KitV558&#916;/+ mice were genetically engineered and shared by Dr. Peter Besmer10. This work was supported by NIH grants R01 CA102613 and T32 CA251063.

All mice were housed under pathogen-free conditions at the University of Pennsylvania according to NIH guidelines and with approval of the University of Pennsylvania IACUC. Euthanasia was performed following the University of Pennsylvania Laboratory Animal Resources standard operating procedures.
1. KitV558&#916;/+ mouse breeding
<ol>
	<li>Backcross the KitV558&#916;/+ mice more than 10 times onto a C57BL/6J background using C57BL/6J mice. To do this, breed the male KitV558&#916;/+ mice&#160;with female C57BL/6J mice at a 1:2 ratio. 
	NOTE: The homozygous KitV558&#916;/V558&#916; genotype is lethal in utero. It is possible to breed female KitV558&#916;/+ mice with male C57BL/6J mice, but litter size is about half as that seen from female wildtype C57BL/6J mice. Furthermore, female KitV558&#916;/+ mice&#160;produce limited litters after 4 months of age.</li>
	<li>Genotype the pups at 7-14 days of age by toe clipping to confirm the presence of the KitV558&#916;/+ genotype. Use the forward primer: TCTCCTCCAGAAACCCATGTATGAA; reporter 1: CCTCGACAACCTTCCA; reverse primer: TTGCGTCGGGTCTATGTAAACAT; and reporter 2: TCTCCTCGACCTTCCA for genotyping.</li>
</ol>
2. KitV558&#916;/+ mouse treatment
<ol>
	<li>Age and sex match the KitV558&#916;/+ mice prior to treatment. Use the age- and sex-matched mice in cohorts as tumors from female KitV558&#916;/+ mice are larger than those in male mice. Treat the mice at 8-12 weeks old, at which time tumors are established (Figure 1).</li>
	<li>Give tyrosine kinase inhibitors orally or by intraperitoneal (i.p.) injection; KitV558&#916;/+ tumors are sensitive to tyrosine kinase inhibitors. Provide imatinib in a dose of 600 mg/L in drinking water or i.p. injections of 45 mg/kg twice daily. Measure tumor weight reduction using digital scales after dissection of tumor as shown in step 3, which is approximately 50% at 1 week and 80% at 4 weeks following treatment with imatinib (Figure 2).</li>
</ol>
3. KitV558&#916;/+ mouse organ harvest
<ol>
	<li>Euthanize mice by CO2 narcosis at a flow rate of 60% chamber volume per min. Leave mice in the chamber for at least 2 min after respiration has ceased, then perform cervical dislocation to confirm death.</li>
	<li>Sterilize all instruments, wear gloves throughout the procedure, and maintain a sterile field. Prepare the skin with 70% ethanol. Make a 2 cm midline vertical incision using scissors and enter the abdominal cavity. Sharply lyse any intra-abdominal adhesions.</li>
	<li>To remove the draining mesenteric lymph node, follow the steps described below.
	<ol>
		<li>Identify the cecum and lift its mesentery superiorly. Approximately midway to the base of the colonic mesentery, identify the mesenteric lymph node and sharply dissect it. The lymph node is off-white and about 0.5 cm x 0.5 cm in size.</li>
		<li>Divide lymph node tissue into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place lymph node tissue in 20 mL of serum free media (RPMI) and keep on ice.</li>
	</ol>
	</li>
	<li>For isolation of the GIST and cecum, follow the steps described below.
	<ol>
		<li>The cecum in KitV558&#916;/+ mice is mostly replaced by a GIST. Carefully divide the ileocolic junction from the base of the tumor. To collect the cecum, divide the colon again, 2 cm proximal to the base of the tumor.</li>
		<li>In 50%-60% of KitV558&#916;/+ mice, the head of the tumor contains a cap of cecal tissue, which typically contains serous fluid but may rarely contain pus (Figure 3). Sharply dissect the cap tissue away from the tumor tissue.</li>
		<li>Divide tumor tissue and/or cecum into thirds for protein isolation, histology, and single cell suspension, as needed. For single cell suspensions, place tumor tissue or cecum in HBSS with 2% FCS, enough to cover the sample and keep on ice.</li>
	</ol>
	</li>
</ol>
4. Western blot analysis of GIST tissue
<ol>
	<li>Prepare tissue lysis buffer containing 50 mM TrisHCl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 1% nondenaturing detergent, 2 mM Na3VO4, 1 mM PMSF, 10 mM NaF, and 20 &#956;l/ml proteinase inhibitor mixture.</li>
	<li>Prepare a 1x Tris-buffered saline solution with 1% Tween 20 (TBST) by combining 1800 mL of deionized water, 2 mL of Tween 20, and 200 mL of 10x Tris-buffered saline (TBS).</li>
	<li>Resuspend tissue from step 3.4.3 in a FACS tube in 5mL/g of tissue lysis buffer and homogenize twice with a mechanical homogenizer at 15,000 rpm for 15 s on ice. Incubate lysate for 30 min on ice.</li>
	<li>Transfer lysate to a 1.5 mL microcentrifuge tube. Centrifuge at max speed for 20 min at 4 &#176;C. Transfer supernatant into a new microcentrifuge tube.</li>
	<li>Run lysates on a 4% to 15% gradient gel, then transfer to a nitrocellulose membrane, as described in14.</li>
	<li>Wash membrane once in 1x TBS for 5 min and then block membrane in 5% milk for 1 h. Again, wash membrane once in 1x TBS for 10 min.</li>
	<li>Incubate membrane in primary antibody diluted 1:1000 in 5% BSA at 4 &#176;C overnight. Wash membrane 3x in 1x TBST for 10 min each. Incubate blot with secondary antibody diluted 1:2500 in 2.5% milk for 1 h at room temperature.</li>
	<li>Wash membrane once in 1x TBS for 5 min. Add enough HRP substrate to cover membrane, typically 200-500 &#956;L, and use a digital imager to detect and quantify chemiluminescence.</li>
</ol>
5. Immunohistochemistry of GIST tissue
<ol>
	<li>Fix tissue from step 3.3.2 or 3.4.3 in 4% paraformaldehyde at 4 &#176;C overnight. Store tissue in 70% EtOH until ready for processing. Embed and section blocks at 5 &#956;m thickness onto glass slides, as described15,16.</li>
	<li>Complete immunohistochemical detection using a basic immunodetection kit, as previously described17.</li>
</ol>
6. Single cell suspension of mesenteric lymph node
<ol>
	<li>Pour RPMI media with lymph node specimen from step 3.3.2 over a 100 &#956;m filter. Move filter to new 50 mL conical and mash lymph node with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of RPMI media.</li>
	<li>Centrifuge the filtrate at 450 x g at 4 &#176;C for 5 min. Aspirate the supernatant.&#160;</li>
	<li>Resuspend pellet in 20 mL of 1% FBS in PBS (bead buffer) and pour over a 40 &#956;m filter. Collect the cell filtrate. Count cells using a hemocytometer.</li>
	<li>Centrifuge the filtrate at 450 x g at 4 &#176;C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>
7. Single cell suspension of GIST
<ol>
	<li>Prepare collagenase buffer by adding 250 mg of collagenase IV, one tablet of EDTA-free protease inhibitor and 100 &#181;L of DNase I to 50 mL of HBSS. Rotate for 10 min at room temperature until dissolved.</li>
	<li>Place GIST in a sterile dish and add 2.5 mL of collagenase buffer. Mince tumor using a sterile scalpel and scissors until the tumor is in fine fragments. Use a large bore pipette to aspirate the tumor and collagenase into a 50 mL tube.</li>
	<li>Incubate in a shaking incubator at 100 rpm at 37 &#176;C for 30 min. Quench reaction with 2 mL of FBS.</li>
	<li>Pour collagenase with GIST specimen over a 100 &#956;m filter and mash tumor with the soft end of a 3 mL plastic syringe and collect in a 50 mL tube. Wash filter with 20 mL of HBSS. Centrifuge the filtrate at 450 x g, 4 &#176;C for 5 min. Aspirate the supernatant.</li>
	<li>Resuspend the pellet in 20 mL of bead buffer and pour over a 40 &#956;m filter. Collect the filtrate and count cells using a hemocytometer. Centrifuge the filtrate at 450 x g, 4 &#176;C for 5 min. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>
8. Single cell suspension of cecum
<ol>
	<li>Prepare collagenase buffer as in step 7.1. Using scissors, split the cecum longitudinally to expose the inner mucosa. Cut into 0.5 cm sections and place in a 50 mL tube with 5 mL of HBSS with 2% FBS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant.</li>
	<li>Add 5 mL of HBSS with 2 mM EDTA. Incubate in a shaking incubator at 37 &#176;C at 100 rpm for 15 min. Centrifuge at 450 x g for 20 s. Aspirate the supernatant.</li>
	<li>Add 5 mL of HBSS. Shake vigorously for 30 s, centrifuge at 450 x g for 20 s, then aspirate the supernatant. Repeat once more.</li>
	<li>Add 5 mL of collagenase buffer. Incubate in a shaking incubator at 37 &#176;C for 30 min at 100 rpm. Shake vigorously every 10 min. Quench reaction with 2 mL of FBS.</li>
	<li>Pour collagenase with cecum specimen over a 100 &#956;m filter and mash with the soft end of a 3 mL plastic syringe. Wash filter with 20 mL of HBSS. Collect filtrate.</li>
	<li>Centrifuge the filtrate at 450 x g&#160;for 5 min at 4 &#176;C. Aspirate the supernatant. Resuspend pellet in 20 mL of bead buffer and pour over a 40 &#956;m filter. Collect filtrate and count cells using a hemocytometer.</li>
	<li>Centrifuge the filtrate at 450 x g&#160;for 5 min at 4 &#176;C. Aspirate the supernatant. Resuspend in bead buffer at 6 x 107 cells/mL for flow cytometry.</li>
</ol>

<ol>
	<li>Mastrangelo, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incidence+of+soft+tissue+sarcoma+and+beyond:+a+population-based+prospective+study+in+3+European+regions.">Incidence of soft tissue sarcoma and beyond: a population-based prospective study in 3 European regions.</a> Cancer. 118 (21), 5339-5348 (2012).</li><li>Joensuu, H., DeMatteo, R. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+management+of+gastrointestinal+stromal+tumors:+a+model+for+targeted+and+multidisciplinary+therapy+of+malignancy.">The management of gastrointestinal stromal tumors: a model for targeted and multidisciplinary therapy of malignancy.</a> Annual Review of Medicine. 63, 247-258 (2012).</li><li>Blanke, C. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+results+from+a+randomized+phase+II+trial+of+standard-+versus+higher-dose+imatinib+mesylate+for+patients+with+unresectable+or+metastatic+gastrointestinal+stromal+tumors+expressing+KIT.">Long-term results from a randomized phase II trial of standard- versus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT.</a> Journal of Clinical Oncology. 26 (4), 620-625 (2008).</li><li>Demetri, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+and+safety+of+regorafenib+for+advanced+gastrointestinal+stromal+tumours+after+failure+of+imatinib+and+sunitinib+(GRID):+an+international,+multicentre,+randomised,+placebo-controlled,+phase+3+trial.">Efficacy and safety of regorafenib for advanced gastrointestinal stromal tumours after failure of imatinib and sunitinib (GRID): an international, multicentre, randomised, placebo-controlled, phase 3 trial.</a> Lancet. 381 (9863), 295-302 (2013).</li><li>Gold, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outcome+of+metastatic+GIST+in+the+era+before+tyrosine+kinase+inhibitors.">Outcome of metastatic GIST in the era before tyrosine kinase inhibitors.</a> Annals of Surgical Oncology. 14 (1), 134-142 (2007).</li><li>Huynh, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sorafenib+induces+growth+suppression+in+mouse+models+of+gastrointestinal+stromal+tumor.">Sorafenib induces growth suppression in mouse models of gastrointestinal stromal tumor.</a> Molecular Cancer Therapeutics. 8 (1), 152-159 (2009).</li><li>Na, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+patient-derived+xenografts+from+patients+with+gastrointestinal+stromal+tumors:+analysis+of+clinicopathological+characteristics+related+to+engraftment+success.">Establishment of patient-derived xenografts from patients with gastrointestinal stromal tumors: analysis of clinicopathological characteristics related to engraftment success.</a> Scientific Reports. 10 (1), 7996 (2020).</li><li>Balachandran, V. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imatinib+potentiates+antitumor+T+cell+responses+in+gastrointestinal+stromal+tumor+through+the+inhibition+of+Ido.">Imatinib potentiates antitumor T cell responses in gastrointestinal stromal tumor through the inhibition of Ido.</a> Nature Medicine. 17 (9), 1094-1100 (2011).</li><li>Vitiello, G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+immune+profiles+distinguish+the+mutational+subtypes+of+gastrointestinal+stromal+tumor.">Differential immune profiles distinguish the mutational subtypes of gastrointestinal stromal tumor.</a> Journal of Clinical Investigation. 129 (5), 1863-1877 (2019).</li><li>Sommer, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrointestinal+stromal+tumors+in+a+mouse+model+by+targeted+mutation+of+the+Kit+receptor+tyrosine+kinase.">Gastrointestinal stromal tumors in a mouse model by targeted mutation of the Kit receptor tyrosine kinase.</a> Proceedings of the National Academy of Sciences of the United States of America. 100 (11), 6706-6711 (2003).</li><li>Cavnar, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KIT+oncogene+inhibition+drives+intratumoral+macrophage+M2+polarization.">KIT oncogene inhibition drives intratumoral macrophage M2 polarization.</a> Journal of Experimental Medicine. 210 (13), 2873-2886 (2013).</li><li>Medina, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+kinase+inhibition+limits+Batf3-dependent+dendritic+cell+development+and+antitumor+immunity.">Oncogenic kinase inhibition limits Batf3-dependent dendritic cell development and antitumor immunity.</a> Journal of Experimental Medicine. 216 (6), 1359-1376 (2019).</li><li>Zhang, J. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Macrophages+and+CD8(+)+T+cells+mediate+the+antitumor+efficacy+of+combined+CD40+ligation+and+imatinib+therapy+in+gastrointestinal+stromal+tumors.">Macrophages and CD8(+) T cells mediate the antitumor efficacy of combined CD40 ligation and imatinib therapy in gastrointestinal stromal tumors.</a> Cancer Immunology Research. 6 (4), 434-447 (2018).</li><li>. General Protocol for Western Blotting Available from: <a target="_blank" href="https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Buttetin_6376.pdf">https://www.bio-rad.com/webroot/web/pdf/lsr/literature/Buttetin_6376.pdf</a> (2022)</li><li>Sadeghipour, A., Babaheidarian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+formalin-fixed,+paraffin+embedded+blocks.">Making formalin-fixed, paraffin embedded blocks.</a> Biobanking: Methods and Protocols. , 253-268 (2019).</li><li>Sy, J., Ang, L. -. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microtomy:+Cutting+formalin-fixed,+paraffin-embedded+sections.">Microtomy: Cutting formalin-fixed, paraffin-embedded sections.</a> Biobanking: Methods and Protocols. , 269-278 (2019).</li><li>Seifert, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PD-1/PD-L1+blockade+enhances+T-cell+activity+and+antitumor+efficacy+of+imatinib+in+gastrointestinal+stromal+tumors.">PD-1/PD-L1 blockade enhances T-cell activity and antitumor efficacy of imatinib in gastrointestinal stromal tumors.</a> Clinical Cancer Research. 23 (2), 454-465 (2017).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+KIT+modulates+Type+I+IFN-mediated+antitumor+immunity+in+GIST.">Oncogenic KIT modulates Type I IFN-mediated antitumor immunity in GIST.</a> Cancer Immunology Research. 9 (5), 542-553 (2021).</li><li>Rossi, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncogenic+Kit+signaling+and+therapeutic+intervention+in+a+mouse+model+of+gastrointestinal+stromal+tumor.">Oncogenic Kit signaling and therapeutic intervention in a mouse model of gastrointestinal stromal tumor.</a> Proceedings of the National Academy of Sciences of the United States of America. 103 (34), 12843-12848 (2006).</li></ol>

The authors have no conflicts of interest to disclose.

The KitV558&#916;/+&#160;mouse model is a powerful research tool in the molecular and immunologic analysis of GIST. Although the breeding strategy requires a single cross, using KitV558&#916;/+ mouse cohorts in experiments analyzing tumor response requires extensive breeding. Mice should be age- and sex-matched to ensure similar tumor weights, and 10% of mice die before 8 weeks of age when tumors are established. Less extensive breeding strategies are possible if using advanced ima...

GIST is the most common sarcoma in humans with an incidence of about 6,000 cases in the United States of America1. GIST appears to originate from the gastrointestinal pacemaker cells named the interstitial cells of Cajal, and is typically driven by a single mutation in the tyrosine kinase KIT or PDGFRA2. Surgery is the mainstay of treatment for GIST and can be curative, but patients with advanced disease may be treated with the tyrosine kinase inhibitor (TKI), imatinib. Since its introduction over 20 years ago, imatinib has transformed the treatment paradigm in GIST, improving the survival in advanced disease from 1 to over 5 years3,4,5. Unfortunately, imatinib is rarely curative due to acquired KIT mutations, so new treatments are needed for this tumor.
Mouse models are an important research tool in the investigation of novel therapies in cancer. Multiple subcutaneous xenograft and patient-derived xenograft models have been developed and investigated in GIST6,7. However, immunodeficient mice do not fully represent human GIST since GISTs harbor differential immune profiles depending on their oncogenic mutation, and altering the gastrointestinal tumor microenvironment improves upon the effects of TKI therapy8,9. The KitV558&#916;/+&#160;mouse has a heterozygous germline deletion in Kit exon 11, which encodes the juxtamembrane domain, the most commonly mutated site in human GIST10. KitV558&#916;/+&#160;mice develop a single cecal GIST with 100% penetrance, and tumors have similar histology, molecular signaling, immune infiltration, and response to therapy as human GIST8,11,12,13. Here, we describe breeding, treatment, and specimen isolation and processing in KitV558&#916;/+&#160;mice for use in molecular and immunologic research in GIST.

<table><tbody><tr><td>100 micron filter</td><td>EMSCO</td><td>1194-2360</td><td></td></tr><tr><td>1x RBC lysis buffer</td><td>Life Technologies</td><td>00-4333-57</td><td></td></tr><tr><td>3mL syringe</td><td>Thermo Fisher Scientific/BD Biosciences</td><td>14823435</td><td></td></tr><tr><td>4&amp;ndash;15% Mini-PROTEAN TGX Precast Protein Gels, 10-well, 30 &amp;micro;l</td><td>Bio-Rad</td><td>4561083</td><td></td></tr><tr><td>4% Paraformaldehyde Solution</td><td>Thermo Fisher Scientific</td><td>AAJ19943K2</td><td></td></tr><tr><td>40 micron filter</td><td>EMSCO</td><td>1194-2340</td><td></td></tr><tr><td>5M NaCl</td><td>Sigma Aldrich</td><td>S6546</td><td></td></tr><tr><td>70 micron filter</td><td>EMSCO</td><td>1194-2350</td><td></td></tr><tr><td>AKT antibody (C67E7)</td><td>Cell Signaling</td><td>4691</td><td></td></tr><tr><td>C57BL/6J mice</td><td>The Jackson Laboratory</td><td></td><td></td></tr><tr><td>Collagenase IV</td><td>Sigma Aldrich</td><td>C5138</td><td></td></tr><tr><td>Complete mini edta free protease inhibitor</td><td>Thomas Scientific</td><td>C852A34</td><td></td></tr><tr><td>Countess II Automated Cell Counter</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>Disposable Scalpels</td><td>Thermo Fisher Scientific/Exel International</td><td>14-840-00</td><td></td></tr><tr><td>Dnase I</td><td>Thomas Scientific</td><td>C756V81</td><td></td></tr><tr><td>Dog1 antibody</td><td>abcam</td><td>ab64085</td><td></td></tr><tr><td>EDTA</td><td>Sigma Aldrich</td><td>E9884</td><td></td></tr><tr><td>ERK antibody (p44/42)</td><td>Cell Signaling</td><td>9102</td><td></td></tr><tr><td>FBS</td><td>Thomas Scientific</td><td>C788U23</td><td></td></tr><tr><td>FIJI software</td><td>FIJI</td><td></td><td>https://imagej.net/software/fiji</td></tr><tr><td>Fisherbrand 850 Homogenizer</td><td>Thermo Fisher Scientific</td><td>15-340-169</td><td></td></tr><tr><td>HBSS</td><td>University of Pennsylvania Cell Center</td><td></td><td></td></tr><tr><td>Imatinib mesylate</td><td>Selleck Chemicals</td><td>S1026</td><td></td></tr><tr><td>KIT antibody (D13A2)</td><td>Cell Signaling</td><td>3074</td><td></td></tr><tr><td>KitV558&amp;Delta;/+ Genotyping</td><td>Transnetyx</td><td></td><td></td></tr><tr><td>Microcentrifuge tubes (1.5mL)</td><td>Thermo Fisher Scientific</td><td>05-408-129</td><td></td></tr><tr><td>Mouse on Mouse Immunodetection Kit, Basic</td><td>Vector Laboratories</td><td>BMK-2202</td><td></td></tr><tr><td>Nitrocellulose Membrane, Precut, 0.45 &amp;micro;m</td><td>Rio-Rad</td><td>1620145</td><td></td></tr><tr><td>Nonfat Dry Milk</td><td>Thermo Fisher Scientific</td><td>NC9121673</td><td></td></tr><tr><td>Nonidet P 40 Substitute</td><td>Sigma Aldrich</td><td>74385</td><td></td></tr><tr><td>p-AKT antibody (S473)</td><td>Cell Signaling</td><td>4060</td><td></td></tr><tr><td>p-ERK antibody (p44/42)</td><td>Cell Signaling</td><td>9101</td><td></td></tr><tr><td>p-KIT antibody (Y719)</td><td>Cell Signaling</td><td>3391</td><td></td></tr><tr><td>PMSF Protease Inhibitor</td><td>Thermo Fisher Scientific</td><td>36978</td><td></td></tr><tr><td>Proeinase K</td><td>Thermo Fisher Scientific</td><td>BP170050</td><td></td></tr><tr><td>Round-Bottom Polystyrene Test (FACS) Tubes</td><td>Falcon/Thermo Fisher Scientific</td><td>14-959-2A</td><td></td></tr><tr><td>RPMI</td><td>University of Pennsylvania Cell Center</td><td></td><td></td></tr><tr><td>Sodium fluoride (NaF)</td><td>Sigma Aldrich</td><td>201154</td><td></td></tr><tr><td>Sodium orthovanadate (Na3VO4)</td><td>Sigma Aldrich</td><td>S6508</td><td></td></tr><tr><td>SuperSignal West Dura Extended Duration Substrate</td><td>Thermo Fisher Scientific</td><td>34076</td><td></td></tr><tr><td>TBS buffer (10x)</td><td>University of Pennsylvania Cell Center</td><td></td><td></td></tr><tr><td>Tissue culture dish (100mm2)</td><td>Thermo Fisher Scientific/Falcon</td><td>08-772E</td><td></td></tr><tr><td>TrisHCL</td><td>Thermo Fisher Scientific</td><td>BP1757500</td><td></td></tr><tr><td>Tween 20</td><td>Rio-Rad</td><td>1706531</td><td></td></tr><tr><td>&amp;nbsp;vivaCT 80 platform</td><td>Scanco medical</td><td></td><td></td></tr></tbody></table>

molecular and immunologic techniques in a genetically engineered mouse model of gastrointestinal stromal tumor

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor types, numerous mouse models have been developed in order to investigate the next generation of cancer therapies. However, in GIST, most in vivo studies use xenograft mouse models which have inherent limitations. Here, we describe an immunocompetent, genetically engineered mouse model of gastrointestinal stromal tumor harboring a KitV558&#916;/+ mutation. In this model, mutant KIT, the oncogene responsible for most GISTs, is driven by its endogenous promoter leading to a GIST which mimics the histological appearance and immune infiltrate seen in human GISTs. Furthermore, this model has been used successfully to investigate both targeted molecular and immune therapies. Here, we describe the breeding and maintenance of a KitV558&#916;/+ mouse colony. Additionally, this paper details the treatment and procurement of GIST, draining mesenteric lymph node, and adjacent cecum in KitV558&#916;/+ mice, as well as sample preparation for molecular and immunologic analyses.

The KitV558&#916;/+ mouse model allows for the investigation of therapeutics in an immunocompetent mouse model. KitV558&#916;/+ mice have an average lifespan of 8 months due to progressive bowel obstruction (Figure 4). Tumors from KitV558&#916;/+ mice express canonical markers of GIST including the tyrosine kinase KIT and the transmembrane channel DOG1 (Figure 5...

Watch this Scientific Journal Video about Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor at JoVE.com

Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

The goal of this manuscript is to describe the KitV558&#916;/+&#160;mouse model and techniques for successful dissection and processing of mouse specimens.

Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and is typically driven by a single mutation in the KIT receptor. Across tumor ...

molecular-immunologic-techniques-genetically-engineered-mouse-model

Research

JoVE Journal

Cancer Research

2.0K Views.  Hospital of the University of Pennsylvania. The goal of this manuscript is to describe the KitV558Δ/+ mouse model and techniques for successful dissection and processing of mouse specimens.

Video: Molecular and Immunologic Techniques in a Genetically Engineered Mouse Model of Gastrointestinal Stromal Tumor

A Murine Orthotopic Bladder Tumor Model and Tumor Detection System

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified to secrete human Prostate Specific Antigen (PSA), and the procedure for the confirmation of tumor implantation. In brief, mice are anesthetized using injectable drugs and are made to lay in the dorsal position. Urine is vacated from the bladder and 50 &#181;L of poly-L-lysine (PLL) is slowly instilled at a rate of 10 &#181;L/20 s using a 24 G IV catheter. It is left in the bladder for 20 min by stoppering the catheter. The catheter is removed and PLL is vacated by gentle pressure on the bladder. This is followed by instillation of the murine bladder cancer cell line (1 x 105 cells/50 &#181;L) at a rate of 10 &#181;L/20 s. The catheter is stoppered to prevent premature evacuation. After 1 h, the mice are revived with a reversal drug, and the bladder is vacated. The slow instillation rate is important, as it reduces vesico-ureteral reflux, which can cause tumors to occur in the upper urinary tract and in the kidneys. The cell line should be well re-suspended to reduce clumping of cells, as this can lead to uneven tumor sizes after implantation.
This technique induces tumors with high efficiency. Tumor growth is monitored by urinary PSA secretion. PSA marker monitoring is more reliable than ultrasound or fluorescence imaging for the detection of the presence of tumors in the bladder. Tumors in mice generally reach a maximum size that negatively impacts health by about 3 - 4 weeks if left untreated. By monitoring tumor growth, it is possible to differentiate mice that were cured from those that were not successfully implanted with tumors. With only end-point analysis, the latter may be mistakenly assumed to have been cured by therapy.

This protocol describes the generation of murine orthotopic bladder tumors in female C57BL/6J mice and the monitoring of tumor growth.

This protocol describes the generation of bladder tumors in female C57BL/6J mice using the murine bladder cancer cell line MB49, which has been modified ...

Isolation of Circulating Tumor Cells in an Orthotopic Mouse Model of Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, subcutaneous mouse models have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Orthotopic mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in hollow organs such as the large bowel. In order to produce uniform tumors which reliably grow and metastasize, standardized techniques of tumor cell preparation and injection are critical. 
We have developed an orthotopic mouse model of colorectal cancer (CRC) which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor cells from either primary tumors, 2-dimensional (2D) cell lines or 3-dimensional (3D) organoids are injected into the cecum and, depending on the metastatic potential of the injected tumor cells, form highly metastatic tumors. In addition, CTCs can be found regularly. We here describe the technique of tumor cell preparation from both 2D cell lines and 3D organoids as well as primary tumor tissue, the surgical and injection techniques as well as the isolation of CTCs from the tumor-bearing mice, and present tips for troubleshooting.

We describe the establishment of orthotopic colorectal tumors via injection of tumor cells or organoids into the cecum of mice and the subsequent isolation of circulating tumor cells (CTCs) from this model.

Despite the advantages of easy applicability and cost-effectiveness, subcutaneous mouse models have severe limitations and do not accurately simulate ...

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired.
As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

A protocol for the establishment of a genetically engineered mouse model of colorectal cancer by segmental adeno-cre infection and its surveillance via high-resolution colonoscopy is presented.

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations ...

High-sensitivity Detection of Micrometastases Generated by GFP Lentivirus-transduced Organoids Cultured from a Patient-derived Colon Tumor

Despite current advances in human colorectal cancer (CRC) treatment, few radical therapies are effective for the late stages of CRC. To overcome this clinical challenge, tumor xenograft mouse models using long-established human carcinoma cell lines and many transgenic mouse models with tumors have been developed as preclinical models. They partially mimic the features of human carcinomas, but often fail to recapitulate the key aspects of human malignancies including invasion and metastasis. Thus, alternative models that better represent the malignant progression in human CRC have long been awaited.
We herein show generation of patient-derived tumor xenografts (PDXs) by subcutaneous implantation of small CRC fragments surgically dissected from a patient. The colon PDXs develop and histopathologically resemble the CRC in the patient. However, few spontaneous micrometastases are detectable in conventional cross-sections of affected distant organs in the PDX model. To facilitate the detection of metastatic dissemination into distant organs, we extracted the tumor organoid cells from the colon PDXs in culture and infected them with GFP lentivirus prior to injection into highly immunodeficient NOD/Shi-scid IL2R&#947;null (NOG) mice. Orthotopically injected PDX-derived CRC organoid cells consistently form primary tumors positive for GFP in recipient mice. Moreover, spontaneously developing micrometastatic colonies expressing GFP are notably detected in the lungs of these mice by fluorescence microscopy. Moreover, intrasplenic injection of CRC organoids frequently produces hepatic colonization. Taken together, these findings indicate GFP-labelled PDX-derived CRC organoid cells to be visually detectable during a multistep process termed the invasion-metastasis cascade. The described protocols include the establishment of PDXs of human CRC and 3D culture of the corresponding CRC organoid cells transduced by GFP lentiviral particles.

To allow highly sensitive detection of the disseminating human colorectal cancer (CRC) cells colonizing tissues, we herein show a protocol for efficient transduction of green fluorescent protein (GFP) lentiviral particles into PDX-derived CRC organoid cells prior to their injection into recipient mice, with stereo-fluorescence microscopic observation.

Despite current advances in human colorectal cancer (CRC) treatment, few radical therapies are effective for the late stages of CRC. To overcome this ...

A Robust Discovery Platform for the Identification of Novel Mediators of Melanoma Metastasis

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was established using robust, reproducible in vivo models and standardized methods to identify novel players in melanoma metastasis. This approach allows for data inference at specific experimental stages to precisely characterize a gene's role in metastasis. Models are established by introducing genetically modified melanoma cells via intracardiac, intradermal, or subcutaneous injections into mice, followed by monitoring with serial in vivo imaging. Once preestablished endpoints are reached, primary tumors and/or metastases-bearing organs are harvested and processed for various analyses. Tumor cells can be sorted and subjected to any of several 'omics' platforms, including single-cell RNA sequencing. Organs undergo imaging and immunohistopathological analyses to quantify the overall burden of metastases and map their specific anatomic location. This optimized pipeline, including standardized protocols for engraftment, monitoring, tissue harvesting, processing, and analysis, can be adopted for patient-derived, short-term cultures and established human and murine cell lines of various solid cancer types.

This article describes a workflow of techniques employed for testing novel candidate mediators of melanoma metastasis and their mechanism(s) of action.

Metastasis is a complex process, requiring cells to overcome barriers that are only incompletely modeled by in vitro assays. A systematic workflow was ...

In Vivo Brain Tumor Modeling via Electroporation-Based Delivery of Plasmid DNA

Modeling Brain Tumors In Vivo Using Electroporation-Based Delivery of Plasmid DNA Representing Patient Mutation Signatures

Tumor models are critical for the preclinical testing of brain tumors in terms of exploring new, more efficacious treatments. With significant interest in immunotherapy, it is even more critical to have a consistent, clinically pertinent, immunocompetent mouse model to examine the tumor and immune cell populations in the brain and their response to treatment. While most preclinical models utilize orthotopic transplantation of established tumor cell lines, the modeling system presented here allows for a "personalized" representation of patient-specific tumor mutations in a gradual, yet effective development from DNA constructs inserted into dividing neural precursor cells (NPCs) in vivo. DNA constructs feature the mosaic analysis with the dual-recombinase-mediated cassette exchange (MADR) method, allowing for single-copy, somatic mutagenesis of driver mutations. Using newborn mouse pups between birth and 3 days old, NPCs are targeted by taking advantage of these dividing cells lining the lateral ventricles. Microinjection of DNA plasmids (e.g., MADR-derived, transposons, CRISPR-directed sgRNA) into the ventricles is followed by electroporation using paddles that surround the rostral region of the head. Upon electrical stimulation, the DNA is taken up into the dividing cells, with the potential of integrating into the genome. The use of this method has successfully been demonstrated in developing both pediatric and adult brain tumors, including the most common malignant brain tumor, glioblastoma. This article discusses and demonstrates the different steps of developing a brain tumor model using this technique, including the procedure of anesthetizing young mouse pups, to microinjection of the plasmid mix, followed by electroporation. With this autochthonous, immunocompetent mouse model, researchers will have the ability to expand preclinical modeling approaches, in efforts to improve and examine efficacious cancer treatment.

Author Spotlight: Modeling Brain Tumors In Vivo Using Electroporation-Based Delivery of Plasmid DNA Representing Patient Mutation Signatures  

Utilizing an immunocompetent, autochthonous tumor model driven by common patient mutations for preclinical testing is critical for immunotherapeutic testing. This protocol describes a method to generate brain tumor mouse models using electroporation-based delivery of plasmid DNA that represent common patient mutations, thus providing an accurate, reproducible, and consistent mouse model.

Tumor models are critical for the preclinical testing of brain tumors in terms of exploring new, more efficacious treatments. With significant interest in ...

Guided Tumor Inoculation and Multimodal Imaging in Mice

A Dorsal Skinfold Window Chamber Tumor Mouse Model for Combined Intravital Microscopy and Magnetic Resonance Imaging in Translational Cancer Research

Preclinical intravital imaging such as microscopy and optical coherence tomography have proven to be valuable tools in cancer research for visualizing the tumor microenvironment and its response to therapy. These imaging modalities have micron-scale resolution but have limited use in the clinic due to their shallow penetration depth into tissue. More clinically applicable imaging modalities such as CT, MRI, and PET have much greater penetration depth but have comparatively lower spatial resolution (mm scale). 
To translate preclinical intravital imaging findings into the clinic, new methods must be developed to bridge this micro-to-macro resolution gap. Here we describe a dorsal skinfold window chamber tumor mouse model designed to enable preclinical intravital and clinically applicable (CT and MR) imaging in the same animal, and the image analysis platform that links these two disparate visualization methods. Importantly, the described window chamber approach enables the different imaging modalities to be co-registered in 3D using fiducial markers on the window chamber for direct spatial concordance. This model can be used for validation of existing clinical imaging methods, as well as for the development of new ones through direct correlation with "ground truth" high-resolution intravital findings. 
Finally, the tumor response to various treatments-chemotherapy, radiotherapy, photodynamic therapy-can be monitored longitudinally with this methodology using preclinical and clinically applicable imaging modalities. The dorsal skinfold window chamber tumor mouse model and imaging platforms described here can thus be used in a variety of cancer research studies, for example, in translating preclinical intravital microscopy findings to more clinically applicable imaging modalities such as CT or MRI.

Author Spotlight: Integrating High-Resolution Intravital Imaging and MRI to Enhance Stereotactic Body Radiation Therapy Planning

Translation of Intravital microscopy findings is challenged by its shallow depth penetration into tissue. Here we describe a dorsal window chamber mouse model that enables co-registration of intravital microscopy and clinically applicable imaging modalities (e.g., CT, MRI) for direct spatial correlation, potentially streamlining clinical translation of intravital microscopy findings.

Preclinical intravital imaging such as microscopy and optical coherence tomography have proven to be valuable tools in cancer research for visualizing the ...

Pathology Assessment of PN-MPNST Progression in the P0-GGFβ3 Mouse Model

Identifying, Diagnosing, and Grading Malignant Peripheral Nerve Sheath Tumors in Genetically Engineered Mouse Models

Patients with the autosomal dominant tumor susceptibility syndrome neurofibromatosis type 1 (NF1) commonly develop plexiform neurofibromas (PNs) that subsequently transform into highly aggressive malignant peripheral nerve sheath tumors (MPNSTs). Understanding the process by which a PN transforms into an MPNST would be facilitated by the availability of genetically engineered mouse (GEM) models that accurately replicate the PN-MPNST progression seen in humans with NF1. Unfortunately, GEM models with Nf1 ablation do not fully recapitulate this process. This led us to develop P0-GGF&#946;3 mice, a GEM model in which overexpression of the Schwann cell mitogen neuregulin-1 (NRG1) in Schwann cells results in the development of PNs that progress to become MPNSTs with high frequency. However, to determine whether tumorigenesis and neoplastic progression in P0-GGF&#946;3 mice accurately model the processes seen in NF1 patients, we had to first prove that the pathology of P0-GGF&#946;3 peripheral nerve sheath tumors recapitulates the pathology of their human counterparts.
Here, we describe the specialized methodologies used to accurately diagnose and grade peripheral nervous system neoplasms in GEM models, using P0-GGF&#946;3 and P0-GGF&#946;3;Trp53+/- mice as an example. We describe the histologic, immunohistochemical, and histochemical methods used to diagnose PNs and MPNSTs, how to distinguish these neoplasms from other tumor types that mimic their pathology, and how to grade these neoplasms. We discuss the establishment of early-passage cultures from GEM MPNSTs, how to characterize these cultures using immunocytochemistry, and how to verify their tumorigenicity by establishing allografts. Collectively, these techniques characterize the pathology of PNs and MPNSTs that arise in GEM models and critically compare the pathology of these murine tumors to their human counterparts.

Author Spotlight: Genetically Engineered Mouse Models and Pathological Characterization of Neurofibromatosis Type 1 Associated Tumors

We have developed a methodology for assessing whether nervous system neoplasms in genetically engineered mice accurately recapitulate the pathology of their human counterparts. Here, we apply these histologic techniques, defined pathologic criteria, and culture methodologies to neurofibromas and malignant peripheral nerve sheath tumors arising in the P0-GGF&#946;3 mouse model.

Patients with the autosomal dominant tumor susceptibility syndrome neurofibromatosis type 1 (NF1) commonly develop plexiform neurofibromas (PNs) that ...

Studying the Role of Alveolar Macrophages in Breast Cancer Metastasis

This paper describes the application of the syngeneic model of breast cancer (4T1) to the studies on a role of pulmonary alveolar macrophages in cancer metastasis. The 4T1 cells expressing GFP in combination with imaging and confocal microscopy are used to monitor tumor growth, track metastasizing tumor cells, and quantify the metastatic burden. These approaches are supplemented by digital histopathology that allows the automated and unbiased quantification of metastases. In this method the routinely prepared histological lung sections, which are stained with hematoxylin and eosin, are scanned and converted to the digital slides that are then analyzed by the self-trained pattern recognition software. In addition, we describe the flow cytometry approaches with the use of multiple cell surface markers to identify alveolar macrophages in the lungs. To determine impact of alveolar macrophages on metastases and antitumor immunity these cells are depleted with the clodronate-containing liposomes administrated intranasally to tumor-bearing mice. This approach leads to the specific and efficient depletion of this cell population as confirmed by flow cytometry. Tumor volumes and lung metastases are evaluated in mice depleted of alveolar macrophages, to determine the role of these cells in the metastatic progression of breast cancer.

Here we describe the model and approach to study functions of pulmonary alveolar macrophages in cancer metastasis. To demonstrate the role of these cells in metastasis, the syngeneic (4T1) model of breast cancer in conjunction with the depletion of alveolar macrophage with clodronate liposomes was used.

This paper describes the application of the syngeneic model of breast cancer (4T1) to the studies on a role of pulmonary alveolar macrophages in cancer ...

Medicine

Intravital Microscopy of Tumor-associated Vasculature Using Advanced Dorsal Skinfold Window Chambers on Transgenic Fluorescent Mice

Tumor and tumor vessel development, as well as tumor response to therapeutics, are highly dynamic biological processes. Histology provides static information and is often not sufficient for a correct interpretation. Intravital evaluation, in which a process is followed in time, provides extra and often unexpected information. With the creation of transgenic animals expressing cell-specific markers and live cell tracers, improvements to imaging equipment, and the development of several imaging chambers, intravital microscopy has become an important tool to better understand biological processes. This paper describes an experimental design for the investigation of tumor vessel development and of therapeutic effects in a spatial and temporal manner. Using this setup, the stage of vessel development, tip cell and lumen formation, blood flow, extravasation, an established vascular bed, and vascular destruction can be visualized and followed. Furthermore, therapeutic effects, intratumoral fate, and the localization of chemotherapeutic compounds can also be followed.

This protocol describes the intravital imaging of transgenic mice expressing cell-specific fluorescent markers. Intravital imaging provides a non-invasive method for high-resolution observations in living animals using implantable windows through which the microscopic visualization of processes is possible. This method is especially useful to study longitudinal processes.