate by the active enzymes before signal measurement.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Detecting anti-RBD antibody with a fast and sensitive assay
<ol>
	<li>HiBiT-RBD antibody detection assay
	<ol>
		<li>Prepare the HiBiT-RBD bioreporter as described in section 1.1 of the protocol. 
		NOTE : It is recommended to use the supernatant for the following assay as it is simpler to collect and contains the mature glycosylated version of the protein. Moreover, the lysate has several other proteins that could interfere with the HiBiT-RBD-antibody interaction.</li>
		<li>Combine 50 &#181;L of the HiBiT-RBD-containing supernatant with 1 &#181;g of the commercial SARS-CoV-2-RBD antibody in a 1.5 mL microtube. Add 20 &#181;L of immunoglobulin-binding protein (protein G) to the solution. Bring up the total volume to 300 &#181;L by adding PBS. 
		NOTE: The total volume of the mixture can be decreased to 150 &#181;L. Lower total volumes are not recommended as it could result in inadequate mixing of antibodies with the bioreporter.</li>
		<li>Incubate the tube(s) on a tube shaker or rotator for 30 min. Centrifuge at 12,000 &#215; g for 30 s, discard the supernatant, and wash with PBS. Repeat the process three times to remove free HiBiT-RBD. Resuspend in 50 &#181;L of PBS and transfer to a 96-well plate.</li>
		<li>Add 50 &#181;L of 1x LgBiT and wait for 5 min. Then, add 50 &#181;L of 1x NanoLuc substrate. Immediately read the luminescent signal with a luminometer.</li>
	</ol>
	</li>
</ol>
3. High-throughput detection of the SARS-CoV-2-specific antibodies from patient serum samples
<ol>
	<li>Prepare larger quantities of the HiBiT-RBD bioreporter for a high-throughput assay by following section 1.1 of the protocol.</li>
	<li>Combine 20 &#181;L of magnetic protein G with 50 &#181;L of the HiBiT-RBD supernatant in a well of 96-well plate for each sample. Add 10 &#181;L of the serum sample to each well and bring up the total volume to 150 &#181;L by adding PBS. 
	NOTE: Use both nonspecific IgG (negative control) and neutralizing SARS-CoV-2 antibody (positive control) at 1 &#181;g/mL concentration as described in step 2.1.2. Moreover, serum samples from vaccinated mice can also be assessed for antibodies. In this test, serum samples were obtained from Ottawa Hospital General Campus under an approved procedure and with informed consent from individuals.</li>
	<li>Incubate for 30 min on a shaker at room temperature. Place the plate on a magnetic washer to precipitate the protein G-antibody complex. 
	NOTE: The specific structure of the magnetic washer will precipitate the complex on the side walls of each well.</li>
	<li>Discard the solution in the middle section of each well, and add PBS for washing. Repeat the washing step at least three times to remove excess HiBiT-RBD. Add 50 &#181;L of 1x PBS and 50 &#181;L of 1x LgBiT. Incubate for at least 5 min at room temperature.</li>
	<li>Prepare the luminometer software, and then add 50 &#181;L of 1x substrate. Place the plate in the machine, run the software, and record the signals. Compare the signals from serum samples, control samples, and background (empty wells).</li>
</ol>

<ol><li>Ullah, H., Ullah, A., Gul, A., Mousavi, T., Khan, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+coronavirus+2019+%28COVID-19%29+pandemic+outbreak%3A+A+comprehensive+review+of+the+current+literature%5BTitle%5D)+AND+%22Vacunas%22%5BJournal%5D)">Novel coronavirus 2019 (COVID-19) pandemic outbreak: A comprehensive review of the current literature.</a> Vacunas. , (2020).</li>
<li>Coronavirus update (Live). Worldometer. , Available from: 
 <a target="_blank" href="https://www.worldometers.info/coronavirus/">https://www.worldometers.info/coronavirus/</a> (2021).</li>
<li>Cacciapaglia, G., Cot, C., Sannino, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Second+wave+COVID-19+pandemics+in+Europe%3A+a+temporal+playbook%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">Second wave COVID-19 pandemics in Europe: a temporal playbook.</a> Scientific Reports. 10 (1), 15514(2020).</li>
<li>World Health Organization. COVID-19 vaccines. World Health Organization. , Available from: 
 <a target="_blank" href="https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines">https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines</a> (2021).</li>
<li>Hueston, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+antibody+response+to+SARS-CoV-2+infection%5BTitle%5D)+AND+%22Open+Forum+Infectious+Diseases%22%5BJournal%5D)">The antibody response to SARS-CoV-2 infection.</a> Open Forum Infectious Diseases. 7 (9), (2020).</li>
<li>Lan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+of+the+SARS-CoV-2+spike+receptor-binding+domain+bound+to+the+ACE2+receptor%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.</a> Nature. 581 (7807), 215-220 (2020).</li>
<li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Implications+for+SARS-CoV-2+vaccine+design%3A+fusion+of+Spike+glycoprotein+transmembrane+domain+to+receptor-binding+domain+induces+trimerization%5BTitle%5D)+AND+%22Membranes%22%5BJournal%5D)">Implications for SARS-CoV-2 vaccine design: fusion of Spike glycoprotein transmembrane domain to receptor-binding domain induces trimerization.</a> Membranes. 10 (9), 215(2020).</li>
<li>Piccoli, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mapping+neutralizing+and+immunodominant+sites+on+the+SARS-CoV-2+Spike+receptor-binding+domain+by+structure-guided+high-resolution+serology%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Mapping neutralizing and immunodominant sites on the SARS-CoV-2 Spike receptor-binding domain by structure-guided high-resolution serology.</a> Cell. 183 (4), 1024-1042 (2020).</li>
<li>Premkumar, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+receptor-binding+domain+of+the+viral+spike+protein+is+an+immunodominant+and+highly+specific+target+of+antibodies+in+SARS-CoV-2+patients%5BTitle%5D)+AND+%22Science+Immunology%22%5BJournal%5D)">The receptor-binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients.</a> Science Immunology. 5 (48), (2020).</li>
<li>Walls, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Elicitation+of+potent+neutralizing+antibody+responses+by+designed+protein+nanoparticle+vaccines+for+SARS-CoV-2%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Elicitation of potent neutralizing antibody responses by designed protein nanoparticle vaccines for SARS-CoV-2.</a> Cell. 183 (5), 1367-1382 (2020).</li>
<li>Azad, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nanoluciferase+complementation-based+biosensor+reveals+the+importance+of+N-+linked+glycosylation+of+SARS-CoV-2+Spike+for+viral+entry%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">Nanoluciferase complementation-based biosensor reveals the importance of N- linked glycosylation of SARS-CoV-2 Spike for viral entry.</a> Mol Ther. , 0074-0075 (2021).</li>
<li>Bastos, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diagnostic+accuracy+of+serological+tests+for+covid-19%3A+systematic+review+and+meta-analysis%5BTitle%5D)+AND+%22BMJ%22%5BJournal%5D)">Diagnostic accuracy of serological tests for covid-19: systematic review and meta-analysis.</a> BMJ. 370, 2516(2020).</li>
<li>Bioluminescent Reporters | Reporter Gene Applications | An Introduction to Reporter Genes. Promega. , Available from: 
 <a target="_blank" href="https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa">https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa</a> (2021).</li>
<li>Fleiss, A., Sarkisyan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+brief+review+of+bioluminescent+systems%5BTitle%5D)+AND+%22Current+Genetics%22%5BJournal%5D)">A brief review of bioluminescent systems.</a> Current Genetics. 65 (4), 877-882 (2019).</li>
<li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+kinome-wide+screen+using+a+NanoLuc+LATS+luminescent+biosensor+identifies+ALK+as+a+novel+regulator+of+the+Hippo+pathway+in+tumorigenesis+and+immune+evasion%5BTitle%5D)+AND+%22The+FASEB+Journal%22%5BJournal%5D)">A kinome-wide screen using a NanoLuc LATS luminescent biosensor identifies ALK as a novel regulator of the Hippo pathway in tumorigenesis and immune evasion.</a> The FASEB Journal. 33 (11), 12487-12499 (2019).</li>
<li>Boute, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NanoLuc+Luciferase+-+a+multifunctional+tool+for+high+throughput+antibody+screening%5BTitle%5D)+AND+%22Frontiers+in+Pharmacology%22%5BJournal%5D)">NanoLuc Luciferase - a multifunctional tool for high throughput antibody screening.</a> Frontiers in Pharmacology. 7, 27(2016).</li>
<li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+celastrol+as+a+novel+YAP-TEAD+inhibitor+for+cancer+therapy+by+high+throughput+screening+with+ultrasensitive+YAP%2FTAZ-TEAD+biosensors%5BTitle%5D)+AND+%22Cancers%22%5BJournal%5D)">Identification of celastrol as a novel YAP-TEAD inhibitor for cancer therapy by high throughput screening with ultrasensitive YAP/TAZ-TEAD biosensors.</a> Cancers. 11 (10), 1596(2019).</li>
<li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((SARS-CoV-2+S1+NanoBiT%3A+A+nanoluciferase+complementation-based+biosensor+to+rapidly+probe+SARS-CoV-2+receptor+recognition%5BTitle%5D)+AND+%22Biosensors+and+Bioelectronics%22%5BJournal%5D)">SARS-CoV-2 S1 NanoBiT: A nanoluciferase complementation-based biosensor to rapidly probe SARS-CoV-2 receptor recognition.</a> Biosensors and Bioelectronics. 180, 113122(2021).</li>
<li>Brown, E. E. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+critical+determinants+of+ACE2-SARS+CoV-2+RBD+interaction%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Characterization of critical determinants of ACE2-SARS CoV-2 RBD interaction.</a> International Journal of Molecular Sciences. 22 (5), 2268(2021).</li>
<li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+gain-of-functional+screen+identifies+the+Hippo+pathway+as+a+central+mediator+of+receptor+tyrosine+kinases+during+tumorigenesis%5BTitle%5D)+AND+%22Oncogene%22%5BJournal%5D)">A gain-of-functional screen identifies the Hippo pathway as a central mediator of receptor tyrosine kinases during tumorigenesis.</a> Oncogene. 39 (2), 334-355 (2020).</li>
<li>Schwinn, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Mediated+tagging+of+endogenous+proteins+with+a+luminescent+peptide%5BTitle%5D)+AND+%22ACS+Chemical+Biology%22%5BJournal%5D)">CRISPR-Mediated tagging of endogenous proteins with a luminescent peptide.</a> ACS Chemical Biology. 13 (2), 467-474 (2018).</li>
<li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+high-throughput+NanoBiT-based+serological+assay+detects+SARS-CoV-2+seroconversion%5BTitle%5D)+AND+%22Nanomaterials%22%5BJournal%5D)">A high-throughput NanoBiT-based serological assay detects SARS-CoV-2 seroconversion.</a> Nanomaterials. 11 (3), 807(2021).</li>
</ol>

The authors declare no conflict of interest.

The increasing number of people infected with the SARS-CoV-2 and the ongoing effort for global vaccination necessitates sensitive and fast serologic tests that can be used in large-scale serosurveys. Recent research shows that split nanoluciferase-based bioreporters can be used to develop such assays. We recently developed the HiBiT-RBD bioreporter to design a test that can be used to detect SARS-CoV-2-specific antibodies in patient serum in a fast and reliable fashion (Figure 4C).
<p cl...

The recent emergence of a new coronavirus, SARS-CoV21, has caused more than 2,800,000 fatalities and 128 million infections as of March 30th, 20212. Due to the lack of a reliable and well-established treatment procedure for SARS-CoV-2 clinical therapies, many endeavors have been made to restrict further viral transmission and more importantly, to develop an effective and robust treatment or a vaccine3. To date, there are more than 50 COVID-19 vaccine candidates in trials reported by the World Health Organization4. Detection of antibodies against SARS-CoV-2 is of paramount importance to determine the long-term stability of humoral response upon administration of the vaccine as well as in recovered patients of COVID-195. Some studies have demonstrated that there is a possibility that recovered SARS-CoV-2 patients lose most of the RBD-binding antibodies after 1 year5,6,7,8,9. Further investigation is required to better understand lasting immunity, and more sensitive antibody detection platforms can help further such work. Reports of sustained immunity of mild SARS-CoV-2 infections, which suggest long-term antibody responses, is also an interesting and worthwhile area of study. A fast and accurate method of detection is essential for monitoring antibodies in individuals&#39; sera to provide more information about immunity in the population.
Like other coronaviruses, SARS-CoV-2 uses protruding spike glycoprotein to bind to angiotensin-converting enzyme-2 (ACE2) to initiate a cascade of events that lead to the fusion of the viral and cell membranes6,7. Several studies have recently proved the RBD of the Spike protein to have a crucial role in eliciting powerful and specific antibody response against SARS-CoV28,9,10,11. In particular, correlations observed by Premkumar et al. between the titer of RBD-binding antibody and SARS-CoV-2 neutralization potency of patients&#39; plasma are consistent with RBD being an immunogenic compartment of the virus structure9. With that in mind, many diagnostic tests available for SARS-CoV-2 antibody detection are time and cost-intensive, require a lengthy procedure of incubation and washing (enzyme-linked immunosorbent assay [ELISA]), or lack sensitivity and accuracy (lateral flow immunoassay [LFIA])12. Therefore, a quantitative and rapid complementary serological method of COVID-19-derived antibody detection with high sensitivity, fast response, and relatively low cost would serve the need for a reliable serologic test for SARS-CoV-2 epidemiologic surveillance.
Collectively, the limitations of current serological assays prompted the investigation of the bioluminescent reporting system as a potential diagnostic agent in future serosurveys. Bioluminescence is a naturally occurring enzyme/substrate reaction, with light emission. Nanoluc luciferase is the smallest (19 kDa), yet the brightest system compared to Renilla and firefly luciferase (36 kDa and 61 kDa, respectively)13,14. Further, Nanoluc has the highest signal to noise ratio and stability among the previously mentioned systems. The high signal intensity of Nanoluc supports the detection of even very low amounts of reporter fusions15. Nanoluc Binary Technology (NanoBiT) is a split version of the Nanoluc system, which is comprised of two segments: small BiT (11 amino acids; SmBiT) and large BiT (LgBiT) with relatively low-affinity interactions (KD = 190 &#181;M ) to form a luminescent complex16. NanoBiT is extensively used in various studies involving the identification of protein-protein interactions15,17,18,19 and cellular signaling pathways11,20,21.
Recently, another small peptide with a distinctly higher affinity to LgBiT (KD = 0.7 nM ) was introduced, namely the HiBiT Nano-Glo system, in place of SmBiT. The high affinity and strong signal of the Nano-Glo &#34;add-mix-read&#34; assay makes HiBiT a suitable, quantitative, luminescent peptide tag. In this approach, the HiBiT tag is appended to the target protein by developing a construct imposing minimal structural interference. HiBiT-protein fusion would actively bind to the LgBiT counterpart, producing a highly active luciferase enzyme to generate detectable bioluminescence in the presence of detection reagents (Figure 1). Similarly, we developed a HiBiT Nano-Glo-based system to readily measure the neutralizing antibody titer in the sera of SARS-CoV-2 recovered individuals and recently developed a HiBiT-tagged SARS-CoV-2 RBD. This paper describes the protocol for producing the HiBiT-RBD bioreporter using standard laboratory procedures and equipment, and shows how this bioreporter can be used in a fast and efficient assay to detect SARS-CoV-2 RBD-targeting antibodies.

<table><tbody><tr><td>5x Passive Lysis Buffer</td><td>Promega</td><td>E194A</td><td>30 mL</td></tr><tr><td>Bio-Plex Handheld Magnetic Washer</td><td>Bio-Rad</td><td>171020100</td><td></td></tr><tr><td>DMEM</td><td>Sigma</td><td>D6429-500ml</td><td></td></tr><tr><td>Dual-Glo luciferase Assay System</td><td>Promega</td><td>E2940</td><td>100 mL kit</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Sigma</td><td>F1051</td><td></td></tr><tr><td>HiBiT-RBD Plasmid</td><td></td><td></td><td>gacggatcgggagatctcccgatcccctatggt gcactctcagtacaatctgctctgatgccgcata gttaagccagtatctgctccctgcttgtgtgttgg aggtcgctgagtagtgcgcgagcaaaattta agctacaacaaggcaaggcttgaccgacaa ttgcatgaagaatctgcttagggttaggcgttttg cgctgcttcgcgatgtacgggccagatatacgc gttgacattgattattgactagttattaatagt aatcaattacggggtcattagttcatagcccat atatggagttccgcgttacataacttacggtaa atggcccgcctggctgaccgcccaacgaccc ccgcccattgacgtcaataatgacgtatgttccc atagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatgg cccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtat tagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttg actcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatc aacgggactttccaaaatgtcgtaacaactccg ccccattgacgcaaatgggcggtaggcgtgta cggtgggaggtctatataagcagagctctctgg ctaactagagaacccactgcttactggcttatcg aaattaatacgactcactatagggagacccaa gctggctagcgtttaaacttaagcttggtaccga gctcggatccgccaccATGGAGACAGA CACACTCCTGCTATGGGTACTGC TGCTCTGGGTTCCAGGTTCCAC TGGTGACtctggctctagcggctctggctct agcggcggcATGGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC tctagcggcGACTACAAGGACC ACGACGGTGACTACAAGGACCA CGACATCGACTACAAGGACGAC GACGACAAGggcagcggctccggca gcagcggaggaggaggctctggaggagga ggctctagcggcggcaacatcacaaatctgtg cccattcggcgaggtgtttaacgccaccagat ttgccagcgtgtatgcctggaaccggaagaga atctctaattgcgtggccgactatagcgtgct gtacaatagcgcctccttctctacctttaagt gctatggcgtgtcccccacaaagctgaacgac ctgtgcttcaccaacgtgtacgccgactcttttgt gatcaggggcgatgaggtgcgccagatcgc acctggacagacaggcaagatcgccgactac aactataagctgccagacgatttcaccggct gcgtgatcgcctggaatagcaacaatctggatt ccaaagtgggcggcaactacaattatctgtac cggctgttcagaaagagcaacctgaagccctt tgagcgggatatcagcacagagatctaccag gcaggctccaccccttgcaacggagtggagg gcttcaattgttattttcccctgcagagctacggc ttccagcctacaaatggcgtgggctatcagcca tacagggtggtggtgctgtcctttgagctgctg cacgcacctgcaaccgtgtcctctggacacatc gagggccgccacatgctggagatgggccatc atcaccatcatcaccaccaccaccactgatag cggccgctcgagtctagagggcccgtttaaac ccgctgatcagcctcgactgtgccttctagtt gccagccatctgttgtttgcccctcccccgtg ccttccttgaccctggaaggtgccactcccac tgtcctttcctaataaaatgaggaaattgcat cgcattgtctgagtaggtgtcattctattctgggg ggtggggtggggcaggacagcaaggggga ggattgggaagacaatagcaggcatgctggg gatgcggtgggctctatggcttctgaggcggaa agaaccagctggggctctagggggtatcccca cgcgccctgtagcggcgcattaagcgcggcg ggtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttcg ctttcttcccttcctttctcgccacgttcgccggctt tccccgtcaagctctaaatcgggggctcccttta gggttccgatttagtgctttacggcacctcgacc ccaaaaaacttgattagggtgatggttcacgta gtgggccatcgccctgatagacggtttttcgcc ctttgacgttggagtccacgttctttaatagtg gactcttgttccaaactggaacaacactcaacc ctatctcggtctattcttttgatttataagggatttt gccgatttcggcctattggttaaaaaatgagctg atttaacaaaaatttaacgcgaattaattctgt ggaatgtgtgtcagttagggtgtggaaagtccc caggctccccagcaggcagaagtatgcaaag catgcatctcaattagtcagcaaccaggtgtgg aaagtccccaggctccccagcaggcagaagt atgcaaagcatgcatctcaattagtcagcaac catagtcccgcccctaactccgcccatcccgc ccctaactccgcccagttccgcccattctccgcc ccatggctgactaattttttttatttatgcagaggc cgaggccgcctctgcctctgagctattccagaa gtagtgaggaggcttttttggaggcctaggcttttg caaaaagctcccgggagcttgtatatccattttc ggatctgatcaagagacaggatgaggatcgttt cgcatgattgaacaagatggattgcacgcagg ttctccggccgcttgggtggagaggctattcggc tatgactgggcacaacagacaatcggctgctct gatgccgccgtgttccggctgtcagcgcagggg cgcccggttctttttgtcaagaccgacctgtccgg tgccctgaatgaactgcaggacgaggcagcg cggctatcgtggctggccacgacgggcgttcct tgcgcagctgtgctcgacgttgtcactgaagcg ggaagggactggctgctattgggcgaagtgcc ggggcaggatctcctgtcatctcaccttgctcctg ccgagaaagtatccatcatggctgatgcaatg cggcggctgcatacgcttgatccggctacctgc ccattcgaccaccaagcgaaacatcgcatcg agcgagcacgtactcggatggaagccggtct tgtcgatcaggatgatctggacgaagagcat caggggctcgcgccagccgaactgttcgcca ggctcaaggcgcgcatgcccgacggcgagg atctcgtcgtgacccatggcgatgcctgcttg ccgaatatcatggtggaaaatggccgctttt ctggattcatcgactgtggccggctgggtgt ggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcg aatgggctgaccgcttcctcgtgctttacgg tatcgccgctcccgattcgcagcgcatcgcc ttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaaatgaccgaccaag cgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggctt cggaatcgttttccgggacgccggctggatga tcctccagcgcggggatctcatgctggagt tcttcgcccaccccaacttgtttattgcagctta taatggttacaaataaagcaatagcatcacaa atttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtat cttatcatgtctgtataccgtcgacctctagct agagcttggcgtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacac aacatacgagccggaagcataaagtgtaaag cctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatgaa tcggccaacgcgcggggagaggcggtttgcg tattgggcgctcttccgcttcctcgctcactgactc gctgcgctcggtcgttcggctgcggcgagcggt atcagctcactcaaaggcggtaatacggttatc cacagaatcaggggataacgcaggaaagaa catgtgagcaaaaggccagcaaaaggccag gaaccgtaaaaaggccgcgttgctggcgtttt tccataggctccgcccccctgacgagcatcac aaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtt tccccctggaagctccctcgtgcgctctcctgtt ccgaccctgccgcttaccggatacctgtccgcc tttctcccttcgggaagcgtggcgctttctcat agctcacgctgtaggtatctcagttcggtgtag gtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatcc ggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggc ggtgctacagagttcttgaagtggtggcctaact acggctacactagaagaacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaa aagagttggtagctcttgatccggcaaacaaa ccaccgctggtagcggtggtttttttgtttgca agcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggt ctgacgctcagtggaacgaaaactcacgttaa gggattttggtcatgagattatcaaaaaggatct tcacctagatccttttaaattaaaaatgaagtt ttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtgagg cacctatctcagcgatctgtctatttcgttcatcca tagttgcctgactccccgtcgtgtagataactac gatacgggagggcttaccatctggccccagtg ctgcaatgataccgcgagacccacgctcacc ggctccagatttatcagcaataaaccagccag ccggaagggccgagcgcagaagtggtcctg caactttatccgcctccatccagtctattaattgtt gccgggaagctagagtaagtagttcgccagtt aatagtttgcgcaacgttgttgccattgctacag gcatcgtggtgtcacgctcgtcgtttggtatgg cttcattcagctccggttcccaacgatcaaggc gagttacatgatcccccatgttgtgcaaaaaag cggttagctccttcggtcctccgatcgttgtca gaagtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagta ctcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacg ggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggc gaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaact gatcttcagcatcttttactttcaccagcgtttc tgggtgagcaaaaacaggaaggcaaaatgc cgcaaaaaagggaataagggcgacacgga aatgttgaatactcatactcttcctttttcaat attattgaagcatttatcagggttattgtc tcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgca catttccccgaaaagtgccacctgacgtc</td></tr><tr><td>LgBiT</td><td>Promega</td><td>N3030</td><td></td></tr><tr><td>penicillin Streptomycin</td><td>Thermo Fisher Scientific</td><td>15140122</td><td></td></tr><tr><td>Pierce Protein G Magnetic Beads</td><td>Thermo Fisher Scientific</td><td>88848</td><td></td></tr><tr><td>PolyJet In Vitro DNA Transfection Reagent</td><td>Signagen</td><td>SL100688.5</td><td></td></tr><tr><td>SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab</td><td>SinoBiological</td><td>40592-MM57</td><td></td></tr><tr><td>Synergy Mx Microplate Reader</td><td>BioTek</td><td></td><td>96-well plate reader luminometer</td></tr><tr><td>Trypsin-EDTA</td><td>Thermo Fisher Scientific</td><td>2520056</td><td>0.25%</td></tr></tbody></table>

detection of sars-cov-2 receptor-binding domain antibody using a hibit-based bioreporter

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The increasing number of SARS-CoV-2 infections raises the need for better antibody detection assays. Current antibody detection methods compromise sensitivity for speed or are sensitive but time-consuming. A large proportion of SARS-CoV-2-neutralizing antibodies target the receptor-binding domain (RBD), one of the primary immunogenic compartments of SARS-CoV-2. We have recently designed and developed a highly sensitive, bioluminescent-tagged RBD (NanoLuc HiBiT-RBD) to detect SARS-CoV-2 antibodies. The following text describes the procedure to produce the HiBiT-RBD complex and a fast assay to evaluate the presence of RBD-targeting antibodies using this tool. Due to the durability of the HiBiT-RBD protein product over a wide range of temperatures and the shorter experimental procedure that can be completed within 1 h, the protocol can be considered as a more efficient alternative to detect SARS-CoV-2 antibodies in patient serum samples.

The signals from both the HiBit-RBD-containing cell lysate and supernatant of the transfected cells were recorded (Figure 2) to evaluate the appropriate protein source. HiBiT-RBD and LgBit were separately used as controls, and the data showed low background compared to a strong signal when both parts were combined. Hence, HiBiT-RBD interaction with LgBiT is necessary to generate active enzyme for substrate digestion and bioluminescence activity (Figure 1).
<...

Watch this Scientific Journal Video about Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter at JoVE.com

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe ...

detection-sars-cov-2-receptor-binding-domain-antibody-using-hibit

Research

JoVE Journal

Immunology and Infection

3.1K Views.  Ottawa Hospital Research Institute. The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

Video: Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

Biomolecular Detection employing the Interferometric Reflectance Imaging Sensor (IRIS)

The sensitive measurement of biomolecular interactions has use in many fields and industries such as basic biology and microbiology, environmental/agricultural/biodefense monitoring, nanobiotechnology, and more. For diagnostic applications, monitoring (detecting) the presence, absence, or abnormal expression of targeted proteomic or genomic biomarkers found in patient samples can be used to determine treatment approaches or therapy efficacy. In the research arena, information on molecular affinities and specificities are useful for fully characterizing the systems under investigation.
Many of the current systems employed to determine molecular concentrations or affinities rely on the use of labels. Examples of these systems include immunoassays such as the enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR) techniques, gel electrophoresis assays, and mass spectrometry (MS). Generally, these labels are fluorescent, radiological, or colorimetric in nature and are directly or indirectly attached to the molecular target of interest. Though the use of labels is widely accepted and has some benefits, there are drawbacks which are stimulating the development of new label-free methods for measuring these interactions. These drawbacks include practical facets such as increased assay cost, reagent lifespan and usability, storage and safety concerns, wasted time and effort in labelling, and variability among the different reagents due to the labelling processes or labels themselves. On a scientific research basis, the use of these labels can also introduce difficulties such as concerns with effects on protein functionality/structure due to the presence of the attached labels and the inability to directly measure the interactions in real time.
Presented here is the use of a new label-free optical biosensor that is amenable to microarray studies, termed the Interferometric Reflectance Imaging Sensor (IRIS), for detecting proteins, DNA, antigenic material, whole pathogens (virions) and other biological material. The IRIS system has been demonstrated to have high sensitivity, precision, and reproducibility for different biomolecular interactions [1-3]. Benefits include multiplex imaging capacity, real time and endpoint measurement capabilities, and other high-throughput attributes such as reduced reagent consumption and a reduction in assay times. Additionally, the IRIS platform is simple to use, requires inexpensive equipment, and utilizes silicon-based solid phase assay components making it compatible with many contemporary surface chemistry approaches.
Here, we present the use of the IRIS system from preparation of probe arrays to incubation and measurement of target binding to analysis of the results in an endpoint format. The model system will be the capture of target antibodies which are specific for human serum albumin (HSA) on HSA-spotted substrates.

Biomolecular Detection employing the Interferometric Reflectance Imaging Sensor IRIS

Quantitative, high-throughput, real-time, and label-free biomolecular detection (DNA, protein, etc.) on SiO2 surfaces can be achieved using a simple interferometric technique which relies on LED illumination, minimal optical components, and a camera. The Interferometric Reflectance Imaging Sensor (IRIS) is inexpensive, simple to use, and amenable to microarray formats.

The sensitive measurement of biomolecular interactions has use in many fields and industries such as basic biology and microbiology, ...

Bioengineering

Engineering Antiviral Agents via Surface Plasmon Resonance

Surface plasmon resonance (SPR) is used to measure hemagglutinin (HA) binding to domain-swapped Cyanovirin-N (CV-N) dimer and to monitor interactions between mannosylated peptides and CV-N's high-affinity binding site. Virus envelope spikes gp120, HA, and Ebola glycoprotein (GP) 1,2 have been reported to bind both high- and low-affinity binding sites on dimeric CVN2. Dimannosylated HA peptide is also bound at the two low-affinity binding sites to an engineered molecule of CVN2, which is bearing a high-affinity site for the respective ligand and mutated to replace a stabilizing disulfide bond in the carbohydrate-binding pocket, thus confirming multivalent binding. HA binding is shown to one high-affinity binding site of pseudo-antibody CVN2 at a dissociation constant (KD) of 275 nM that further neutralizes human immunodeficiency virus type 1 (HIV-1) through oligomerization. Correlating the number of disulfide bridges in domain-swapped CVN2, which are decreased from 4 to 2 by substituting cystines into polar residue pairs of glutamic acid and arginine, results in reduced binding affinity to HA. Among the strongest interactions, Ebola GP1,2 is bound by CVN2 with two high-affinity binding sites in the lower nanomolar range using the envelope glycan without a transmembrane domain. In the present study, binding of the multispecific monomeric CV-N to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike (S) glycoprotein is measured at KD = 18.6 &#181;M as compared with nanomolar KD to those other virus spikes, and via its receptor-binding domain in the mid-&#181;-molar range.

Engineering Antiviral Agents via Surface Plasmon Resonance

The present protocol describes new tools for SPR binding assays to examine CV-N binding to HA, S glycoprotein, related hybrid-type glycans, and high-mannose oligosaccharides. SPR is used to determine the KD for binding either dimeric or monomeric CV-N to these glycans.

Surface plasmon resonance (SPR) is used to measure hemagglutinin (HA) binding to domain-swapped Cyanovirin-N (CV-N) dimer and to monitor interactions ...

In Vitro Selection of Aptamers to Differentiate Infectious from Non-Infectious Viruses

Virus infections have a major impact on society; most methods of detection have difficulties in determining whether a detected virus is infectious, causing delays in treatment and further spread of the virus. Developing new sensors that can inform on the infectability of clinical or environmental samples will meet this unmet challenge. However, very few methods can obtain sensing molecules that can recognize an intact infectious virus and differentiate it from the same virus that has been rendered non-infectious by disinfection methods. Here, we describe a protocol to select aptamers that can distinguish infectious viruses vs non-infectious viruses using systematic evolution of ligands by exponential enrichment (SELEX). We take advantage of two features of SELEX. First, SELEX can be tailor-made to remove competing targets, such as non-infectious viruses or other similar viruses, using counter selection. Additionally, the whole virus can be used as the target for SELEX, instead of, for example, a viral surface protein. Whole virus SELEX allows for the selection of aptamers that bind specifically to the native state of the virus, without the need to disrupt of the virus. This method thus allows recognition agents to be obtained based on functional differences in the surface of pathogens, which do not need to be known in advance.

We provide a protocol that can be generally applied to select aptamers that bind to infectious viruses only and not to viruses that have been rendered non-infectious by a disinfection method or to any other similar viruses. This opens the possibility of determining infectivity status in portable and rapid tests.

Virus infections have a major impact on society; most methods of detection have difficulties in determining whether a detected virus is infectious, ...

High-Performance Graphene-Modified Sensing Chip for SARS-CoV-2 Detection

This sensing prototype model involves the development of a reusable, twofold graphene oxide (GrO)-glazed double inter-digitated capacitive (DIDC) detecting chip for detecting severe acute respiratory syndrome coronavirus 2 virus (SARS-CoV-2) specifically and rapidly. The fabricated DIDC comprises a Ti/Pt-containing glass substrate glazed with graphene oxide (GrO), which is further chemically modified with EDC-NHS to immobilize antibodies (Abs) hostile to SARS-CoV-2 based on the spike (S1) protein of the virus. The results of insightful investigations showed that GrO gave an ideal engineered surface for Ab immobilization and enhanced the capacitance to allow higher sensitivity and low sensing limits. These tunable elements helped accomplish a wide sensing range (1.0 mg/mL to 1.0 fg/mL), a minimum sensing limit of 1 fg/mL, high responsiveness and good linearity of 18.56 nF/g, and a fast reaction time of 3 s. Besides, in terms of developing financially viable point-of-care (POC) testing frameworks, the reusability of the GrO-DIDC biochip in this study is good. Significantly, the biochip is specific against blood-borne antigens and is stable for up to 10 days at 5 &#176;C. Due to its compactness, this scaled-down biosensor has the potential for POC diagnostics of COVID-19 infection. This system can also detect other severe viral diseases, although an approval step utilizing other virus examples is under development.

The present protocol describes the fabrication of low-cost biosensing prototypes based on useful nanosystems for accurately detecting viral proteins (at the Fg level). Such a tiny sensor platform allows for point-of-care applications that can be integrated with the Internet of Medical Things (IoMT) to meet telemedicine objectives.

This sensing prototype model involves the development of a reusable, twofold graphene oxide (GrO)-glazed double inter-digitated capacitive (DIDC) ...

Detection of SARS-CoV-2 Neutralizing Antibodies using High-Throughput Fluorescent Imaging of Pseudovirus Infection

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the presence of neutralizing antibodies against the virus may provide protection against future infection. Thus, as the creation and translation of effective COVID-19 vaccines continues at an unprecedented speed, the development of fast and effective methods to measure neutralizing antibodies against SARS-CoV-2 will become increasingly important to determine long-term protection against infection for both previously infected and immunized individuals. This paper describes a high-throughput protocol using vesicular stomatitis virus (VSV) pseudotyped with the SARS-CoV-2 spike protein to measure the presence of neutralizing antibodies in convalescent serum from patients who have recently recovered from COVID-19. The use of a replicating pseudotyped virus eliminates the necessity for a containment level 3 facility required for SARS-CoV-2 handling, making this protocol accessible to virtually any containment level 2 lab. The use of a 96-well format allows for many samples to be run at the same time with a short turnaround time of 24 h.

The protocol described here outlines a fast and effective method for measuring neutralizing antibodies against the SARS-CoV-2 spike protein by evaluating the ability of convalescent serum samples to inhibit infection by an enhanced green fluorescent protein-labeled vesicular stomatitis virus pseudotyped with spike glycoprotein.

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the ...

A Rapid, Multiplex Dual Reporter IgG and IgM SARS-CoV-2 Neutralization Assay for a Multiplexed Bead-Based Flow Analysis System

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel pathogens, such as SARS-CoV-2. Multiplex serological testing can be particularly useful because it can simultaneously analyze antibodies to multiple antigens that optimizes pathogen coverage, and controls for variability in the organism and the individual host response. Here we describe a SARS-CoV-2 IgG 3-plex fluorescent microsphere-based assay that can detect both IgM and IgG antibodies to three major SARS-CoV-2 antigens-the spike (S) protein, spike angiotensin-converting enzyme-2 (ACE2) receptor-binding domain (RBD), and nucleocapsid (Nc). The assay was shown to have comparable performance to a SARS-CoV-2 reference assay for IgG in serum obtained at &#8805;21 days from symptom onset but had higher sensitivity with samples collected at &#8804;5 days from symptom onset. Further, using soluble ACE2 in a neutralization assay format, inhibition of antibody binding was demonstrated for S and RBD.

A flow analysis system for bead-based multiplexed assays which provides a two-reporter readout was used for the development of multiplex serological and antibody neutralization assays that can simultaneously measure neutralizing IgG and IgM antibodies for SARS-CoV-2.

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel ...

Analysis of SARS-CoV-2 Using Dual-Reporter and Multiplex Technology

Profiling of Surface Protein Epitopes on Viral Particles by Multiplex Dual-Reporter Strategy

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of viral particles to host cells, host-virus interactions, and disease pathogenesis. Furthermore, viral membrane proteins on virus particles and presented on host cell surfaces have proven to be excellent targets for antivirals and vaccines. Here, we describe a protocol to investigate surface proteins on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) particles using the dual-reporter flow cytometric system. The assay exploits multiplex technology to obtain a triple detection of viral particles by three independent affinity reactions. Magnetic beads conjugated to recombinant human angiotensin-converting enzyme-2 (ACE2) were used to capture viral particles from the supernatant of cells infected with SARS-CoV-2. Then, two detection reagents labeled with R-phycoerythrin (PE) or Brilliant Violet 421 (BV421) were applied simultaneously. As a proof-of-concept, antibody fragments targeting different epitopes of the SARS-CoV-2 surface protein Spike (S1) were used. The detection of viral particles by three independent affinity reactions provides strong specificity and confirms the capture of intact virus particles. Dose-dependency curves of SARS-CoV-2 infected cell supernatant were generated with replicate coefficient variances (mean/SD) &#706;14%. Good assay performance in both channels confirmed that two virus surface target protein epitopes are detectable in parallel. The protocol described here could be applied for (i) high-multiplex, high-throughput profiling of surface proteins expressed on enveloped viruses; ii) detection of active intact viral particles; and (iii) assessment of specificity and affinity of antibodies and antiviral drugs for surface epitopes of viral antigens.The application can be potentially extended to any type of extracellular vesicles and bioparticles, exposing surface antigens in body fluids or other liquid matrices.

Author Spotlight: Advancing Antiviral Strategies Through Novel Immunocapture and Mass Spectrometry Techniques

Here, we describe a newly developed multiplex fluorescent immunoassay that uses a dual-reporter flow cytometric system to concurrently detect two unique spike protein epitopes on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral particles that had been captured by angiotensin-converting enzyme-2-coupled magnetic microspheres.

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of ...

Dynamic Monitoring of Seroconversion using a Multianalyte Immunobead Assay for Covid-19

Multiplex technologies for interrogating multiple biomarkers in concert have existed for several decades; however, methods to evaluate multiple epitopes on the same analyte remain limited. This report describes the development and optimization of a multiplexed immunobead assay for serological testing of common immunoglobulin isotypes (e.g., IgA, IgM, and IgG) associated with an immune response to SARS-CoV-2 infection or vaccination. Assays were accomplished using a flow-based, multiplex fluorescent reader with dual-channel capability. Optimizations focused on analyte capture time, detection antibody concentration, and detection antibody incubation time. Analytical assay performance characteristics (e.g., assay range (including lower and upper limits of quantitation); and intra- and inter-assay precision) were established for either IgG/IgM or IgA/IgM serotype combination in tandem using the 'dual channel' mode. Analyte capture times of 30 min for IgG, 60 min for IgM, and 120 min for IgA were suitable for most applications, providing a balance of assay performance and throughput. Optimal detection antibody incubations at 4 &#181;g/mL for 30 min was observed and are recommended for general applications, given the overall excellent precision (percent coefficient of variance (%CV) &#8804; 20%) and sensitivity values observed. The dynamic range for the IgG isotype spanned several orders of magnitude for each assay (Spike S1, Nucleocapsid, and Membrane glycoproteins), which supports robust titer evaluations at a 1:500 dilution factor for clinical applications. Finally, the optimized protocol was applied to monitoring Spike S1 seroconversion for subjects (n = 4) that completed a SARS-CoV-2 vaccine regimen. Within this cohort, Spike S1 IgG levels were observed to reach maximum titers at 14 days following second dose administration, at a much higher (~40-fold) signal intensity than either IgM or IgA isotypes. Interestingly, we observed highly variable Spike S1 IgG titer decay rates that were largely subject-dependent were observed, which will be the topic of future studies.

This article describes a convenient method for monitoring dynamic changes in antibody titers for two immunoglobulin isotypes concurrently (either IgA, IgM, or IgG) resulting from an immune response to SARS-CoV-2 infection or vaccination. This 'Multianalyte Covid-19 Immune Response Panel' employs three indirect immunoassays built on coded microspheres that are read using a flow-based multiplex reader with 'dual-channel' capability.

Multiplex technologies for interrogating multiple biomarkers in concert have existed for several decades; however, methods to evaluate multiple epitopes ...

Medicine

High-throughput Confocal Imaging of Quantum Dot-Conjugated SARS-CoV-2 Spike Trimers to Track Binding and Endocytosis in HEK293T Cells

The development of new technologies for cellular fluorescence microscopy has facilitated high-throughput screening methods for drug discovery. Quantum dots are fluorescent nanoparticles with excellent photophysical properties imbued with bright and stable photoluminescence as well as narrow emission bands. Quantum dots are spherical in shape, and with the proper modification of the surface chemistry, can be used to conjugate biomolecules for cellular applications. These optical properties, combined with the ability to functionalize them with biomolecules, make them an excellent tool for investigating receptor-ligand interactions and cellular trafficking. Here, we present a method that uses quantum dots to track the binding and endocytosis of SARS-CoV-2 spike protein. This protocol can be used as a guide for experimentalists looking to utilize quantum dots to study protein-protein interactions and trafficking in the context of cellular physiology.

In this protocol, quantum dots conjugated to recombinant SARS-CoV-2 spike enable cell-based assays to monitor spike binding to hACE2 at the plasma membrane and subsequent endocytosis of the bound proteins into the cytoplasm.

The development of new technologies for cellular fluorescence microscopy has facilitated high-throughput screening methods for drug discovery. Quantum ...

Biology

Bioreporter Assay: A Sensitive Technique using a Bioluminescent Reporter System to Detect SARS-CoV-2 Antibodies

Source: Rezaei, R. et al., <a href="https://app.jove.com/v/62488">Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter.</a> J. Vis. Exp. (2021)
In this video, we show the HiBit-RBD bioreporter system-based assay for detecting SARS-CoV-2 neutralizing antibodies. This system targets the viral RBD domain by using a bioluminescent reporter system containing HiBiT fused to the RBD domain.

Source: Rezaei, R. et al., Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter. J. Vis. Exp. (2021)
In this video, we ...

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

Summary

Explore More Videos

Biomolecular Detection employing the Interferometric Reflectance Imaging Sensor (IRIS)

Engineering Antiviral Agents via Surface Plasmon Resonance

In Vitro Selection of Aptamers to Differentiate Infectious from Non-Infectious Viruses

High-Performance Graphene-Modified Sensing Chip for SARS-CoV-2 Detection

Detection of SARS-CoV-2 Neutralizing Antibodies using High-Throughput Fluorescent Imaging of Pseudovirus Infection

A Rapid, Multiplex Dual Reporter IgG and IgM SARS-CoV-2 Neutralization Assay for a Multiplexed Bead-Based Flow Analysis System

Profiling of Surface Protein Epitopes on Viral Particles by Multiplex Dual-Reporter Strategy

Dynamic Monitoring of Seroconversion using a Multianalyte Immunobead Assay for Covid-19

High-throughput Confocal Imaging of Quantum Dot-Conjugated SARS-CoV-2 Spike Trimers to Track Binding and Endocytosis in HEK293T Cells

Bioreporter Assay: A Sensitive Technique using a Bioluminescent Reporter System to Detect SARS-CoV-2 Antibodies