وأيد هذا العمل من قبل المعاهد الوطنية للصحة ومؤسسة PKD لZS. وأجريت التجارب على الحيوانات فقط وفقا لمركز يال الثروة الحيوانية (YARC) والمؤسسية رعاية الحيوان واستخدام المبادئ التوجيهية للجنة (IACUC).

الجزء 1 : إعداد micropipettes وألواح غرفة microinjection <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> افتعال micropipettes عن طريق التسخين وسحب الأنابيب الزجاجية البورسليكات الشعرية (البنك الآلات الدقيقة ، وشركة ، 1B100 - 4) في جهاز مجتذب micropipette (سوتر الآلات ، وشركة يلهب / براون P - 97). مخزن في طبق بتري على أعلى كمية صغيرة من الطين أو شريط لاصق. </li><li style=";text-align:right;direction:rtl"> صب agarose 1.5 ٪ (الاميركي Bioanlytical ، شركة ، AB00972 - 00500) في لوحات 1X المتوسطة E3 مصبوب مع اسفين على شكل أحواض من شأنها أن تكون بمثابة طريقة سهلة لعقد أجنة خلال حقن (كما هو موضح في كتاب &#39;اسماك الزرد&quot;) 1. دعونا لوحات أجار الغرفة ترسيخ قبل استخدام وتخزين عند 4 درجة مئوية. </li></ol> الجزء 2 : إعداد RNA نهج واحد قوي للدراسات وظائف الجينات والحمض النووي الريبي لmicroinject في المختبر توج كتب في الأجنة الزرد. توج الجيش الملكي النيبالي سلوك مشابه إلى mRNAs حقيقية النواة الموجودة في الجسم الحي بسبب وجود تمثيلي CAP. الزرد الباحثين الاستفادة بشكل روتيني لهذا الأسلوب أو overexpress misexpress الجين اهتمامهم. في هذه التظاهرة ، فإننا سوف microinject مستخرج EGFP الموسومة واستخدام كامل يعيش الجنين GFP - التعبير بوصفها قراءات مرئية عن طريق الحقن ناجحة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إجراء في المختبر CAP رد فعل على النص نسخ الحمض النووي الريبي اهتمامك. في المختبر ، ونحن ادخال بشكل روتيني [كدنا] من الاهتمام الى ناقلات + pCS2 وإجراء كرد فعل التوليف المختبر كميات كبيرة من الحمض النووي الريبي توج باستخدام mMachine mMessage SP6 مجموعة (Ambion ، شركة ، AM1340). </li><li style=";text-align:right;direction:rtl"> تنقية عينة الحمض النووي الريبي التي تعمل من خلال مجموعة صغيرة RNeasy (Qiagen ، شركة ، 74104) أو الفينول : استخراج الكلوروفورم والأيزوبروبانول هطول الأمطار. </li><li style=";text-align:right;direction:rtl"> تحديد دقيق للتركيز على إعداد الجيش الملكي النيبالي وتخزينها في -80 درجة مئوية لتصبح جاهزة للاستخدام. </li><li style=";text-align:right;direction:rtl"> في يوم من الحقن ، وأذاب عينة الحمض النووي الريبي ، وتدور الدوامة طفيفة أسفل لفترة وجيزة. </li><li style=";text-align:right;direction:rtl"> يعد حل تعمل مع الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول (سيغما الدريخ شركة P0290). أحمر الفينول بمثابة علامة مرئية لحقن المحلول في جنين. في هذه المقالة ، سوف نستعد حلا مرنا من 100 عامل EGFP نانوغرام / UL مع أحمر الفينول 0.050 ٪. </li><li style=";text-align:right;direction:rtl"> إبقاء عينة تعمل على الجليد وعودة السهم إلى رنا -80 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة. </li></ol> الجزء 3 : إعداد morpholino وتستخدم على نطاق واسع Morpholino [أليغنوكليوتيد] العقاقير لتعديل التعبير الجيني عن طريق منع ترجمة البروتين المستهدف أو عن طريق تعديل قبل مرنا الربط 2،3. Morpholinos في الزرد بمثابة أداة الوراثة العكسية القوية التي هدمت وظيفة الجين. في هذه المقالة ، فإننا سوف microinject a morpholino جزئية تستهدف موقع من بدء متعدية pkd2 (5&#39; - AGGACGAACGCGACTGGAGCTCATC - 3 &#39;). على أساس العمل المحددة مسبقا ، ونحن نتوقع من حقن الأجنة لتقليد phenotypically pkd2 4 الأسماك متحولة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نأذن بشكل روتيني من 300 nmol بنسبة ضئيلة morpholino مصممة خصيصا لجينة من الاهتمام من أدوات الجينات ، LLC (Philomath ، OR). </li><li style=";text-align:right;direction:rtl"> إضافة الماء المعقم UL 100 لجعل مخزون 3 ملم الحل. قسامة الحل وتخزينها في -20 درجة مئوية لتصبح جاهزة للاستخدام. </li><li style=";text-align:right;direction:rtl"> في يوم من الحقن ، والحرارة الحل morpholino عند 65 درجة مئوية لمدة 5 دقائق. المفاجئة باردة على الجليد على الفور وتدور لفترة وجيزة. يبدل طبيعة هذه الخطوة أي الهياكل الثانوية في جزئية ويضمن solubilized تماما الحل. </li><li style=";text-align:right;direction:rtl"> يعد حل العامل تمييع الحل morpholino في الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول. في هذه المظاهرة ، سنكون إعداد حل عمل 0.50 ملي pkd2 morpholino مع أحمر الفينول 0.050 ٪. </li><li style=";text-align:right;direction:rtl"> مواصلة العمل على حل درجة حرارة الغرفة. </li><li style=";text-align:right;direction:rtl"> انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة.---- </li></ol> الجزء 4 : تعبئة micropipette مع الحل الخاص العاملة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> قطع رأس القاصية من micropipette بالملقط أو razorblade الجراحية لإنشاء الافتتاح ان يكون مرئيا فقط تحت المجهر تشريح (نيكون الآلات ، وشركة ، SM2645) في التكبير 50X. </li><li style=";text-align:right;direction:rtl"> 2 UL مكان من الحل الخاص بك يعمل انخفاض في الصعود إلى ساترة. </li><li style=";text-align:right;direction:rtl"> نعلق الجزء الخلفي من micropipette إلى حقنة 5 مل مزودة أنابيب على إبرة تحت الجلد ويغرق قليلا الطرف البعيد من micropipette إلى إسقاط الخاص من محلول العمل. الحرص على عدم كسر غيض من micropipette. </li><li style=";text-align:right;direction:rtl"> سيفون الحل من خلال العمل في نهاية البعيدة للmicropipette عن طريق سحب المكبس من المحاقن. </li></ol> الجزء 5 : معايرة حجم الحقن micropipette <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وضع قطرة من الزيت المعدني (الاميركي Bioanalytical ، شركة ، AB00921 - 00025) على شريحة ميكرون (فايشير ، 12 SM1 - 561). </li><li style=";text-align:right;direction:rtl"> بدوره على السلطة والعرض الجوي للضغط نابض الدقيقة حاقن جهاز (وورلد شركة آلات دقيقة ، PV830). </li><li style=";text-align:right;direction:rtl"> إرفاق micropipette لصاحب micropipette جهاز حاقن الجزئي. حاقن هو الضغط الجزئي للتنظيم وتنشيط الإفرازات عن طريق الضغط على دواسة القدم. </li><li style=";text-align:right;direction:rtl"> تشريح تحت المجهر ، واختبار حجم الحقن باستخدام محقنة الدقيقة لوضع قطرة من حل العمل الخاص بك على النفط ميكرون. قياس قطرها من الانخفاض حيث يعوم كمجال على أعلى من النفط. </li><li style=";text-align:right;direction:rtl"> ضبط مدة وضغط الحقن لمعايرة الصوت الخاص بعناية من الحقن. هذه الخطوة يساعد في استنساخ التجربة microinjection. في هذه المظاهرة ، وسيتم ذلك عن microinjections مع قطره قطرة 0.15 ملم (حوالي 1.76 NL في الحجم). </li><li style=";text-align:right;direction:rtl"> مرة واحدة وقد تم معايرة حجم الحقن الخاص ، واستخدام &quot;عقد&quot; مفتاح على حاقن الدقيقة لمنع الردم وتسريب micropipette. </li></ol> الجزء 6 : إعداد الأجنة المخصبة الزرد لmicroinjection <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> والزرد لم عشوائيا في الساعات القليلة الأولى من صباح كل يوم. جمع الأجنة في مرحلة 1 - الخلية ووضعها في 1X المتوسطة E3. </li><li style=";text-align:right;direction:rtl"> باستخدام الماصة نقل 3 مل (بيكتون ديكنسون لابوار ، 357524) ، وترتيب الأجنة على طول أحواض اسفين على شكل لوحات في غرفة microinjection. </li><li style=";text-align:right;direction:rtl"> إزالة المتوسطة بحيث تكون مغمورة ضحلة الأجنة وغمرت لا. هذه الخطوة يساعد في تسوية الأجنة إلى أسفل هبوطا ، وكذلك في الاختراق من قبل المشيماء micropipette. </li></ol> الجزء 7 : Microinjection خلال المشيماء <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التلاعب في الأجنة مع micropipette بحيث السيتوبلازم الجنين مرحلة 1 - الخلية مرئية تحت المجهر تشريح. الحرص على عدم كسر غيض من micropipette. </li><li style=";text-align:right;direction:rtl"> اختراق المشيماء ثم صفار ومع micropipette من أجل حقن في الجنين. في هذه التظاهرة ، فإننا سوف تكون الأولى في microinjecting صفار مباشرة تحت الخلية ، والسماح لتدفق حشوية ونشرها لتحقيق الحل العاملين في الخلية. هذا التدفق غير مرئية بسبب أحمر الفينول وأضاف أن الحل العمل. </li><li style=";text-align:right;direction:rtl"> وسوف نظهر أيضا الحقن المباشر في السيتوبلازم الخلية. microinjection مباشرة في الخلية هو أكثر قوة ولكن وقتا طويلا في اتجاه الجنين السليم وتقنية microinjection هو مطلوب. كما غشاء الخلية هو أكثر صرامة من الغشاء المحي ، غالبا ما يكون أسرع لدخول micropipette صفار من خلال التوصل إلى السيتوبلازم الخلية. قد توجيه القطب الحيواني نحو قاع الحوض ، والعمل مع المعونة أيدي ثابتة في هذا الأسلوب من الحقن. </li><li style=";text-align:right;direction:rtl"> بعد microinjection ، وضع الأجنة في طبق بيتري مع E3 المتوسطة واحتضان لهم في التطور الطبيعي ل28.5 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> خلال الساعات القليلة المقبلة والأيام من تطور الجنين ، مراقبة الجنين عن الظواهر اهتمامك. </li></ol> الجزء 8 : نتائج الممثل EGFP مرنا overexpression : التحقق من نجاح microinjection ، وسوف نقوم بمراقبة التعبير عن GFP في الأجنة النامية في مرحلة بداية درع (~ 6 HPF) في الجسم الحي بواسطة المجهر مضان كامل الجنين (لايكا مايكروسيستمز GMBH ، MZFLIII). التعبير عن بناء أكثر قوية خلال الأحداث المبكرة من التطور الجنيني ، وسوف يقلل كثيرا خلال التنمية كما توج حقن الحمض النووي الريبي هو المتدهورة بشكل تدريجي ويعتمد على استقرار البروتين المعبر عنها. pkd2 متعدية حجب morpholino : بناء على النتائج المنشورة سابقا ، فإننا نتوقع أن morphants pkd2 لتقليد محور الجسم الظهري انحناء كما وجدت في pkd2 الزرد متحولة والخراجات الكلى حاضرا في حوالي 2 -- 3 4 DPF. <img src="/files/ftp_upload/1113/1113fig1.png" alt="الشكل 1" /> الشكل 1 : نتائج من الممثل microinjection من EGFP مرنا وpkd2 morpholino أغسطس (أ) كانت microinjected TAB الأجنة في مرحلة 1 - زنزانة مع 0.17 نانوغرام من EGFP مرنا وتصور في 1 DPF في التعبير عن GFP الجسم الحي. (ب ، ج) وmicroinjected TAB الأجنة في مرحلة 1 - NL زنزانة مع 1،7 ~ من morpholino متعدية pkd2 حظر عند 0.50 ملم وسجل للانحناء الجسم الظهري في 4 DPF.

<ol>
	<li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Nasevicius, A., Ekker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+targeted+gene+'knockdown'+in+zebrafish.">Effective targeted gene 'knockdown' in zebrafish.</a> Nat Genet. 26, 216-220 (2000).</li><li>Draper, B., Morcos, P., Kimmel, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+zebrafish+fgf8+pre-mRNA+splicing+with+morpholino+oligos:+a+quantifiable+method+for+gene+knockdown.">Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown.</a> Genesis. 30, 154-156 (2001).</li><li>Sun, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+zebrafish+identifies+cilia+genes+as+a+principal+cause+of+cystic+kidney.">A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney.</a> Development. 131, 4085-4093 (2004).</li><li>Stuart, G., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication,+integration+and+stable+germ-line+transmission+of+foreign+sequences+injected+into+early+zebrafish+embryos.">Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos.</a> Development. 103, 403-412 (1988).</li><li>Stuart, G., Vielkind, J., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+lines+of+transgenic+zebrafish+exhibit+reproducible+patterns+of+transgene+expression.">Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression.</a> Development. 109, 577-584 (1990).</li><li>Culp, P., N&#252;sslein-Volhard, C., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+germ-line+transmission+of+plasmid+DNA+sequences+injected+into+fertilized+zebrafish+eggs.">High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs.</a> Proc Natl Acad Sci U S A. 88, 7953-7957 (1991).</li><li>Strehlow, D., Heinrich, G., Gilbert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fates+of+the+blastomeres+of+the+16-cell+zebrafish+embryo.">The fates of the blastomeres of the 16-cell zebrafish embryo.</a> Development. 120, 1791-1798 (1994).</li><li>Helde, K., Wilson, E., Cretekos, C., Grunwald, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+early+cells+to+the+fate+map+of+the+zebrafish+gastrula.">Contribution of early cells to the fate map of the zebrafish gastrula.</a> Science. 265, 517-520 (1994).</li><li>Lin, S., Long, W., Chen, J., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+germ-line+chimeras+in+zebrafish+by+cell+transplants+from+genetically+pigmented+to+albino+embryos.">Production of germ-line chimeras in zebrafish by cell transplants from genetically pigmented to albino embryos.</a> Proc Natl Acad Sci U S A. 89, 4519-4523 (1992).</li><li>Long, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GATA-1+expression+pattern+can+be+recapitulated+in+living+transgenic+zebrafish+using+GFP+reporter+gene.">GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene.</a> Development. 124, 4105-4111 (1997).</li><li>Murphey, R., Zon, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecule+screening+in+the+zebrafish.">Small molecule screening in the zebrafish.</a> Methods. 39, 255-261 (2006).</li></ol>

Microinjection في الأجنة الزرد هي تقنية راسخة وقوية لاستكشاف دور جين خاص في مجال التنمية. وتشمل التطبيقات overexpression ، misexpression ، وضربة قاضية لفحوصات الجينات اهتمامك ، فضلا عن تحليل روكبي بين جينات متعددة. وقد Microinjection في الزرد المستخدمة على نطاق واسع لتوليد حيوانات معدلة وراثي?...

يتم سرد كافة المواد الأخرى في البروتوكول.

microinjection of mrna and morpholino antisense oligonucleotides in zebrafish embryos.

أداة أساسية للتحقيق في دور الجينات خلال التنمية هو القدرة على تنفيذ ضربة قاضية الجينات ، overexpression والدراسات misexpression. في الزرد (<em&gt; دانيو rerio</em&gt;) ، microinjection من الحمض النووي الريبي ، والحمض النووي والبروتينات والعقاقير [أليغنوكليوتيد] والجزيئات الصغيرة الأخرى في الجنين النامية تقدم الباحثون فحص سريعة وقوية لاستكشاف وظائف الجينات<em&gt; في الجسم الحي</em&gt;. في هذه المقالة عن طريق الفيديو ، وسوف نقوم شرح كيفية إعداد وmicroinject<em&gt; في المختبر</em&gt; توليفها EGFP مرنا ومتعدية للحظر جزئية ضد morpholino<em&gt; pkd2</em&gt; ، وهو الجين المرتبط راثي جسمي أمراض الكلى المتعدد الكيسات (ADPKD) ، إلى خلايا الأجنة 1 الزرد المرحلة. وسوف نقوم بتحليل ثم نجاح مرنا وmicroinjections morpholino من خلال التحقق من التعبير GFP وتحليل النمط الظاهري. تطبيقات واسعة من هذه التقنية تشمل الحيوانات المعدلة وراثيا وتوليد الوهم الجرثومية الخط ، ورسم خرائط مصير الخلايا وفحص الجينات. هنا نحن تصف بروتوكول للoverexpression من EGFP وضربة قاضية ل<em&gt; pkd2</em&gt; من جانب ومرنا morpholino حقن قليل النوكليوتيد.

Watch this Scientific Journal Video about Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos. at JoVE.com

Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Microinjection طريقة راسخة وفعالة لإدخال المؤثرات الأجنبية في الأجنة المخصبة الزرد. هنا ، علينا أن نظهر تقنية microinjection قوية لأداء overexpression مرنا ، والدراسات morpholino ضربة قاضية قليل النوكليوتيد الجينات في الزرد.

Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

An essential tool for investigating the role of a gene during development is the ability to perform gene knockdown, overexpression, and misexpression ...

microinjection-mrna-morpholino-antisense-oligonucleotides-zebrafish

Research

JoVE Journal

Biology

36.5K Views.  Yale University School of Medicine. Microinjection طريقة راسخة وفعالة لإدخال المؤثرات الأجنبية في الأجنة المخصبة الزرد. هنا ، علينا أن نظهر تقنية microinjection قوية لأداء overexpression مرنا ، والدراسات morpholino ضربة قاضية قليل النوكليوتيد الجينات في الزرد.

Video: Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Microinjection of A. aegypti Embryos to Obtain Transgenic Mosquitoes

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue fever.  The techniques for correctly preparing microinjection needles, dessicating embryos, and performing microinjection are demonstrated.

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue fever. The techniques for correctly preparing microinjection needles, dessicating embryos, and performing microinjection are demonstrated.

Microinjection الجنين بعوض ألف الحصول على البعوض المعدلة وراثيا

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue ...

Microinjection of Zebrafish Embryos to Analyze Gene Function

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic oligonucleotides with antisense complementarity to target RNAs, can be added to the embryo to reduce the expression of a particular gene product.  Conversely, processed mRNA can be added to the embryo to increase levels of a gene product.  The vehicle for adding either mRNA or morpholino to an embryo is microinjection.  Microinjection is efficient and rapid, allowing for the injection of hundreds of embryos per hour.  This video shows all the steps involved in microinjection.  Briefly, eggs are collected immediately after being laid and lined up against a microscope slide in a Petri dish.  Next, a fine-tipped needle loaded with injection material is connected to a microinjector and an air source, and the microinjector controls are adjusted to produce a desirable injection volume.  Finally, the needle is plunged into the embryo's yolk and the morpholino or mRNA is expelled.

This video shows how morpholino or mRNA can be injected into zebrafish embryos at the one-cell stage to decrease or increase the level of specific gene products during subsequent development.

Microinjection الجنين اسماك الزرد إلى تحليل وظائف الجينات

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic ...

Two-photon axotomy and time-lapse confocal imaging in live zebrafish embryos

Zebrafish have long been utilized to study the cellular and molecular mechanisms of development by time-lapse imaging of the living transparent embryo. Here we describe a method to mount zebrafish embryos for long-term imaging and demonstrate how to automate the capture of time-lapse images using a confocal microscope. We also describe a method to create controlled, precise damage to individual branches of peripheral sensory axons in zebrafish using the focused power of a femtosecond laser mounted on a two-photon microscope. The parameters for successful two-photon axotomy must be optimized for each microscope. We will demonstrate two-photon axotomy on both a custom built two-photon microscope and a Zeiss 510 confocal/two-photon to provide two examples.

Zebrafish trigeminal sensory neurons can be visualized in a transgenic line expressing GFP driven by a sensory neuron specific promoter 1. We have adapted this zebrafish trigeminal model to directly observe sensory axon regeneration in living zebrafish embryos. Embryos are anesthetized with tricaine and positioned within a drop of agarose as it solidifies. Immobilized embryos are sealed within an imaging chamber filled with phenylthiourea (PTU) Ringers. We have found that embryos can be continuously imaged in these chambers for 12-48 hours. A single confocal image is then captured to determine the desired site of axotomy. The region of interest is located on the two-photon microscope by imaging the sensory axons under low, non-damaging power. After zooming in on the desired site of axotomy, the power is increased and a single scan of that defined region is sufficient to sever the axon. Multiple location time-lapse imaging is then set up on a confocal microscope to directly observe axonal recovery from injury.

Here we describe a method for mounting zebrafish embryos for long-term imaging, two-photon imaging and tissue-damage techniques, and time-lapse confocal imaging.

ثنائي الفوتون axotomy والوقت الفاصل بين التصوير مبائر يعيش في الأجنة الزرد

Zebrafish have long been utilized to study the cellular and molecular mechanisms of development by time-lapse imaging of the living transparent embryo.  ...

Generating Chimeric Zebrafish Embryos by Transplantation

One of the most powerful tools used to gain insight into complex developmental processes is the analysis of chimeric embryos. A chimera is defined as an organism that contains cells from more than one animal; mosaics are one type of chimera in which cells from more than one genotype are mixed, usually wild-type and mutant. In the zebrafish, chimeras can be readily made by transplantation of cells from a donor embryo into a host embryo at the appropriate embryonic stage. Labeled donor cells are generated by injection of a lineage marker, such as a fluorescent dye, into the one-cell stage embryo. Labeled donor cells are removed from donor embryos and introduced into unlabeled host embryos using an oil-controlled glass pipette mounted on either a compound or dissecting microscope. Donor cells can in some cases be targeted to a specific region or tissue of the developing blastula or gastrula stage host embryo by choosing a transplantation site in the host embryo based on well-established fate maps.

A step-by-step guide to generating targeted chimeric zebrafish embryos by transplantation at the blastula or gastrula stage.

توليد الأجنة اسماك الزرد همي بواسطة زرع

One of the most powerful tools used to gain insight into complex developmental processes is the analysis of chimeric embryos. A chimera is defined as an ...

Two-Photon-Based Photoactivation in Live Zebrafish Embryos

Photoactivation of target compounds in a living organism has proven a valuable approach to investigate various biological processes such as embryonic development, cellular signaling and adult physiology. In this respect, the use of multi-photon microscopy enables quantitative photoactivation of a given light responsive agent in deep tissues at a single cell resolution. As zebrafish embryos are optically transparent, their development can be monitored in vivo. These traits make the zebrafish a perfect model organism for controlling the activity of a variety of chemical agents and proteins by focused light. Here we describe the use of two-photon microscopy to induce the activation of chemically caged fluorescein, which in turn allows us to follow cell's destiny in live zebrafish embryos. We use embryos expressing a live genetic landmark (GFP) to locate and precisely target any cells of interest. This procedure can be similarly used for precise light induced activation of proteins, hormones, small molecules and other caged compounds.

Multiphoton microscopy allows control of low energy photons with deep optical penetration and reduced phototoxicity. We describe the use of this technology for live cell labeling in zebrafish embryos. This protocol can be readily adapted for photo-induction of various light-responsive molecules.

ثنائي الفوتون المستندة إلى تنشيط ضوئي في الأجنة الحية اسماك الزرد

Photoactivation of target compounds in a living organism has proven a valuable approach to investigate various biological processes such as embryonic ...

Microinjection of Medaka Embryos for use as a Model Genetic Organism

In this video, we demonstrate the technique of microinjection into one-cell stage medaka embryos. Medaka is a small egg-laying freshwater fish that allows both genetic and embryological analyses and is one of the vertebrate model organisms in which genome-wide phenotype-driven mutant screens were carried out 1, as in zebrafish and the mouse. Divergence of functional overlap of related genes between medaka and zebrafish allows identification of novel phenotypes that are unidentifiable in a single species 2, thus medaka and zebrafish are complementary for genetic dissection of vertebrate genome functions.
To take advantage of medaka fish whose embryos are transparent and develop externally, microinjection is an essential technique to inject cell-tracers for labeling cells, mRNAs or anti-sense oligonucleotides for over-expressing and knocking-down genes of interest, and DNAs for making transgenic lines.

Medaka and zebrafish are complementary for genetic dissection of vertebrate genome functions. This protocol highlights the key points for successful microinjection into medaka embryos, an important technique for embryological and genetic analysis using medaka and zebrafish in a laboratory.

Microinjection الجنين الميداكا لاستخدامها بوصفها كائنا النموذجي الوراثية

In this video, we demonstrate the technique of microinjection into one-cell stage medaka embryos. Medaka is a small egg-laying freshwater fish that allows ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

تحليل حركية مرنا الصادرات النووية في خلايا الثدييات التي Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

Imaging Glycans in Zebrafish Embryos by Metabolic Labeling and Bioorthogonal Click Chemistry

Imaging glycans in vivo has recently been enabled using a bioorthogonal chemical reporter strategy by treating cells or organisms with azide- or alkyne-tagged monosaccharides1, 2. The modified monosaccharides, processed by the glycan biosynthetic machinery, are incorporated into cell surface glycoconjugates. The bioorthogonal azide or alkyne tags then allow covalent conjugation with fluorescent probes for visualization, or with affinity probes for enrichment and glycoproteomic analysis. This protocol describes the procedures typically used for noninvasive imaging of fucosylated glycans in zebrafish embryos, including: 1) microinjection of one-cell stage embryos with GDP-5-alkynylfucose (GDP-FucAl), 2) labeling fucosylated glycans in the enveloping layer of zebrafish embryos with azide-conjugated fluorophores via biocompatible Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC), and 3) imaging by confocal microscopy3. The method described here can be readily extended to visualize other classes of glycans, e.g. glycans containing sialic acid4 and N-acetylgalactosamine5, 6, in developing zebrafish and in other living organisms.

A click-chemistry based method that allows for the rapid, noninvasive, and robust labeling of alkyne-tagged glycans in zebrafish embryos is described. Fucosylated glycans in the enveloping layer of zebrafish embryos in the late gastrulation stage were imaged in this study.

Glycans التصوير في الأجنة التي وصفها اسماك الزرد الاستقلابية والكيمياء Bioorthogonal انقر

Imaging glycans in vivo has recently been enabled using a bioorthogonal chemical reporter strategy by treating cells or organisms with azide- or ...

Metabolic Profile Analysis of Zebrafish Embryos

A growing goal in the field of metabolism is to determine the impact of genetics on different aspects of mitochondrial function. Understanding these relationships will help to understand the underlying etiology for a range of diseases linked with mitochondrial dysfunction, such as diabetes and obesity. Recent advances in instrumentation, has enabled the monitoring of distinct parameters of mitochondrial function in cell lines or tissue explants. Here we present a method for a rapid and sensitive analysis of mitochondrial function parameters in vivo during zebrafish embryonic development using the Seahorse bioscience XF 24 extracellular flux analyser. This protocol utilizes the Islet Capture microplates where a single embryo is placed in each well, allowing measurement of bioenergetics, including: (i) basal respiration; (ii) basal mitochondrial respiration (iii) mitochondrial respiration due to ATP turnover; (iv) mitochondrial uncoupled respiration or proton leak and (iv) maximum respiration. Using this approach embryonic zebrafish respiration parameters can be compared between wild type and genetically altered embryos (mutant, gene over-expression or gene knockdown) or those manipulated pharmacologically. It is anticipated that dissemination of this protocol will provide researchers with new tools to analyse the genetic basis of metabolic disorders in vivo in this relevant vertebrate animal model.

Zebrafish represent a powerful vertebrate model that has been under-utilised for metabolic studies. Here we describe a rapid way to measure the in vivo metabolic profile of developing zebrafish that allows the comparison of different mitochondrial function parameters between genetically or pharmacologically manipulated embryos, thereby increasing the applicability of this organism.

الأيض تحليل الملف من الأجنة الزرد

A growing goal in the field of metabolism is to determine the impact of genetics on different aspects of mitochondrial function. Understanding these ...

Analysis of Oxidative Stress in Zebrafish Embryos

High levels of reactive oxygen species (ROS) may cause a change of cellular redox state towards oxidative stress condition. This situation causes oxidation of molecules (lipid, DNA, protein) and leads to cell death. Oxidative stress also impacts the progression of several pathological conditions such as diabetes, retinopathies, neurodegeneration, and cancer. Thus, it is important to define tools to investigate oxidative stress conditions not only at the level of single cells but also in the context of whole organisms. Here, we consider the zebrafish embryo as a useful in vivo system to perform such studies and present a protocol to measure in vivo oxidative stress. Taking advantage of fluorescent ROS probes and zebrafish transgenic fluorescent lines, we develop two different methods to measure oxidative stress in vivo: i) a &#8220;whole embryo ROS-detection method&#8221; for qualitative measurement of oxidative stress and ii) a &#8220;single-cell&#160;ROS detection method&#8221; for quantitative measurements of oxidative stress. Herein, we demonstrate the efficacy of these procedures by increasing oxidative stress in tissues by oxidant agents and physiological or genetic methods. This protocol is amenable for forward genetic screens and it will help address cause-effect relationships of ROS in animal models of oxidative stress-related pathologies such as neurological disorders and cancer.

Here we report a protocol to measure oxidative stress in living zebrafish embryos. This procedure allows reactive oxygen species (ROS) detection in both whole embryo tissues and single-cell populations. This protocol will accomplish both qualitative and quantitative analyses.