This work was supported by VELUX STIFTUNG [project 1852] to M.L. and postgraduate fellowship grants from CONAHCYT to M.B. (836810), E.J.M.C. (802436) and A.M.F (CVU 1317418). Sincere gratitude to all the members of the laboratory, Centro de Investigaci&#243;n sobre el Envejecimiento, and Departamento de Farmacobiolog&#237;a (Cinvestav) for their contributions to the stimulating discussions.

All procedures described here were approved by the Animal Ethics Committee of Cinvestav (CICUAL, # 0354/23). The laboratory animals were treated and handled in strict accordance with the journal&#39;s animal use guidelines and according to the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research. Ocular health before and after the procedures was evaluated by assessing ocular discharges, swollen eyelids, ocular abnormalities, and behavior changes.
1. Animals and reagent preparation
<ol>
	<li>Use three 2-month-old C57BL/6 male mice per replicate for the procedure, with a starting weight of ~25 g (Figure 1). Process each mouse individually and place it on a heating pad to maintain warmth.</li>
	<li>To induce tear secretion, prepare a stock solution of pilocarpine at 20 mg/mL using sterile water.</li>
	<li>Cut the Schirmer&#39;s test strips to 5 mm in length and bend each strip at the notch to a 90&#176; angle.</li>
	<li>Prepare 250 &#181;L of sterile water with a protease inhibitor (1 tablet for 50 mL, according to manufacturer instructions).</li>
</ol>
2. Tear production stimulation and collection
<ol>
	<li>Weigh each mouse individually to calculate the appropriate dosage of treatments.</li>
	<li>To stimulate tear production, administer 30 mg/kg of pilocarpine intraperitoneally with a 6 mm insulin syringe (Figure 1B). Wait for 2 min post-drug injection for its effects to manifest. 
	NOTE: Data from unstimulated animals could not be obtained due to the limited availability of tear fluid.</li>
	<li>Collect the tears by placing the end of each Schirmer strip fragment over the center of the lower eyelid with a pair of tweezers and keep it in place until the tear reaches the strip limit (Figure 1C). Then, replace the strip. Sequentially place 2&#160;Schirmer strips in each eye, with a 2&#160;min interval between strips for collection. The tear collection process requires around four strip fragments over 10 min per mouse.</li>
	<li>Place the Schirmer strip fragments in sterile tubes on ice to avoid degradation of components. As soon as the collection finishes, start tear processing.</li>
</ol>
3. Protein isolation
<ol>
	<li>Place the&#160;strip fragments in a 600 &#181;L microcentrifuge tube containing 20 &#181;L of sterile water with a protease inhibitor and centrifuge for 1 h at 600 x g at 4 &#176;C, as previously shown17 (Figure 1D).</li>
	<li>Make a puncture using a 7.5 cm stainless-steel injector needle at the tip of the 600 &#181;L tube containing the sample (Figure 1E). Then, transfer this punctured tube to a new sterilized 1.5 mL tube and centrifuge the samples at 12,000 x g for 10 min at 4 &#176;C, as previously reported17, to recover the volume of diluted tears. The tear film volume (supernatant) will be at the bottom of the tube.</li>
	<li>Create a protein pool by combining the supernatant recovered from all the samples. In this experiment, a total volume of approximately 200 &#181;L was obtained. 
	NOTE:&#160;Tear production can last over 1 hour. During this time, tears can still be collected.</li>
	<li>Quantify the total protein content of the tear pool using the Bradford standard method22.</li>
</ol>
4. SDS-PAGE analysis
<ol>
	<li>Heat the protein samples at 99 &#176;C for 4 min to denature the proteins. Vortex the samples briefly to mix the components.</li>
	<li>Load 30 &#181;g of quantified protein content from each sample onto a 10% SDS-PAGE gel (Table 1) and run the samples at 90 V for 2 h using a standard method23.</li>
	<li>After electrophoresis, cover the gel with staining solution (Table 1) and incubate for 30 min to stain the proteins.</li>
	<li>Rinse the gel with the destaining solution several times until the background becomes clear and protein bands are visible.</li>
	<li>Acquire images with a gel documentation system.</li>
</ol>
5. mRNA isolation for qPCR and digital PCR
<ol>
	<li>Place the strips in a 600 &#181;L microcentrifuge tube containing 20 &#181;L of sterile water. Make a puncture at the tip of the tube containing the sample, put it in a new sterilized 1.5 mL tube, and centrifuge, as previously reported in human tears3, for 20 min at 2,000 x g at 4 &#176;C (Figure 1E-H).</li>
	<li>Create a pool from all samples. The recovered volume of this experiment was approximately 22 &#181;L of supernatant for each mouse, i.e., 66 &#181;L of total volume. Place the tubes on dry ice to avoid biomolecule degradation.</li>
	<li>Add 200 &#181;L of monophasic solution of phenol and guanidinium isothiocyanate (commercially obtained) and homogenize by pipetting. Let stand for 5 min at room temperature. At this step, samples can be stored at -20 &#176;C for several weeks or -70 &#176;C for several months.</li>
	<li>Add 40 &#181;L of chloroform and mix in a vortex for 15 s. Let stand for 2 min at room temperature. Centrifuge at 10,000 x g for 15 min at 4&#176;C.</li>
	<li>Carefully transfer the aqueous phase (without taking the interphase) to a new 1.5 mL tube.</li>
	<li>Add 0.5 &#181;L of glycogen (0.05 &#181;g/&#181;L) to a 100 &#181;L of isopropanol and mix by pipetting. Glycogen is co-precipitated with the RNA and does not interfere with subsequent steps.</li>
	<li>Let stand for 10 min at -20 &#176;C. Centrifuge at 10,000 x g for 10 min at 4 &#176;C. Quickly decant the supernatant.</li>
	<li>Add 200 &#181;L of cold 75% ethanol and resuspend the RNA pellet by vortexing. Centrifuge at 8,000 x g for 5 min at 4 &#176;C.</li>
	<li>Decant the ethanol. Without inverting the tube, let it air dry for 20-30 min. Add 20 &#181;L of RNase-free water and resuspend.</li>
	<li>Proceed with reading the optical density in the microvolume spectrophotometer at 260 nm and 280 nm to assess the purity of RNA. Samples must be on ice. 
	NOTE: Ribosomal bands 28S and 18S cannot be observed using an agarose gel due to the nature of the sample. The presence of other RNAs, such as miRNAs or mRNAs, can be analyzed using a bioanalyzer, as previously shown18.</li>
	<li>Synthesize the cDNA from tears RNA using a commercial kit as per the manufacturer&#39;s protocol.
	<ol>
		<li>Start with an input RNA in a range from 10 ng-5000 ng; according to the kit used, mix it with 1 &#181;L of Oligo (dT) and up to 12 &#181;L of RNase-free water. Spin it at 500 x g for 30 s and incubate at 65 &#176;C for 5 min.</li>
		<li>Add to the mixing tube 4 &#181;L of 5x reaction buffer, 1 &#181;L of RNase inhibitor, 2 &#181;L of dNTP mix, and 1 &#181;L of reverse transcriptase.</li>
		<li>Spin the tube at 500 x g for 30 s to pull down the mixture. Then, incubate the tube at 42 &#176;C for 60 min. Finish the reaction by incubating the tube at 70 &#176;C for 10 min.</li>
	</ol>
	</li>
	<li>Due to the low concentration of mRNA in tears, it is recommended to use undiluted cDNA for qPCR24. For this experiment, 150 ng of cDNA were used. Perform qPCR&#160;using DNMT3a primers: 
	Forward: GCCGAATTGTGTCTTGGTGGATGACA, Reverse: CCTGGTGGAATGCACTGCAGAAGGA and GAPDH primers: 
	Forward: ACTGGCATGGCCTTCCGTGTTCTTA, Reverse: TCAGTGTAGCCCAAGATGCCCTTC following instructions from manufacturers and equipment procedures.
	<ol>
		<li>For qPCR cycle, use the following program: Initial denaturation: 95 &#176;C for 10 min followed by 45 cycles of C 95&#176;C - 15 s, 60 &#176;C- 30 s, and 72 &#176;C- 30 s, end with a final extension at 72 &#176;C for 5 min.</li>
		<li>Perform a melt curve analysis to assess the presence of primer dimers or unspecific amplicons in the reaction. The temperature ramp started from 50 &#176;C to a final 99 &#176;C, with an initial hold of 90 s for the first step and a hold of 5 s between each step.</li>
		<li>For dPCR25, perform serial dilutions to optimize the amount of cDNA that is required to detect the mRNA of interest. In this experiment, use the following dilutions of cDNA in nuclease-free water: 150 ng, 75 ng, 37.5 ng, and 18.75 ng of cDNA. Primers for DNMT3a previously mentioned were used. For dPCR cycle, use the following program: initial denaturation: 95 &#176;C for 2 min followed by 40 cycles of 95 &#176;C - 15 s and 60 &#176;C- 30 s.</li>
	</ol>
	</li>
</ol>

Protocol for Tear Protein Extraction in Experimental Animal Models

<ol>
	<li>Ravishankar, P., Daily, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tears+as+the+next+diagnostic+biofluid:+A+comparative+study+between+ocular+fluid+and+blood.">Tears as the next diagnostic biofluid: A comparative study between ocular fluid and blood.</a> Appl Sci. 12 (6), 2884 (2022).</li><li>Masoudi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemistry+of+human+tear+film:+A+review.">Biochemistry of human tear film: A review.</a> Exp Eye Res. 220, 109101 (2022).</li><li>Dara, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+RNA+extraction+method+from+human+tears.">Novel RNA extraction method from human tears.</a> Mol Biol Res Commun. 11 (4), 167-172 (2022).</li><li>Amorim, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+biomarkers+in+tears+for+diabetic+retinopathy+diagnosis.">Putative biomarkers in tears for diabetic retinopathy diagnosis.</a> Front Med (Lausanne). 9, 873483 (2022).</li><li>Arslan, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanded+biochemical+analyses+of+human+tear+fluid:+Polyvalent+faces+of+the+Schirmer+strip.">Expanded biochemical analyses of human tear fluid: Polyvalent faces of the Schirmer strip.</a> Exp Eye Res. 237, 109679 (2023).</li><li>Liu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+th17-associated+cytokines+and+clinical+correlations+in+patients+with+dry+eye+disease.">Analysis of th17-associated cytokines and clinical correlations in patients with dry eye disease.</a> PloS one. 12 (4), e0173301 (2017).</li><li>Cross, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rna+profiles+of+tear+fluid+extracellular+vesicles+in+patients+with+dry+eye-related+symptoms.">Rna profiles of tear fluid extracellular vesicles in patients with dry eye-related symptoms.</a> Int J Mol Sci. 24 (20), 15390 (2023).</li><li>Paranjpe, V., Phung, L., Galor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tear+film:+Anatomy+and+physiology.">The tear film: Anatomy and physiology.</a> Ocular Fluid Dyn: Anat, Physiol, Imaging Tech, and Math Model. , 329-345 (2019).</li><li>Jung, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+analysis+of+human+lacrimal+and+tear+fluid+in+dry+eye+disease.">Proteomic analysis of human lacrimal and tear fluid in dry eye disease.</a> Sci Rep. 7 (1), 13363 (2017).</li><li>Di Zazzo, A., Micera, A., De Piano, M., Cortes, M., Bonini, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tears+and+ocular+surface+disorders:+Usefulness+of+biomarkers.">Tears and ocular surface disorders: Usefulness of biomarkers.</a> J Cell Physiol. 234 (7), 9982-9993 (2019).</li><li>Von Thun Und Hohenstein-Blaul, N., Funke, S., Grus, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tears+as+a+source+of+biomarkers+for+ocular+and+systemic+diseases.">Tears as a source of biomarkers for ocular and systemic diseases.</a> Exp Eye Res. 117, 126-137 (2013).</li><li>Pieczynski, J., Szulc, U., Harazna, J., Szulc, A., Kiewisz, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+fluid+collection+methods:+Review+of+current+techniques.">Tear fluid collection methods: Review of current techniques.</a> Eur J Ophthalmol. 31 (5), 2245-2251 (2021).</li><li>Shiraki, T., Shigeta, M., Tahara, N., Furukawa, H., Ohtsuka, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tear+production+assessment+by+using+Schirmer+tear+test+strips+in+mice,+rats+and+dogs.">A tear production assessment by using Schirmer tear test strips in mice, rats and dogs.</a> Animal Eye Res. 24 (1-2), 1-5 (2005).</li><li>Zhao, J., Nagasaki, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lacrimal+gland+as+the+major+source+of+mouse+tear+factors+that+are+cytotoxic+to+corneal+keratocytes.">Lacrimal gland as the major source of mouse tear factors that are cytotoxic to corneal keratocytes.</a> Exp Eye Res. 77 (3), 297-304 (2003).</li><li>Khanna, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolomics+and+lipidomics+approaches+in+human+tears:+A+systematic+review.">Metabolomics and lipidomics approaches in human tears: A systematic review.</a> Surv Ophthalmol. 67 (4), 1229-1243 (2022).</li><li>Bachhuber, F., Huss, A., Senel, M., Tumani, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+biomarkers+in+tear+fluid:+From+sampling+to+preanalytical+processing.">Diagnostic biomarkers in tear fluid: From sampling to preanalytical processing.</a> Sci Rep. 11 (1), 10064 (2021).</li><li>Koduri, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+and+evaluation+of+tear+protein+elution+from+Schirmer's+strips+in+dry+eye+disease.">Optimization and evaluation of tear protein elution from Schirmer's strips in dry eye disease.</a> Indian J Ophthalmol. 71 (4), 1413-1419 (2023).</li><li>Kakan, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+miRNAs+identified+in+a+murine+model+of+sjogren's+syndrome+as+potential+diagnostic+biomarkers+and+indicators+of+disease+mechanism.">Tear miRNAs identified in a murine model of sjogren's syndrome as potential diagnostic biomarkers and indicators of disease mechanism.</a> Front Immunol. 13, 833254 (2022).</li><li>Moore, M., Ma, T., Yang, B., Verkman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+secretion+by+lacrimal+glands+in+transgenic+mice+lacking+water+channels+aqp1,+aqp3,+aqp4+and+aqp5.">Tear secretion by lacrimal glands in transgenic mice lacking water channels aqp1, aqp3, aqp4 and aqp5.</a> Exp Eye Res. 70 (5), 557-562 (2000).</li><li>Balafas, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive+ocular+(tear)+sampling+method+for+genetic+ascertainment+of+transgenic+mice+and+research+ethics+innovation.">A noninvasive ocular (tear) sampling method for genetic ascertainment of transgenic mice and research ethics innovation.</a> OMICS. 23 (6), 312-317 (2019).</li><li>Nakagawa, A., Nakajima, T., Azuma, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+miRNA+expression+analysis+reveals+mir-203+as+a+potential+regulator+of+corneal+epithelial+cells.">Tear miRNA expression analysis reveals mir-203 as a potential regulator of corneal epithelial cells.</a> BMC Ophthalmol. 21 (1), 377 (2021).</li><li>Bradford, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+and+sensitive+method+for+the+quantitation+of+microgram+quantities+of+protein+utilizing+the+principle+of+protein-dye+binding.">A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.</a> Anal Biochem. 72, 248-254 (1976).</li><li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory manual. , (1989).</li><li>RealQPlus2x Master Mix Green without ROX. Ampliqon Available from: <a target="_blank" href="https://ampliqon.com/en/pcr-enzymes/pcr-enzymes/real-time-pcr/realq-plus-2x-master-mix-green">https://ampliqon.com/en/pcr-enzymes/pcr-enzymes/real-time-pcr/realq-plus-2x-master-mix-green</a> (2023)</li><li>Qiagen. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quick-Start+Protocol+QIAcuity+EG+PCR+Kit.">Quick-Start Protocol QIAcuity EG PCR Kit.</a> Qiagen. , (2023).</li><li>Anier, K., Malinovskaja, K., Aonurm-Helm, A., Zharkovsky, A., Kalda, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+methylation+regulates+cocaine-induced+behavioral+sensitization+in+mice.">DNA methylation regulates cocaine-induced behavioral sensitization in mice.</a> Neuropsychopharmacology. 35 (12), 2450-2461 (2010).</li><li>Hagan, S., Martin, E., Enriquez-De-Salamanca, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+fluid+biomarkers+in+ocular+and+systemic+disease:+Potential+use+for+predictive,+preventive,+and+personalized+medicine.">Tear fluid biomarkers in ocular and systemic disease: Potential use for predictive, preventive, and personalized medicine.</a> EPMA J. 7 (1), 15 (2016).</li><li>Gasparini, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sars-cov-2+on+the+ocular+surface+in+a+cohort+of+covid-19+patients+from+Brazil.">Identification of sars-cov-2 on the ocular surface in a cohort of covid-19 patients from Brazil.</a> Exp Biol Med. 246 (23), 2495-2501 (2021).</li><li>Sebbag, L., Harrington, D. M., Mochel, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tear+fluid+collection+in+dogs+and+cats+using+ophthalmic+sponges.">Tear fluid collection in dogs and cats using ophthalmic sponges.</a> Vet Ophthalmol. 21, 249-254 (2018).</li><li>Abusharha, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+basal+and+reflex+human+tear+osmolarity+in+normal+subjects:+assessment+of+tear+osmolarity.">Analysis of basal and reflex human tear osmolarity in normal subjects: assessment of tear osmolarity.</a> Ther Adv Ophthal. 10, 2515841418794886 (2018).</li><li>Fullard, R. J., Snyder, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+levels+in+nonstimulated+and+stimulated+tears+of+normal+human+subjects.">Protein levels in nonstimulated and stimulated tears of normal human subjects.</a> Inves Opht Vis Sci. 31 (6), 1119-1126 (1990).</li><li>Longwell, A., Birss, S., Keller, N., Moore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+topically+applied+pilocarpine+on+tear+film+pH.">Effect of topically applied pilocarpine on tear film pH.</a> J Pharm Sci. 65 (11), 1654-1657 (1976).</li><li>Dartt, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+regulation+of+lacrimal+gland+secretory+processes:+relevance+in+dry+eye+diseases.">Neural regulation of lacrimal gland secretory processes: relevance in dry eye diseases.</a> Prog Ret Eye Res. 28 (3), 155-177 (2009).</li></ol>

The authors declare no conflict of interest.

Tear fluid is easily accessible, and the determination of biomarkers in tears can be employed as a successful complementary technique for the early diagnosis of various human diseases27. While the biochemical analysis of tear composition in experimental animal models complements this approach and promises significant progress in understanding the molecular basis of diseases, there is a scarcity of available data and protocols, which led us to develop one. The method described in this report is tec...

Tears are considered a plasma ultrafiltrate and have also been described as an intermediate fluid between plasma serum and cerebrospinal fluid due to a significant overlap in the biomolecules they share1. It has been reported that human tears contain proteins, tear lipids, metabolites, and electrolytes2. Recently, other biomolecules such as mRNAs, miRNAs, and extracellular vesicles have also been identified3,4,5,6,7.
In humans, basal tears are located in the tear film, which consists of three layers: the outer lipid layer, which maintains the tear surface smooth to allow us to see through it and prevent tear evaporation; the middle aqueous layer, which keeps the eye hydrated, repels bacteria, protects the cornea, and constitutes 90% of the tear film; and finally, the mucin layer, a family of high molecular weight proteins that are in contact with the cornea and allow the tear to adhere to the eye8. Tear distribution across the ocular surface begins with secretion from the lacrimal gland. This fluid is then guided through tear ducts to pass over the eye&#39;s surface and flow into drainage channels. Each blink allows tears to disperse evenly over the entire eye, keeping it moist9.
The tear film is a highly dynamic biofluid capable of reflecting molecular changes that occur not only on the ocular surface but also in other tissues and organs. The analysis of differential expression in this biofluid represents a promising approach for the discovery of biomarkers in human diseases10,11. The utilization of tear film as a source of biomarkers for early diagnosis in various pathologies has been greatly facilitated by the presence of non-invasive collection methods. The most common method for collecting tears in human and veterinary clinics involves membrane-based support (Schirmer&#39;s strip), which operates on the principle of capillary action, allowing the water in tears to travel along the length of a paper test strip or capillary tubes placed in the subject&#39;s lower conjunctival sac12,13,14. Despite the inherent limitation of obtaining a small sample volume through this method, the biochemical analysis of tear composition using various sensitive techniques has facilitated the identification of potential biomarker molecules11,15. Protocols for optimizing and evaluating the elution of tear proteins from Schirmer strips and capillaries in human patients are well documented16,17. However, complete descriptions of optimized protocols specifically designed to extract molecular information related to tears from experimental animal models are available but scarce. Existing methods, such as tear induction through direct stimulation of the lacrimal gland18, while allowing for the collection of larger volumes, are invasive and can cause discomfort to the animals. Non-invasive methods, such as collecting tears from the ocular surface, have been described as a way to isolate DNA and miRNAs19,21.
This protocol aims to establish a cost-effective and optimized method for collecting and processing tears in mice. The method prioritizes non-invasiveness while obtaining sufficient tear volumes suitable for molecular analysis through techniques like SDS-PAGE, qPCR, and dPCR. The extracted protein and mRNA content information can then be utilized to identify potential biomarkers in existing experimental models of disease.

<table><tbody><tr><td>2-mercaptoethanol</td><td>Gibco</td><td>1985023</td><td></td></tr><tr><td>2x Laemmli buffer</td><td>Bio-Rad</td><td>16-0737</td><td></td></tr><tr><td>Acetic Acid</td><td>Quimica Meyer</td><td>64-19-7</td><td></td></tr><tr><td>Acrylamide</td><td>Sigma-Aldrich</td><td>A4058</td><td></td></tr><tr><td>Bradford Reagent</td><td>Sigma-Aldrich</td><td>B6916</td><td></td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>1003045143</td><td></td></tr><tr><td>Coomassie Blue R 250</td><td>US Biological</td><td>6104-59-2</td><td></td></tr><tr><td>Ethanol</td><td>Quimica Rique</td><td>64-17-5</td><td></td></tr><tr><td>GeneRuler 1kb plus DNA Ladder</td><td>Thermofisher scientific</td><td>SM1331</td><td></td></tr><tr><td>Glycerol</td><td>US Biological</td><td>G8145</td><td></td></tr><tr><td>Glycine</td><td>SANTA CRUZ</td><td>SC- 29096</td><td></td></tr><tr><td>Glycogen</td><td>Roche</td><td>10901393001</td><td></td></tr><tr><td>HCl</td><td>Quimica Rique</td><td>7647-01-0</td><td></td></tr><tr><td>Isopropyl alcohol</td><td>Quimica Rique</td><td>67-63-0</td><td></td></tr><tr><td>Methanol</td><td>Quimica Meyer</td><td>67-56-1</td><td></td></tr><tr><td>Micro tubes 1.5 ml</td><td>Axygen</td><td>MCT-150-C</td><td></td></tr><tr><td>Micro tubes 600 &amp;micro;l</td><td>Axygen</td><td>MCT-060-C</td><td></td></tr><tr><td>NaCl</td><td>Sigma-Aldrich</td><td>S3014</td><td></td></tr><tr><td>PCR tubes &amp;amp; strips</td><td>Novasbio</td><td>PCR 0104</td><td></td></tr><tr><td>Pilocarpine</td><td>Sigma-Aldrich</td><td>P6503-10g</td><td></td></tr><tr><td>Protease inhibitor</td><td>Roche</td><td>11873580001</td><td></td></tr><tr><td>QIAcuity EvaGreen PCR Kit (5mL)</td><td>Qiagen</td><td>250112</td><td></td></tr><tr><td>QIAcuity Nanoplate 26k 24-well (10)</td><td>Qiagen</td><td>250001</td><td></td></tr><tr><td>Real qPlus 2x Master Mix Green</td><td>Ampliqon</td><td>A323402</td><td></td></tr><tr><td>RevertAid First Strad cDNA Synthesis Kit</td><td>Thermofisher scientific</td><td>K1622</td><td></td></tr><tr><td>Schirmer&#039;s test strips</td><td>Laboratorio Santgar</td><td>SANT1553</td><td></td></tr><tr><td>SDS</td><td>Sigma-Aldrich</td><td>L3771</td><td></td></tr><tr><td>TEMED</td><td>Sigma aldrich</td><td>102560430</td><td></td></tr><tr><td>TRI reagent</td><td>Sigma-Aldrich</td><td>T9424-200ML</td><td>monophasic solution of phenol and guanidinium isothiocyanate</td></tr><tr><td>Tris</td><td>US Biological</td><td>T8650</td><td></td></tr><tr><td>Tris base</td><td>Chem Cruz</td><td>sc-3715A</td><td></td></tr></tbody></table>

optimizing tear collection in mice for mrna and protein analysis

The tear film is a highly dynamic biofluid capable of reflecting pathology-associated molecular changes, not only in the ocular surface but also in other tissues and organs. Molecular analysis of this biofluid offers a non-invasive way to diagnose or monitor diseases, assess medical treatment efficacy, and identify possible biomarkers. Due to the limited sample volume, collecting tear samples requires specific skills and appropriate tools to ensure high quality and maximum efficiency. Various tear sampling methodologies have been described in human studies. In this article, a comprehensive description of an optimized protocol is presented, specifically tailored for extracting tear-related protein information from experimental animal models, especially mice. This method includes the pharmacological stimulation of tear production in 2-month-old mice, followed by sample collection using Schirmer strips and the evaluation of the efficacy and efficiency of the protocol through standard procedures, SDS-PAGE, qPCR, and digital PCR (dPCR). This protocol can be easily adapted for the investigation of the tear protein signature in a variety of experimental paradigms. By establishing an affordable, standardized, and optimized tear sampling protocol for animal models, the aim was to bridge the gap between human and animal research, facilitating translational studies and accelerating advancements in the field of ocular and systemic disease research.

The protocol described in this paper provides an easy and affordable method for obtaining molecular information from tear fluid using techniques commonly available in most molecular biology laboratories. Furthermore, the protocol can be scaled up by employing highly sensitive techniques such as ELISA for enzymatic activity detection.
After these procedures, the total protein yield was approximately 3-4 &#181;g/&#181;L. Coomassie-stained SDS page analysis of total protein extracts reveals patte...

Author Spotlight: Isolating Biomolecules from Mouse Tears &#8212; A Methodology for Molecular Analysis and Biomarker Research

The identification of RNA and protein biomarkers from tears in mouse models holds great promise for early diagnostics in various diseases. This manuscript provides a comprehensive protocol for optimizing the efficacy and efficiency of mRNA and protein isolation from mouse tears.

Optimizing Tear Collection in Mice for mRNA and Protein Analysis

The tear film is a highly dynamic biofluid capable of reflecting pathology-associated molecular changes, not only in the ocular surface but also in other ...

optimizing-tear-collection-in-mice-for-mrna-and-protein-analysis

Research

JoVE Journal

Biology

1.1K Views.  CINVESTAV Sede Sur. The identification of RNA and protein biomarkers from tears in mouse models holds great promise for early diagnostics in various diseases. This manuscript provides a comprehensive protocol for optimizing the efficacy and efficiency of mRNA and protein isolation from mouse tears.

Video: Author Spotlight: Isolating Biomolecules from Mouse Tears — A Methodology for Molecular Analysis and Biomarker Research

Mouse Adipose Tissue Collection and Processing for RNA Analysis

Compared to other tissues, white adipose tissue has a considerably less RNA and protein content for downstream applications such as real-time PCR and Western Blot, since it mostly contains lipids. RNA isolation from adipose tissue samples is also challenging as extra steps are required to avoid these lipids. Here, we present a procedure to collect three anatomically different white adipose tissues from mice, to process these samples and perform RNA isolation. We further describe the synthesis of cDNA and gene expression experiments using real-time PCR. The hereby described protocol allows the reduction of contamination from the animal's hair and blood on fat pads as well as cross-contamination between different fat pads during tissue collection. It has also been optimized to ensure adequate quantity and quality of the RNA extracted. This protocol can be widely applied to any mouse model where adipose tissue samples are required for routine experiments such as real-time PCR but is not intended for isolation from primary adipocytes cell culture.

The purpose of this paper is to present a step-by-step procedure to collect different white adipose tissues from mice, process the fat samples and extract RNA.

Compared to other tissues, white adipose tissue has a considerably less RNA and protein content for downstream applications such as real-time PCR and ...

Biochemistry

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of the breadth of molecular regulation. Newer approaches such as high-resolution RNA sequencing (RNA-Seq)1 provides new and expansive information about tissue- or state-specific expression such as relative transcript levels, alternative splicing, and micro RNAs2-4. Prospects for employing the RNA-Seq method in comparative whole transcriptome profiling5 within discrete tissues or between phenotypically distinct groups of individuals affords new avenues for elucidating molecular mechanisms involved in both normal and abnormal physiological states. Recently, whole transcriptome profiling has been performed on human brain tissue, identifying gene expression differences associated with disease progression6. However, the use of next-generation sequencing has yet to be more widely integrated into mammalian studies.
Gene expression studies in mouse models have reported distinct profiles within various brain nuclei using laser capture microscopy (LCM) for sample excision7,8. While LCM affords sample collection with single-cell and discrete brain region precision, the relatively low total RNA yields from the LCM approach can be prohibitive to RNA-Seq and other profiling approaches in mouse brain tissues and may require sub-optimal sample amplification steps. Here, a protocol is presented for microdissection and total RNA extraction from discrete mouse brain regions. Set-diameter tissue corers are used to isolate 13 tissues from 750-&mu;m serial coronal sections of an individual mouse brain. Tissue micropunch samples are immediately frozen and archived. Total RNA is obtained from the samples using magnetic bead-enabled total RNA isolation technology. Resulting RNA samples have adequate yield and quality for use in downstream expression profiling. This microdissection strategy provides a viable option to existing sample collection strategies for obtaining total RNA from discrete brain regions, opening possibilities for new gene expression discoveries.

Non-Laser Capture Microscopy Approach for the Microdissection of Discrete Mouse Brain Regions for Total RNA Isolation and Downstream Next-Generation Sequencing and Gene Expression Profiling  |

RNA expression profiling of discrete mouse brain regions requires a precise and repeatable tissue collection strategy. A protocol that uses both coronal brain sectioning and tissue corer-assisted microdissection is described here. The yield and quality of total RNA obtained from the resulting samples confirms the utility of the outlined method.

As technological platforms, approaches such as next-generation sequencing, microarray, and qRT-PCR have great promise for expanding our understanding of ...

Neuroscience

Dynamic Proteomic and miRNA Analysis of Polysomes from Isolated Mouse Heart After Langendorff Perfusion

Studies in dynamic changes in protein translation require specialized methods. Here we examined changes in newly-synthesized proteins in response to ischemia and reperfusion using the isolated perfused mouse heart coupled with polysome profiling. To further understand the dynamic changes in protein translation, we characterized the mRNAs that were loaded with cytosolic ribosomes (polyribosomes or polysomes) and also recovered mitochondrial polysomes and compared mRNA and protein distribution in the high-efficiency fractions (numerous ribosomes attached to mRNA), low-efficiency (fewer ribosomes attached) which also included mitochondrial polysomes, and the non-translating fractions. miRNAs can also associate with mRNAs that are being translated, thereby reducing the efficiency of translation, we examined the distribution of miRNAs across the fractions. The distribution of mRNAs, miRNAs, and proteins was examined under basal perfused conditions, at the end of 30 min of global no-flow ischemia, and after 30 min of reperfusion. Here we present the methods used to accomplish this analysis&#8212;in particular, the approach to optimization of protein extraction from the sucrose gradient, as this has not been described before&#8212;and provide some representative results.

Here we present a protocol to perform polysome profiling on the isolated perfused mouse heart. We describe methods for heart perfusion, polysome profiling, and analysis of the polysome fractions with respect to mRNAs, miRNAs, and the polysome proteome.

Studies in dynamic changes in protein translation require specialized methods. Here we examined changes in newly-synthesized proteins in response to ...

RiboTag Immunoprecipitation in the Germ Cells of the Male Mouse

Quantifying differences in mRNA abundance is a classic approach to understand the impact of a given gene mutation on cell physiology. However, characterizing differences in the translatome (the whole of translated mRNAs) provides an additional layer of information particularly useful when trying to understand the function of RNA regulating or binding proteins. A number of methods for accomplishing this have been developed, including ribosome profiling and polysome analysis. However, both methods carry significant technical challenges and cannot be applied to specific cell populations within a tissue unless combined with additional sorting methods. In contrast, the RiboTag method is a genetic-based, efficient, and technically straightforward alternative that allows the identification of ribosome associated RNAs from specific cell populations without added sorting steps, provided an applicable cell-specific Cre driver is available. This method consists of breeding to generate the genetic models, sample collection, immunoprecipitation, and downstream RNA analyses. Here, we outline this process in adult male mouse germ cells mutant for an RNA binding protein required for male fertility. Special attention is paid to considerations for breeding with a focus on efficient colony management and the generation of correct genetic backgrounds and immunoprecipitation in order to reduce background and optimize output. Discussion of troubleshooting options, additional confirmatory experiments, and potential downstream applications is also included. The presented genetic tools and molecular protocols represent a powerful way to describe the ribosome-associated RNAs of specific cell populations in complex tissues or in systems with aberrant mRNA storage and translation with the goal of informing on the molecular drivers of mutant phenotypes.

Here, we describe the immunoprecipitation of ribosomes and associated RNA from select populations of adult male mouse germ cells using the RiboTag system. Strategic breeding and careful immunoprecipitation result in clean, reproducible results that inform on the germ cell translatome and provide insight into the mechanisms of mutant phenotypes.

Quantifying differences in mRNA abundance is a classic approach to understand the impact of a given gene mutation on cell physiology. However, ...

Developmental Biology

A Precise Pathogen Delivery and Recovery System for Murine Models of Secondary Bacterial Pneumonia

Secondary bacterial pneumonias following influenza infections consistently rank within the top ten leading causes of death in the United States. To date, murine models of co-infection have been the primary tool developed to explore the pathologies of both the primary and secondary infections. Despite the prevalence of this model, considerable discrepancies regarding instillation procedures, dose volumes, and efficacies are prevalent among studies. Furthermore, these efforts have been largely incomplete in addressing how the pathogen may be directly influencing disease progression post-infection. Herein we provide a precise method of pathogen delivery, recovery, and analysis to be used in murine models of secondary bacterial pneumonia. We demonstrate that intratracheal instillation enables an efficient and accurate delivery of controlled volumes directly and evenly into the lower respiratory tract. Lungs can be excised to recover and quantify the pathogen burden. Following excision of the infected lungs, we describe a method to extract high quality pathogen RNA for subsequent transcriptional analysis. This procedure benefits from being a non-surgical method of delivery without the use of specialized laboratory equipment and provides a reproducible strategy to investigate pathogen contributions to secondary bacterial pneumonia.

Here, we present methods to improve secondary bacterial pneumonia studies by providing a non-invasive route of instillation into the lower respiratory tract followed by pathogen recovery and transcript analysis. These procedures are reproducible and can be performed without specialized equipment such as cannulas, guide wires, or fiber optic cables.

Secondary bacterial pneumonias following influenza infections consistently rank within the top ten leading causes of death in the United States. To date, ...

Immunology and Infection

A Cryo-pulverization Protocol for Processing Mouse Paws to Evaluate Molecular Pathways of Tissue Inflammation in a Collagen Induced Arthritis Model

Profiling molecular changes in local tissues is crucial to understand the mechanism(s) of action of therapeutic candidates in vivo. In the field of arthritis research, many studies are focused on inflamed joints that are composed of a complex mixture of bone, cartilage, muscle, stromal cells and immune cells. Here, we established a reliable and robust mechanical method to disrupt inflamed mouse paws into homogeneous pulverized samples in a cryogenically controlled environment. Protein and RNA lysates were processed to enable proteomic and transcriptional endpoints and molecular characterization of relevant disease pathways in local tissue.

A cryogenic pulverization method to process murine paws using a liquid nitrogen freezer mill was developed to improve the yield and quality of RNA or protein extracted from the tissues and enable the analysis of molecular profiles associated with inflammatory responses.

Profiling molecular changes in local tissues is crucial to understand the mechanism(s) of action of therapeutic candidates in vivo. In the field of ...

Cryosectioning of Contiguous Regions of a Single Mouse Skeletal Muscle for Gene Expression and Histological Analyses

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene expression using adjacent regions from a single mouse skeletal muscle. Typically, it is challenging to achieve adequate homogenization of small skeletal muscle samples because buffer volumes may be too low for efficient grinding applications, yet without sufficient mechanical disruption, the dense tissue architecture of muscle limits penetration of buffer reagents, ultimately causing low RNA yield. By following the protocol reported here, 30 &#956;m sections are collected and pooled allowing cryosectioning and subsequent needle homogenization to mechanically disrupt the muscle, increasing the surface area exposed for buffer penetration. The primary limitations of the technique are that it requires a cryostat, and it is relatively low throughput. However, high-quality RNA can be obtained from small samples of pooled muscle cryosections, making this method accessible for many different skeletal muscles and other tissues. Furthermore, this technique enables matched analyses (e.g., tissue histopathology and gene expression) from adjacent regions of a single skeletal muscle so that measurements can be directly compared across applications to reduce experimental uncertainty and to reduce replicative animal experiments necessary to source a small tissue for multiple applications.

Consecutive cryo-sections are collected to enable histological applications and enrichment of RNA for gene expression measurements using adjacent regions from a single mouse skeletal muscle. High-quality RNA is obtained from 20 - 30 mg of pooled cryosections and measurements are directly compared across applications.

With this method, consecutive cryosections are collected to enable both microscopy applications for tissue histology and enrichment of RNA for gene ...

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...

Non-Invasive Biomarker Discovery for Tear Proteomics Using LC-MS

A Protein Suspension-Trapping Sample Preparation for Tear Proteomics by Liquid Chromatography-Tandem Mass Spectrometry

Tear fluid is one of the easily accessible biofluids that can be collected non-invasively. Tear proteomics has the potential to discover biomarkers for several ocular diseases and conditions. The suspension trapping column has been reported to be an efficient and user-friendly sample preparation workflow for the broad application of downstream proteomic analysis. Yet, this strategy has not been well-studied in the analysis of human tear proteome. The present protocol describes an integrated workflow from clinical human tear samples to purified peptides for non-invasive tear protein biomarker research using mass spectrometry, which provides insights into disease biomarkers and monitoring when combined with bioinformatics analysis. A protein suspension trapping sample preparation was applied and demonstrated the discovery of tear proteome with fast, reproducible, and user-friendly procedures, as a universal, optimized sample preparation for human tear fluid analysis. In particular, the suspension trapping procedure outperformed in-solution sample preparation in terms of peptide recovery, protein identification, and shorter sample preparation time.

Author Spotlight: Advancing Tear Fluid Analysis Using a Standardized Protocol for Proteomics Research 

This protocol describes a method for collecting tear samples using Schirmer strips and an integrated quantitative workflow for discovering non-invasive tear protein biomarkers. The suspension trapping sample preparation workflow enables fast and robust tear sample preparation and mass spectrometric analysis, resulting in higher peptide recovery yields and protein identification than standard in-solution procedures.

Tear fluid is one of the easily accessible biofluids that can be collected non-invasively. Tear proteomics has the potential to discover biomarkers for ...

Medicine

A Laser Capture Microdissection Protocol That Yields High Quality RNA from Fresh-frozen Mouse Bones

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser capture microdissection (LCM) procedure. Since LCM studies work with low amounts of material, concerns about limited RNA yields are also important. Therefore, an LCM protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The effect of staining protocol, thickness of cryosections, microdissected tissue quantity, RNA extraction kit, and LCM system used on RNA yield and integrity obtained from microdissected bone cells was evaluated. Eight-&#181;m-thick frozen bone sections were made using an adhesive film and stained using a rapid protocol for a commercial LCM stain. The sample was sandwiched between a polyethylene terephthalate (PET) membrane and the adhesive film. An LCM system that uses gravity for sample collection and a column-based RNA extraction method were used to obtain high quality RNAs of sufficient yield. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study in situ gene expression in cells of any hard tissue in both physiological conditions and disease processes.

A laser capture microdissection (LCM) protocol was developed to obtain sufficient quantity of high-quality RNA for gene expression analysis in bone cells. The current study focusses on mouse femur sections. However, the LCM protocol reported here can be used to study gene expression in cells of any hard tissue.

RNA yield and integrity are decisive for RNA analysis. However, it is often technically challenging to maintain RNA integrity throughout the entire laser ...