Name: detection of sars-cov-2 receptor-binding domain antibody using a hibit-based bioreporter
Uploaded: 2021-08-12T13:30:00
Description: Watch this Scientific Journal Video about Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter at JoVE.com

We appreciate and thank the technical assistance of Xiaohong He, Ricardo Marius, Julia Petryk, Bradley Austin, and Christiano Tanese De Souza. We also thank Mina Ghahremani for Graphic Design. We would also like to thank all the individuals who participated and donated their blood samples for this study. DWC is supported in part by uOttawa Faculty and Department of Medicine.

NOTE: The protocol described below adheres to all ethics guidelines according to protocol code 20200371-01H.
1. Production and evaluation of the HiBiT-RBD bioreporter
<ol>
	<li>Producing a sufficient quantity of HiBiT-RBD bioreporter
	<ol>
		<li>Prepare for cell culture
		<ol>
			<li>Prepare complete Dulbecco&#39;s modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Then, warm the media in a 37 &#176;C water bath.</li>
			<li>Turn the biological saf...

<ol>
	<li>Ullah, H., Ullah, A., Gul, A., Mousavi, T., Khan, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+coronavirus+2019+(COVID-19)+pandemic+outbreak:+A+comprehensive+review+of+the+current+literature.">Novel coronavirus 2019 (COVID-19) pandemic outbreak: A comprehensive review of the current literature.</a> Vacunas. , (2020).</li><li>Coronavirus update (Live). Worldometer Available from: <a target="_blank" href="https://www.worldometers.info/coronavirus/">https://www.worldometers.info/coronavirus/</a> (2021)</li><li>Cacciapaglia, G., Cot, C., Sannino, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Second+wave+COVID-19+pandemics+in+Europe:+a+temporal+playbook.">Second wave COVID-19 pandemics in Europe: a temporal playbook.</a> Scientific Reports. 10 (1), 15514 (2020).</li><li>COVID-19 vaccines. World Health Organization Available from: <a target="_blank" href="https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines">https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines</a> (2021)</li><li>Hueston, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+antibody+response+to+SARS-CoV-2+infection.">The antibody response to SARS-CoV-2 infection.</a> Open Forum Infectious Diseases. 7 (9), (2020).</li><li>Lan, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+of+the+SARS-CoV-2+spike+receptor-binding+domain+bound+to+the+ACE2+receptor.">Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor.</a> Nature. 581 (7807), 215-220 (2020).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implications+for+SARS-CoV-2+vaccine+design:+fusion+of+Spike+glycoprotein+transmembrane+domain+to+receptor-binding+domain+induces+trimerization.">Implications for SARS-CoV-2 vaccine design: fusion of Spike glycoprotein transmembrane domain to receptor-binding domain induces trimerization.</a> Membranes. 10 (9), 215 (2020).</li><li>Piccoli, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+neutralizing+and+immunodominant+sites+on+the+SARS-CoV-2+Spike+receptor-binding+domain+by+structure-guided+high-resolution+serology.">Mapping neutralizing and immunodominant sites on the SARS-CoV-2 Spike receptor-binding domain by structure-guided high-resolution serology.</a> Cell. 183 (4), 1024-1042 (2020).</li><li>Premkumar, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+receptor-binding+domain+of+the+viral+spike+protein+is+an+immunodominant+and+highly+specific+target+of+antibodies+in+SARS-CoV-2+patients.">The receptor-binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients.</a> Science Immunology. 5 (48), (2020).</li><li>Walls, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elicitation+of+potent+neutralizing+antibody+responses+by+designed+protein+nanoparticle+vaccines+for+SARS-CoV-2.">Elicitation of potent neutralizing antibody responses by designed protein nanoparticle vaccines for SARS-CoV-2.</a> Cell. 183 (5), 1367-1382 (2020).</li><li>Azad, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoluciferase+complementation-based+biosensor+reveals+the+importance+of+N-+linked+glycosylation+of+SARS-CoV-2+Spike+for+viral+entry.">Nanoluciferase complementation-based biosensor reveals the importance of N- linked glycosylation of SARS-CoV-2 Spike for viral entry.</a> Mol Ther. , 0074-0075 (2021).</li><li>Bastos, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+accuracy+of+serological+tests+for+covid-19:+systematic+review+and+meta-analysis.">Diagnostic accuracy of serological tests for covid-19: systematic review and meta-analysis.</a> BMJ. 370, 2516 (2020).</li><li>Bioluminescent Reporters | Reporter Gene Applications | An Introduction to Reporter Genes. Promega Available from: <a target="_blank" href="https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa">https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa</a> (2021)</li><li>Fleiss, A., Sarkisyan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+review+of+bioluminescent+systems.">A brief review of bioluminescent systems.</a> Current Genetics. 65 (4), 877-882 (2019).</li><li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+kinome-wide+screen+using+a+NanoLuc+LATS+luminescent+biosensor+identifies+ALK+as+a+novel+regulator+of+the+Hippo+pathway+in+tumorigenesis+and+immune+evasion.">A kinome-wide screen using a NanoLuc LATS luminescent biosensor identifies ALK as a novel regulator of the Hippo pathway in tumorigenesis and immune evasion.</a> The FASEB Journal. 33 (11), 12487-12499 (2019).</li><li>Boute, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoLuc+Luciferase+-+a+multifunctional+tool+for+high+throughput+antibody+screening.">NanoLuc Luciferase - a multifunctional tool for high throughput antibody screening.</a> Frontiers in Pharmacology. 7, 27 (2016).</li><li>Nouri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+celastrol+as+a+novel+YAP-TEAD+inhibitor+for+cancer+therapy+by+high+throughput+screening+with+ultrasensitive+YAP/TAZ-TEAD+biosensors.">Identification of celastrol as a novel YAP-TEAD inhibitor for cancer therapy by high throughput screening with ultrasensitive YAP/TAZ-TEAD biosensors.</a> Cancers. 11 (10), 1596 (2019).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SARS-CoV-2+S1+NanoBiT:+A+nanoluciferase+complementation-based+biosensor+to+rapidly+probe+SARS-CoV-2+receptor+recognition.">SARS-CoV-2 S1 NanoBiT: A nanoluciferase complementation-based biosensor to rapidly probe SARS-CoV-2 receptor recognition.</a> Biosensors and Bioelectronics. 180, 113122 (2021).</li><li>Brown, E. E. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+critical+determinants+of+ACE2-SARS+CoV-2+RBD+interaction.">Characterization of critical determinants of ACE2-SARS CoV-2 RBD interaction.</a> International Journal of Molecular Sciences. 22 (5), 2268 (2021).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gain-of-functional+screen+identifies+the+Hippo+pathway+as+a+central+mediator+of+receptor+tyrosine+kinases+during+tumorigenesis.">A gain-of-functional screen identifies the Hippo pathway as a central mediator of receptor tyrosine kinases during tumorigenesis.</a> Oncogene. 39 (2), 334-355 (2020).</li><li>Schwinn, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Mediated+tagging+of+endogenous+proteins+with+a+luminescent+peptide.">CRISPR-Mediated tagging of endogenous proteins with a luminescent peptide.</a> ACS Chemical Biology. 13 (2), 467-474 (2018).</li><li>Azad, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-throughput+NanoBiT-based+serological+assay+detects+SARS-CoV-2+seroconversion.">A high-throughput NanoBiT-based serological assay detects SARS-CoV-2 seroconversion.</a> Nanomaterials. 11 (3), 807 (2021).</li></ol>

The increasing number of people infected with the SARS-CoV-2 and the ongoing effort for global vaccination necessitates sensitive and fast serologic tests that can be used in large-scale serosurveys. Recent research shows that split nanoluciferase-based bioreporters can be used to develop such assays. We recently developed the HiBiT-RBD bioreporter to design a test that can be used to detect SARS-CoV-2-specific antibodies in patient serum in a fast and reliable fashion (Figure 4C).
<p cl...

The recent emergence of a new coronavirus, SARS-CoV21, has caused more than 2,800,000 fatalities and 128 million infections as of March 30th, 20212. Due to the lack of a reliable and well-established treatment procedure for SARS-CoV-2 clinical therapies, many endeavors have been made to restrict further viral transmission and more importantly, to develop an effective and robust treatment or a vaccine3. To date, there are more than 50 COVID-19 vaccine candidates in trials reported by the World Health Organization4. Detection of antibodies against SARS-CoV-2 is of paramount importance to determine the long-term stability of humoral response upon administration of the vaccine as well as in recovered patients of COVID-195. Some studies have demonstrated that there is a possibility that recovered SARS-CoV-2 patients lose most of the RBD-binding antibodies after 1 year5,6,7,8,9. Further investigation is required to better understand lasting immunity, and more sensitive antibody detection platforms can help further such work. Reports of sustained immunity of mild SARS-CoV-2 infections, which suggest long-term antibody responses, is also an interesting and worthwhile area of study. A fast and accurate method of detection is essential for monitoring antibodies in individuals&#39; sera to provide more information about immunity in the population.
Like other coronaviruses, SARS-CoV-2 uses protruding spike glycoprotein to bind to angiotensin-converting enzyme-2 (ACE2) to initiate a cascade of events that lead to the fusion of the viral and cell membranes6,7. Several studies have recently proved the RBD of the Spike protein to have a crucial role in eliciting powerful and specific antibody response against SARS-CoV28,9,10,11. In particular, correlations observed by Premkumar et al. between the titer of RBD-binding antibody and SARS-CoV-2 neutralization potency of patients&#39; plasma are consistent with RBD being an immunogenic compartment of the virus structure9. With that in mind, many diagnostic tests available for SARS-CoV-2 antibody detection are time and cost-intensive, require a lengthy procedure of incubation and washing (enzyme-linked immunosorbent assay [ELISA]), or lack sensitivity and accuracy (lateral flow immunoassay [LFIA])12. Therefore, a quantitative and rapid complementary serological method of COVID-19-derived antibody detection with high sensitivity, fast response, and relatively low cost would serve the need for a reliable serologic test for SARS-CoV-2 epidemiologic surveillance.
Collectively, the limitations of current serological assays prompted the investigation of the bioluminescent reporting system as a potential diagnostic agent in future serosurveys. Bioluminescence is a naturally occurring enzyme/substrate reaction, with light emission. Nanoluc luciferase is the smallest (19 kDa), yet the brightest system compared to Renilla and firefly luciferase (36 kDa and 61 kDa, respectively)13,14. Further, Nanoluc has the highest signal to noise ratio and stability among the previously mentioned systems. The high signal intensity of Nanoluc supports the detection of even very low amounts of reporter fusions15. Nanoluc Binary Technology (NanoBiT) is a split version of the Nanoluc system, which is comprised of two segments: small BiT (11 amino acids; SmBiT) and large BiT (LgBiT) with relatively low-affinity interactions (KD = 190 &#181;M ) to form a luminescent complex16. NanoBiT is extensively used in various studies involving the identification of protein-protein interactions15,17,18,19 and cellular signaling pathways11,20,21.
Recently, another small peptide with a distinctly higher affinity to LgBiT (KD = 0.7 nM ) was introduced, namely the HiBiT Nano-Glo system, in place of SmBiT. The high affinity and strong signal of the Nano-Glo &#34;add-mix-read&#34; assay makes HiBiT a suitable, quantitative, luminescent peptide tag. In this approach, the HiBiT tag is appended to the target protein by developing a construct imposing minimal structural interference. HiBiT-protein fusion would actively bind to the LgBiT counterpart, producing a highly active luciferase enzyme to generate detectable bioluminescence in the presence of detection reagents (Figure 1). Similarly, we developed a HiBiT Nano-Glo-based system to readily measure the neutralizing antibody titer in the sera of SARS-CoV-2 recovered individuals and recently developed a HiBiT-tagged SARS-CoV-2 RBD. This paper describes the protocol for producing the HiBiT-RBD bioreporter using standard laboratory procedures and equipment, and shows how this bioreporter can be used in a fast and efficient assay to detect SARS-CoV-2 RBD-targeting antibodies.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5x Passive Lysis Buffer</td>
			<td>Promega</td>
			<td>E194A</td>
			<td>30 mL</td>
		</tr>
		<tr>
			<td>Bio-Plex Handheld Magnetic Washer</td>
			<td>Bio-Rad</td>
			<td>171020100</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Sigma</td>
			<td>D6429-500ml</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td>100 mL kit</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Sigma</td>
			<td>F1051</td>
			<td></td>
		</tr>
		<tr>
			<td>HiBiT-RBD Plasmid</td>
			<td></td>
			<td></td>
			<td>gacggatcgggagatctcccgatcccctatggt
				gcactctcagtacaatctgctctgatgccgcata
				gttaagccagtatctgctccctgcttgtgtgttgg
				aggtcgctgagtagtgcgcgagcaaaattta
				agctacaacaaggcaaggcttgaccgacaa
				ttgcatgaagaatctgcttagggttaggcgttttg
				cgctgcttcgcgatgtacgggccagatatacgc
				gttgacattgattattgactagttattaatagt
				aatcaattacggggtcattagttcatagcccat
				atatggagttccgcgttacataacttacggtaa
				atggcccgcctggctgaccgcccaacgaccc
				ccgcccattgacgtcaataatgacgtatgttccc
				atagtaacgccaatagggactttccattgacgtc
				aatgggtggagtatttacggtaaactgcccact
				tggcagtacatcaagtgtatcatatgccaagta
				cgccccctattgacgtcaatgacggtaaatgg
				cccgcctggcattatgcccagtacatgaccttat
				gggactttcctacttggcagtacatctacgtat
				tagtcatcgctattaccatggtgatgcggtttt
				ggcagtacatcaatgggcgtggatagcggtttg
				actcacggggatttccaagtctccaccccattg
				acgtcaatgggagtttgttttggcaccaaaatc
				aacgggactttccaaaatgtcgtaacaactccg
				ccccattgacgcaaatgggcggtaggcgtgta
				cggtgggaggtctatataagcagagctctctgg
				ctaactagagaacccactgcttactggcttatcg
				aaattaatacgactcactatagggagacccaa
				gctggctagcgtttaaacttaagcttggtaccga
				gctcggatccgccaccATGGAGACAGA
				CACACTCCTGCTATGGGTACTGC
				TGCTCTGGGTTCCAGGTTCCAC
				TGGTGACtctggctctagcggctctggctct
				agcggcggcATGGTGAGCGGCTG
				GCGGCTGTTCAAGAAGATTAGC
				tctagcggcGACTACAAGGACC
				ACGACGGTGACTACAAGGACCA
				CGACATCGACTACAAGGACGAC
				GACGACAAGggcagcggctccggca
				gcagcggaggaggaggctctggaggagga
				ggctctagcggcggcaacatcacaaatctgtg
				cccattcggcgaggtgtttaacgccaccagat
				ttgccagcgtgtatgcctggaaccggaagaga
				atctctaattgcgtggccgactatagcgtgct
				gtacaatagcgcctccttctctacctttaagt
				gctatggcgtgtcccccacaaagctgaacgac
				ctgtgcttcaccaacgtgtacgccgactcttttgt
				gatcaggggcgatgaggtgcgccagatcgc
				acctggacagacaggcaagatcgccgactac
				aactataagctgccagacgatttcaccggct
				gcgtgatcgcctggaatagcaacaatctggatt
				ccaaagtgggcggcaactacaattatctgtac
				cggctgttcagaaagagcaacctgaagccctt
				tgagcgggatatcagcacagagatctaccag
				gcaggctccaccccttgcaacggagtggagg
				gcttcaattgttattttcccctgcagagctacggc
				ttccagcctacaaatggcgtgggctatcagcca
				tacagggtggtggtgctgtcctttgagctgctg
				cacgcacctgcaaccgtgtcctctggacacatc
				gagggccgccacatgctggagatgggccatc
				atcaccatcatcaccaccaccaccactgatag
				cggccgctcgagtctagagggcccgtttaaac
				ccgctgatcagcctcgactgtgccttctagtt
				gccagccatctgttgtttgcccctcccccgtg
				ccttccttgaccctggaaggtgccactcccac
				tgtcctttcctaataaaatgaggaaattgcat
				cgcattgtctgagtaggtgtcattctattctgggg
				ggtggggtggggcaggacagcaaggggga
				ggattgggaagacaatagcaggcatgctggg
				gatgcggtgggctctatggcttctgaggcggaa
				agaaccagctggggctctagggggtatcccca
				cgcgccctgtagcggcgcattaagcgcggcg
				ggtgtggtggttacgcgcagcgtgaccgctac
				acttgccagcgccctagcgcccgctcctttcg
				ctttcttcccttcctttctcgccacgttcgccggctt
				tccccgtcaagctctaaatcgggggctcccttta
				gggttccgatttagtgctttacggcacctcgacc
				ccaaaaaacttgattagggtgatggttcacgta
				gtgggccatcgccctgatagacggtttttcgcc
				ctttgacgttggagtccacgttctttaatagtg
				gactcttgttccaaactggaacaacactcaacc
				ctatctcggtctattcttttgatttataagggatttt
				gccgatttcggcctattggttaaaaaatgagctg
				atttaacaaaaatttaacgcgaattaattctgt
				ggaatgtgtgtcagttagggtgtggaaagtccc
				caggctccccagcaggcagaagtatgcaaag
				catgcatctcaattagtcagcaaccaggtgtgg
				aaagtccccaggctccccagcaggcagaagt
				atgcaaagcatgcatctcaattagtcagcaac
				catagtcccgcccctaactccgcccatcccgc
				ccctaactccgcccagttccgcccattctccgcc
				ccatggctgactaattttttttatttatgcagaggc
				cgaggccgcctctgcctctgagctattccagaa
				gtagtgaggaggcttttttggaggcctaggcttttg
				caaaaagctcccgggagcttgtatatccattttc
				ggatctgatcaagagacaggatgaggatcgttt
				cgcatgattgaacaagatggattgcacgcagg
				ttctccggccgcttgggtggagaggctattcggc
				tatgactgggcacaacagacaatcggctgctct
				gatgccgccgtgttccggctgtcagcgcagggg
				cgcccggttctttttgtcaagaccgacctgtccgg
				tgccctgaatgaactgcaggacgaggcagcg
				cggctatcgtggctggccacgacgggcgttcct
				tgcgcagctgtgctcgacgttgtcactgaagcg
				ggaagggactggctgctattgggcgaagtgcc
				ggggcaggatctcctgtcatctcaccttgctcctg
				ccgagaaagtatccatcatggctgatgcaatg
				cggcggctgcatacgcttgatccggctacctgc
				ccattcgaccaccaagcgaaacatcgcatcg
				agcgagcacgtactcggatggaagccggtct
				tgtcgatcaggatgatctggacgaagagcat
				caggggctcgcgccagccgaactgttcgcca
				ggctcaaggcgcgcatgcccgacggcgagg
				atctcgtcgtgacccatggcgatgcctgcttg
				ccgaatatcatggtggaaaatggccgctttt
				ctggattcatcgactgtggccggctgggtgt
				ggcggaccgctatcaggacatagcgttggct
				acccgtgatattgctgaagagcttggcggcg
				aatgggctgaccgcttcctcgtgctttacgg
				tatcgccgctcccgattcgcagcgcatcgcc
				ttctatcgccttcttgacgagttcttctgagcg
				ggactctggggttcgaaatgaccgaccaag
				cgacgcccaacctgccatcacgagatttcgat
				tccaccgccgccttctatgaaaggttgggctt
				cggaatcgttttccgggacgccggctggatga
				tcctccagcgcggggatctcatgctggagt
				tcttcgcccaccccaacttgtttattgcagctta
				taatggttacaaataaagcaatagcatcacaa
				atttcacaaataaagcatttttttcactgcatt
				ctagttgtggtttgtccaaactcatcaatgtat
				cttatcatgtctgtataccgtcgacctctagct
				agagcttggcgtaatcatggtcatagctgtttc
				ctgtgtgaaattgttatccgctcacaattccacac
				aacatacgagccggaagcataaagtgtaaag
				cctggggtgcctaatgagtgagctaactcacat
				taattgcgttgcgctcactgcccgctttccagtc
				gggaaacctgtcgtgccagctgcattaatgaa
				tcggccaacgcgcggggagaggcggtttgcg
				tattgggcgctcttccgcttcctcgctcactgactc
				gctgcgctcggtcgttcggctgcggcgagcggt
				atcagctcactcaaaggcggtaatacggttatc
				cacagaatcaggggataacgcaggaaagaa
				catgtgagcaaaaggccagcaaaaggccag
				gaaccgtaaaaaggccgcgttgctggcgtttt
				tccataggctccgcccccctgacgagcatcac
				aaaaatcgacgctcaagtcagaggtggcgaa
				acccgacaggactataaagataccaggcgtt
				tccccctggaagctccctcgtgcgctctcctgtt
				ccgaccctgccgcttaccggatacctgtccgcc
				tttctcccttcgggaagcgtggcgctttctcat
				agctcacgctgtaggtatctcagttcggtgtag
				gtcgttcgctccaagctgggctgtgtgcacgaa
				ccccccgttcagcccgaccgctgcgccttatcc
				ggtaactatcgtcttgagtccaacccggtaag
				acacgacttatcgccactggcagcagccactg
				gtaacaggattagcagagcgaggtatgtaggc
				ggtgctacagagttcttgaagtggtggcctaact
				acggctacactagaagaacagtatttggtatc
				tgcgctctgctgaagccagttaccttcggaaa
				aagagttggtagctcttgatccggcaaacaaa
				ccaccgctggtagcggtggtttttttgtttgca
				agcagcagattacgcgcagaaaaaaaggat
				ctcaagaagatcctttgatcttttctacggggt
				ctgacgctcagtggaacgaaaactcacgttaa
				gggattttggtcatgagattatcaaaaaggatct
				tcacctagatccttttaaattaaaaatgaagtt
				ttaaatcaatctaaagtatatatgagtaaactt
				ggtctgacagttaccaatgcttaatcagtgagg
				cacctatctcagcgatctgtctatttcgttcatcca
				tagttgcctgactccccgtcgtgtagataactac
				gatacgggagggcttaccatctggccccagtg
				ctgcaatgataccgcgagacccacgctcacc
				ggctccagatttatcagcaataaaccagccag
				ccggaagggccgagcgcagaagtggtcctg
				caactttatccgcctccatccagtctattaattgtt
				gccgggaagctagagtaagtagttcgccagtt
				aatagtttgcgcaacgttgttgccattgctacag
				gcatcgtggtgtcacgctcgtcgtttggtatgg
				cttcattcagctccggttcccaacgatcaaggc
				gagttacatgatcccccatgttgtgcaaaaaag
				cggttagctccttcggtcctccgatcgttgtca
				gaagtaagttggccgcagtgttatcactcatggt
				tatggcagcactgcataattctcttactgtcatg
				ccatccgtaagatgcttttctgtgactggtgagta
				ctcaaccaagtcattctgagaatagtgtatgcg
				gcgaccgagttgctcttgcccggcgtcaatacg
				ggataataccgcgccacatagcagaactttaa
				aagtgctcatcattggaaaacgttcttcggggc
				gaaaactctcaaggatcttaccgctgttgagat
				ccagttcgatgtaacccactcgtgcacccaact
				gatcttcagcatcttttactttcaccagcgtttc
				tgggtgagcaaaaacaggaaggcaaaatgc
				cgcaaaaaagggaataagggcgacacgga
				aatgttgaatactcatactcttcctttttcaat
				attattgaagcatttatcagggttattgtc
				tcatgagcggatacatatttgaatgtattt
				agaaaaataaacaaataggggttccgcgca
				catttccccgaaaagtgccacctgacgtc</td>
		</tr>
		<tr>
			<td>LgBiT</td>
			<td>Promega</td>
			<td>N3030</td>
			<td></td>
		</tr>
		<tr>
			<td>penicillin Streptomycin</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce Protein G Magnetic Beads</td>
			<td>Thermo Fisher Scientific</td>
			<td>88848</td>
			<td></td>
		</tr>
		<tr>
			<td>PolyJet In Vitro DNA Transfection Reagent</td>
			<td>Signagen</td>
			<td>SL100688.5</td>
			<td></td>
		</tr>
		<tr>
			<td>SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab</td>
			<td>SinoBiological</td>
			<td>40592-MM57</td>
			<td></td>
		</tr>
		<tr>
			<td>Synergy Mx Microplate Reader</td>
			<td>BioTek</td>
			<td></td>
			<td>96-well plate reader luminometer</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA</td>
			<td>Thermo Fisher Scientific</td>
			<td>2520056</td>
			<td>0.25%</td>
		</tr>
	</tbody>
</table>

detection of sars-cov-2 receptor-binding domain antibody using a hibit-based bioreporter

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The increasing number of SARS-CoV-2 infections raises the need for better antibody detection assays. Current antibody detection methods compromise sensitivity for speed or are sensitive but time-consuming. A large proportion of SARS-CoV-2-neutralizing antibodies target the receptor-binding domain (RBD), one of the primary immunogenic compartments of SARS-CoV-2. We have recently designed and developed a highly sensitive, bioluminescent-tagged RBD (NanoLuc HiBiT-RBD) to detect SARS-CoV-2 antibodies. The following text describes the procedure to produce the HiBiT-RBD complex and a fast assay to evaluate the presence of RBD-targeting antibodies using this tool. Due to the durability of the HiBiT-RBD protein product over a wide range of temperatures and the shorter experimental procedure that can be completed within 1 h, the protocol can be considered as a more efficient alternative to detect SARS-CoV-2 antibodies in patient serum samples.

The signals from both the HiBit-RBD-containing cell lysate and supernatant of the transfected cells were recorded (Figure 2) to evaluate the appropriate protein source. HiBiT-RBD and LgBit were separately used as controls, and the data showed low background compared to a strong signal when both parts were combined. Hence, HiBiT-RBD interaction with LgBiT is necessary to generate active enzyme for substrate digestion and bioluminescence activity (Figure 1).
<...

Watch this Scientific Journal Video about Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter at JoVE.com

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe ...

My lab has been working in COVID-19 research, and we have recently developed a novel assay that allowed us to quickly and accurately detect SARS-CoV-2 antibodies. This protocol outlines a high throughput assay for detecting anti-SARS-CoV-2 antibodies in patient serum samples, which is critical given the current pandemic. The majority of current serological assays sacrifice speed for sensitivity or vice versa.Our data shows that our assay is both sensitive and has a quick response time. In order to produce a sufficient quantity of high HiBiT-RBD bioreporter, begin by preparing for cell culture. First, prepare complete Dulbecco's modified eagle medium containing 10%fetal bovine serum and 1%penicillin and streptomycin.Then warm the media in a 37 degree Celsius water bath. Turn the biological safety cabinet on and use 70%ethanol for sterilizing the cabinet surface. To culture the cell line, take it out from minus 80 degrees Celsius or liquid nitrogen and thaw it in a 37 degree Celsius water bath.Mix the thawed cells with at least 10 milliliters of complete medium. Pipette the cell suspension into a 15 centimeter Petri dish and swirl the plate to distribute the cells uniformly. Place the dish in a cell culture incubator at 37 degrees Celsius, 5%carbon dioxide, and 85 to 95%humidity.Observe the cells under the microscope until the confluency level reaches 80 to 90%At high confluency, remove the medium, wash the cells with warm PBS and add three to five milliliters of 0.25%trypsin-EDTA to detach the cells from the surface. After approximately five minutes, look at the cells under a microscope. If all cells are floating, add at least four milliliters of medium and transfer the cell suspension into a new sterile tube.Count the cells using a hemocytometer and add one million cells into each well of a six-well plate for transfection. To perform transfection of the HiBiT-RBD plasmid, use one microgram of the HiBiT-RBD expression plasmid with a suitable transfection reagent. Incubate for 10 to 15 minutes at room temperature, then add the total volume to each well of the plate dropwise.On the next day, replace the medium containing the transfection mixture with complete medium. Observe the transfection control well 48 hours after transfection. Collect the supernatant in 1.5 milliliter microtubes.Add 500 microliters of 1X passive lysis buffer or PLB to the cells, then incubate and shake the plate for 15 minutes at room temperature for cell lysis. Next, to evaluate the luminescence signal from the bioreporter using a luciferase assay, first prepare the reaction components and use the supernatant as the source of the bioreporter. Dilute the large BiT and substrate to 1X before use.Transfer 50 microliters of the supernatant from each well or tube to a 96-well plate and add 50 microliters of 1X large BiT to each well. Incubate for five minutes at room temperature. Open the luminometer software, add 50 microliters of 1X substrate to each well, place the plate in the luminometer and run the software.In order to perform the HiBiT-RBD antibody detection assay, prepare the HiBiT-RBD bioreporter as previously described and combine 50 microliters of the HiBiT-RBD containing supernatant with one microgram of the commercial SARS-CoV-2 RBD antibody in a 1.5 milliliter microtube. Add 20 microliters of immunoglobulin binding protein or Protein G to the solution. Bring the total volume to 300 microliters by adding PBS.Incubate the tubes on a tube shaker or rotator for 30 minutes. Centrifuge at 12, 000 G for 30 seconds. Then discard the supernatant and wash with PBS.Repeat the process three times to remove free HiBiT-RBD. Resuspend the cells in 50 microliters of PBS and transfer it to a 96-well plate. Add 50 microliters of 1X large BiT and wait for five minutes.Then add 50 microliters of 1X NanoLuc substrate. Immediately read the luminescence signal with a luminometer. Prepare larger quantities of the HiBiT-RBD bioreporter for a high throughput assay and combine 20 microliters of magnetic Protein G with 50 microliters of the HiBiT-RBD supernatant in each well of a 96-well plate for each sample.Add 10 microliters of the serum sample to each well and bring the total volume to 150 microliters by adding PBS. Incubate for 30 minutes on a shaker at room temperature. Then place the plate on a magnetic washer to precipitate the Protein G antibody complex.Discard the solution in the middle section of each well and add PBS for washing. Repeat the washing step at least three times to remove excess HiBiT-RBD. Add 50 microliters of 1X PBS and 50 microliters of 1X large BiT and incubate for at least five minutes at room temperature.Prepare the luminometer software. Then add 50 microliters of 1X substrate. Place the plate in the machine, run software and record the signals.Compare the signals from serum samples, control samples, and background signal from empty wells. The signals from both the HiBiT-RBD containing cell lysate and supernatant of the transfected cells were recorded to evaluate the appropriate protein source. The data showed low background compared to a strong signal when both parts were combined.The addition of Protein G helps antibody precipitation. The assay was used to compare the signal from a commercial SARS-CoV-2 neutralizing antibody with a control IgG. The specific antibody signal was robust, while the control antibody had close to the luminescent background level.Recombinant attenuated oncolytic vesicular stomatitis virus or VSV with a mutation at position 51 of the M protein expressing exogenous RBD was used to vaccinate mice. The serum collected from vaccinated mice produced a robust signal compared to no signal in mice injected with control VSV. This protocol can be used for detection of the SARS-CoV-2 antibodies in patient serum samples.The wash steps following incubation with Protein G is critical for reducing background. In addition, it's important to add the substrate as quickly as possible to avoid signal loss. With a few additional optimization steps, the same assay can be used to analyze blood samples and could be an effective method for the determining anti-SARS-CoV-2 antibodies in patient blood samples.

detection-sars-cov-2-receptor-binding-domain-antibody-using-hibit

Research

JoVE Journal

Immunology and Infection

Visualization of SARS-CoV-2 using Immuno RNA-Fluorescence In Situ Hybridization

This manuscript provides a protocol for in situ hybridization chain reaction (HCR) coupled with immunofluorescence to visualize severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA in cell line&#160;and three-dimensional (3D) cultures of human airway epithelium. The method allows highly specific and sensitive visualization of viral RNA by relying on HCR initiated by probe localization. Split-initiator probes help amplify the signal by fluorescently labeled amplifiers, resulting in negligible background fluorescence in confocal microscopy. Labeling amplifiers with different fluorescent dyes facilitates the simultaneous recognition of various targets. This, in turn, allows the mapping of the infection in tissues to better understand viral pathogenesis and replication at the single-cell level. Coupling this method with immunofluorescence may facilitate better understanding of host-virus interactions, including alternation of the host epigenome and immune response pathways. Owing to sensitive and specific HCR technology, this protocol can also be used as a diagnostic tool. It is also important to remember that the technique may be modified easily to enable detection of any RNA, including non-coding RNAs and RNA viruses that may emerge in the future.

Here, we describe a simple method that combines RNA fluorescence in situ&#160;hybridization (RNA-FISH) with immunofluorescence to visualize severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA. This protocol may increase understanding of the molecular characteristics of SARS-CoV-2 RNA-host interactions at a single-cell level.

This manuscript provides a protocol for in situ hybridization chain reaction (HCR) coupled with immunofluorescence to visualize severe acute respiratory ...

Detection of SARS-CoV-2 Neutralizing Antibodies using High-Throughput Fluorescent Imaging of Pseudovirus Infection

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the presence of neutralizing antibodies against the virus may provide protection against future infection. Thus, as the creation and translation of effective COVID-19 vaccines continues at an unprecedented speed, the development of fast and effective methods to measure neutralizing antibodies against SARS-CoV-2 will become increasingly important to determine long-term protection against infection for both previously infected and immunized individuals. This paper describes a high-throughput protocol using vesicular stomatitis virus (VSV) pseudotyped with the SARS-CoV-2 spike protein to measure the presence of neutralizing antibodies in convalescent serum from patients who have recently recovered from COVID-19. The use of a replicating pseudotyped virus eliminates the necessity for a containment level 3 facility required for SARS-CoV-2 handling, making this protocol accessible to virtually any containment level 2 lab. The use of a 96-well format allows for many samples to be run at the same time with a short turnaround time of 24 h.

The protocol described here outlines a fast and effective method for measuring neutralizing antibodies against the SARS-CoV-2 spike protein by evaluating the ability of convalescent serum samples to inhibit infection by an enhanced green fluorescent protein-labeled vesicular stomatitis virus pseudotyped with spike glycoprotein.

As the COVID-19 pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) continues to evolve, it has become evident that the ...

A Rapid, Multiplex Dual Reporter IgG and IgM SARS-CoV-2 Neutralization Assay for a Multiplexed Bead-Based Flow Analysis System

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel pathogens, such as SARS-CoV-2. Multiplex serological testing can be particularly useful because it can simultaneously analyze antibodies to multiple antigens that optimizes pathogen coverage, and controls for variability in the organism and the individual host response. Here we describe a SARS-CoV-2 IgG 3-plex fluorescent microsphere-based assay that can detect both IgM and IgG antibodies to three major SARS-CoV-2 antigens-the spike (S) protein, spike angiotensin-converting enzyme-2 (ACE2) receptor-binding domain (RBD), and nucleocapsid (Nc). The assay was shown to have comparable performance to a SARS-CoV-2 reference assay for IgG in serum obtained at &#8805;21 days from symptom onset but had higher sensitivity with samples collected at &#8804;5 days from symptom onset. Further, using soluble ACE2 in a neutralization assay format, inhibition of antibody binding was demonstrated for S and RBD.

A flow analysis system for bead-based multiplexed assays which provides a two-reporter readout was used for the development of multiplex serological and antibody neutralization assays that can simultaneously measure neutralizing IgG and IgM antibodies for SARS-CoV-2.

The COVID-19 pandemic has underscored the need for rapid high-throughput methods for sensitive and specific serological detection of infection with novel ...

Live Imaging and Quantification of Viral Infection in K18 hACE2 Transgenic Mice Using Reporter-Expressing Recombinant SARS-CoV-2

The coronavirus disease 2019 (COVID-19) pandemic has been caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To date, SARS-CoV-2 has been responsible for over 242 million infections and more than 4.9 million deaths worldwide. Similar to other viruses, studying SARS-CoV-2 requires the use of experimental methods to detect the presence of virus in infected cells and/or in animal models. To overcome this limitation, we generated replication-competent recombinant (r)SARS-CoV-2 that expresses bioluminescent (nanoluciferase, Nluc) or fluorescent (Venus) proteins. These reporter-expressing rSARS-CoV-2 allow tracking viral infections in vitro and in vivo based on the expression of Nluc and Venus reporter genes. Here the study describes the use of rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus to detect and track SARS-CoV-2 infection in the previously described K18 human angiotensin-converting enzyme 2 (hACE2) transgenic mouse model of infection using in vivo imaging systems (IVIS). This rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus show rSARS-CoV-2/WT-like pathogenicity and viral replication in vivo. Importantly, Nluc and Venus expression allow us to directly track viral infections in vivo and ex vivo, in infected mice. These rSARS-CoV-2/Nluc and rSARS-CoV-2/Venus represent an excellent option to study the biology of SARS-CoV-2 in vivo, to understand viral infection and associated COVID-19 disease, and to identify effective prophylactic and/or therapeutic treatments to combat SARS-CoV-2 infection.

This protocol describes the dynamics of viral infections using luciferase- and fluorescence-expressing recombinant (r)SARS-CoV-2 and an in vivo imaging systems (IVIS) in K18 hACE2 transgenic mice to overcome the need of secondary approaches required to study SARS-CoV-2 infections in vivo.

The coronavirus disease 2019 (COVID-19) pandemic has been caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To date, SARS-CoV-2 has ...

Efficient SARS-CoV-2 Quantitative Reverse Transcriptase PCR Saliva Diagnostic Strategy utilizing Open-Source Pipetting Robots

The emergence of the recent SARS-CoV-2 global health crisis introduced key challenges for epidemiological research and clinical testing. Characterized by a high rate of transmission and low mortality, the COVID-19 pandemic necessitated accurate and efficient diagnostic testing, particularly in closed populations such as residential universities. Initial availability of nucleic acid testing, like nasopharyngeal swabs, was limited due to supply chain pressure which also delayed reporting of test results. Saliva-based reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) testing has shown to be comparable in sensitivity and specificity to other testing methods, and saliva collection is less physically invasive to participants. Consequently, we developed a multiplex RT-qPCR diagnostic assay for population surveillance of Clemson University and the surrounding community. The assay utilized open-source liquid handling robots and thermocyclers instead of complex clinical automation systems to optimize workflow and system flexibility. Automation of saliva-based RT-qPCR enables rapid and accurate detection of a wide range of viral RNA concentrations for both large- and small-scale testing demands. The average turnaround for the automated system was &#60; 9 h for 95% of samples and &#60; 24 h for 99% of samples. The cost for a single test was $2.80 when all reagents were purchased in bulk quantities.

The protocol describes a SARS-CoV-2 diagnostic method that utilizes open-source automation to perform RT-qPCR molecular testing of saliva samples. This scalable approach can be applied to clinical public health surveillance as well as to increase the capacity of smaller university laboratories.

The emergence of the recent SARS-CoV-2 global health crisis introduced key challenges for epidemiological research and clinical testing. Characterized by ...

Quantifying Vaccine-Induced Neutralizing Antibodies in SARS-CoV-2 Variants

Application of Ha-CoV-2 Pseudovirus for Rapid Quantification of SARS-CoV-2 Variants and Neutralizing Antibodies

The coronavirus disease 2019 pandemic (COVID-19) has highlighted the need for rapid assays to accurately measure the infectivity of emerging SARS-CoV-2 variants and the effectiveness of vaccine-induced neutralizing antibodies against viral variants. These assays are essential for pandemic surveillance and validating vaccines and variant-specific boosters. This manuscript demonstrates the application of a novel hybrid alphavirus-SARS-CoV-2 pseudovirus (Ha-CoV-2) for quick quantification of SARS-CoV-2 variant infectivity and vaccine-induced neutralizing antibodies to viral variants. Ha-CoV-2 is a SARS-CoV-2 virus-like particle consisting of viral structural proteins (S, M, N, and E) and a fast-expressing RNA genome derived from an alphavirus, Semliki Forest Virus (SFV). Ha-CoV-2 also contains both green fluorescent protein (GFP) and luciferase reporter genes that allow for quick quantification of viral infectivity. As an example, the infectivity of the SARS-CoV-2 Delta (B.1.617.2) and the Omicron (B.1.1.529) variants are quantified, and their sensitivities to a neutralizing antibody (27VB) are also measured. These examples demonstrate the great potential of Ha-CoV-2 as a robust platform for rapid quantification of SARS-CoV-2 variants and their susceptibility to neutralizing antibodies.

Author Spotlight: A Pseudotype Virus System for Assessing Omicron Subvariants and Neutralizing Antibodies in SARS-CoV-2 Research

This protocol describes the application of a novel hybrid alphavirus-SARS-CoV-2 pseudovirus (Ha-CoV-2) as a platform for rapid quantification of infectivity of SARS-CoV-2 variants and their sensitivity to neutralizing antibodies.

The coronavirus disease 2019 pandemic (COVID-19) has highlighted the need for rapid assays to accurately measure the infectivity of emerging SARS-CoV-2 ...

Assessing Serum Neutralization Against SARS-CoV-2 with Pseudotyped Viruses

Pseudotyped Viruses As a Molecular Tool to Monitor Humoral Immune Responses Against SARS-CoV-2 Via Neutralization Assay

Pseudotyped viruses (PVs) are molecular tools that can be used to study host-virus interactions and to test the neutralizing ability of serum samples, in addition to their better-known use in gene therapy for the delivery of a gene of interest. PVs are replication defective because the viral genome is divided into different plasmids that are not incorporated into the PVs. This safe and versatile system allows the use of PVs in biosafety level 2 laboratories. Here, we present a general methodology to produce lentiviral PVs based on three plasmids as mentioned here: (1) the backbone plasmid carrying the reporter gene needed to monitor the infection; (2) the packaging plasmid carrying the genes for all the structural proteins needed to generate the PVs; (3) the envelope surface glycoprotein expression plasmid that determines virus tropism and mediates viral entry into the host cell. In this work, SARS-CoV-2 Spike is the envelope glycoprotein used for the production of non-replicative SARS-CoV-2 pseudotyped lentiviruses.
Briefly, packaging cells (HEK293T) were co-transfected with the three different plasmids using standard methods. After 48 h, the supernatant containing the PVs was harvested, filtered, and stored at -80 &#176;C. The infectivity of SARS-CoV-2 PVs was tested by studying the expression of the reporter gene (luciferase) in a target cell line 48 h after infection. The higher the value for relative luminescence units (RLUs), the higher the infection/transduction rate. Furthermore, the infectious PVs were added to the serially diluted serum samples to study the neutralization process of pseudoviruses' entry into target cells, measured as the reduction in RLU intensity: lower values corresponding to high neutralizing activity.

Author Spotlight: Studying Host-Virus Interactions with Pseudotyped Viruses 

Pseudotyped viruses (PVs) are replication-defective virions that are used to study host-virus interactions under safer conditions than handling authentic viruses. Presented here is a detailed protocol that shows how SARS-CoV-2 PVs can be used to test the neutralizing ability of patients' serum after COVID-19 vaccination.

Pseudotyped viruses (PVs) are molecular tools that can be used to study host-virus interactions and to test the neutralizing ability of serum samples, in ...

Analysis of SARS-CoV-2 Using Dual-Reporter and Multiplex Technology

Profiling of Surface Protein Epitopes on Viral Particles by Multiplex Dual-Reporter Strategy

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of viral particles to host cells, host-virus interactions, and disease pathogenesis. Furthermore, viral membrane proteins on virus particles and presented on host cell surfaces have proven to be excellent targets for antivirals and vaccines. Here, we describe a protocol to investigate surface proteins on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) particles using the dual-reporter flow cytometric system. The assay exploits multiplex technology to obtain a triple detection of viral particles by three independent affinity reactions. Magnetic beads conjugated to recombinant human angiotensin-converting enzyme-2 (ACE2) were used to capture viral particles from the supernatant of cells infected with SARS-CoV-2. Then, two detection reagents labeled with R-phycoerythrin (PE) or Brilliant Violet 421 (BV421) were applied simultaneously. As a proof-of-concept, antibody fragments targeting different epitopes of the SARS-CoV-2 surface protein Spike (S1) were used. The detection of viral particles by three independent affinity reactions provides strong specificity and confirms the capture of intact virus particles. Dose-dependency curves of SARS-CoV-2 infected cell supernatant were generated with replicate coefficient variances (mean/SD) &#706;14%. Good assay performance in both channels confirmed that two virus surface target protein epitopes are detectable in parallel. The protocol described here could be applied for (i) high-multiplex, high-throughput profiling of surface proteins expressed on enveloped viruses; ii) detection of active intact viral particles; and (iii) assessment of specificity and affinity of antibodies and antiviral drugs for surface epitopes of viral antigens.The application can be potentially extended to any type of extracellular vesicles and bioparticles, exposing surface antigens in body fluids or other liquid matrices.

Author Spotlight: Advancing Antiviral Strategies Through Novel Immunocapture and Mass Spectrometry Techniques

Here, we describe a newly developed multiplex fluorescent immunoassay that uses a dual-reporter flow cytometric system to concurrently detect two unique spike protein epitopes on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral particles that had been captured by angiotensin-converting enzyme-2-coupled magnetic microspheres.

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of ...

Quick and Early Detection of Rabies Antibodies to Evaluate the Immune Response in a Patient

Detection of Rabies IgG and IgM Antibodies Using the Rabies Indirect Fluorescent Antibody Test

The rabies indirect fluorescent antibody (IFA) test was developed to detect various rabies-specific antibody isotypes in sera or cerebral spinal fluid. This test provides rapid results and can be used to detect rabies antibodies in several different scenarios. The rabies IFA test is especially useful for the quick and early detection of antibodies to evaluate the immune response in a patient who has developed rabies. Although other methods for antemortem rabies diagnosis take precedence, this test may be utilized to demonstrate recent rabies virus exposure through antibody detection. The IFA test does not provide a virus-neutralizing antibody (VNA) titer, but the pre-exposure prophylaxis (PrEP) response can be evaluated through positive or negative antibody presence. This test can be utilized in various situations and can provide results for a number of different targets. In this study, we used several paired serum samples from individuals who received PrEP and demonstrated their rabies antibody presence over time using the IFA test.

Author Spotlight: Rabies-Specific Antibody Isotypes Detection in Sera or Cerebral Spinal Fluid Using an IFA Test 

The aim of this manuscript is to examine the use of the rabies indirect fluorescent antibody test for the detection of rabies-specific IgG and IgM antibodies.

The rabies indirect fluorescent antibody (IFA) test was developed to detect various rabies-specific antibody isotypes in sera or cerebral spinal fluid. ...

SARS-CoV-2 Pseudotype Virus Production and Serum Neutralization Assay

To begin, in a six-well plate, seed one milliliter of human embryonic kidney 293T cells. Add two milliliters of complete DMEM. The next day, replace the medium with fresh antibiotic-free medium to prepare the cells for transfection.To transfect the adherent cells, first, prepare mix A by adding plasmid DNA to 100 microliters of Opti-MEM. Next, add 17.5 microliters of polyethylenimine to 100 microliters of Opti-MEM. Mix the contents of the mix A and B, then incubate.During incubation, gently flick the tube every three to four minutes to enhance mixing. Add the whole volume of the mixture to the plate with the HEK 293T cells. After 16 to 20 hours of transfection, replace the culture medium with fresh complete DMEM.Incubate the plate at 37 degrees Celsius under 5%carbon dioxide to produce the pseudotype viruses. After 72 hours of transfection, harvest the supernatant into a collection tube. Centrifuge the supernatant at 1, 600 G for seven minutes at room temperature.Then filter the supernatant through a 0.45 micrometer cellulose acetate filter. Distribute 50 microliters of complete DMEM in the wells of a 96-well plate. Leave row A empty.Add 100 microliters of the pseudovirus stock to the wells in row A.Next, pipette 50 microliters of the solution from row A to B.Repeat this process up to row G to obtain serial dilutions. Remove the exhausted medium from a plate with cultured susceptible HEK 293T ACE2 cells, and wash the cells with four milliliters of DPBS. Then detach the cells with one milliliter of trypsin EDTA in DPBS saline.Now add 50 microliters of the susceptible cell suspension into each well containing the pseudotype viruses. Incubate the plate at 37 degrees Celsius under 5%carbon dioxide for 48 hours. Add 100 microliters of the luciferase reagent to each well.After incubation, transfer the contents of each well into a black 96-well plate. Then read the plate in a plate reader. In a 96-well plate, add 50 microliters of fresh complete DMEM to columns one to 10 from rows B to H.Add 95 microliters of fresh complete DMEM to the corresponding wells of row A.Now add 50 microliters of complete DMEM to the wells in column 11 and 100 microliters of DMEM to column 12.Pipette five microliters of heat-inactivated serum samples to row A.With a multi-channel pipette, mix the samples in the first row and transfer 50 microliters of medium-containing serum from row A to B up to row H.Distribute 50 microliters of dilute pseudovirus containing medium to each well from columns one to 11. Incubate the plate at 37 degrees Celsius under 5%carbon dioxide for one hour. Prepare a suspension of susceptible HEK293T ACE2 cells in five milliliters.Add 50 microliters of the cell suspension to each well, then incubate before performing the luciferase assay. Lower serum dilution resulted in decreased viral entry into the cells. This is confirmed by the increased percentage of neutralization.