وأيد هذا العمل من قبل المعاهد الوطنية للصحة ومؤسسة PKD لZS. وأجريت التجارب على الحيوانات فقط وفقا لمركز يال الثروة الحيوانية (YARC) والمؤسسية رعاية الحيوان واستخدام المبادئ التوجيهية للجنة (IACUC).

الجزء 1 : إعداد micropipettes وألواح غرفة microinjection <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> افتعال micropipettes عن طريق التسخين وسحب الأنابيب الزجاجية البورسليكات الشعرية (البنك الآلات الدقيقة ، وشركة ، 1B100 - 4) في جهاز مجتذب micropipette (سوتر الآلات ، وشركة يلهب / براون P - 97). مخزن في طبق بتري على أعلى كمية صغيرة من الطين أو شريط لاصق. </li><li style=";text-align:right;direction:rtl"> صب agarose 1.5 ٪ (الاميركي Bioanlytical ، شركة ، AB00972 - 00500) في لوحات 1X المتوسطة E3 مصبوب مع اسفين على شكل أحواض من شأنها أن تكون بمثابة طريقة سهلة لعقد أجنة خلال حقن (كما هو موضح في كتاب &#39;اسماك الزرد&quot;) 1. دعونا لوحات أجار الغرفة ترسيخ قبل استخدام وتخزين عند 4 درجة مئوية. </li></ol> الجزء 2 : إعداد RNA نهج واحد قوي للدراسات وظائف الجينات والحمض النووي الريبي لmicroinject في المختبر توج كتب في الأجنة الزرد. توج الجيش الملكي النيبالي سلوك مشابه إلى mRNAs حقيقية النواة الموجودة في الجسم الحي بسبب وجود تمثيلي CAP. الزرد الباحثين الاستفادة بشكل روتيني لهذا الأسلوب أو overexpress misexpress الجين اهتمامهم. في هذه التظاهرة ، فإننا سوف microinject مستخرج EGFP الموسومة واستخدام كامل يعيش الجنين GFP - التعبير بوصفها قراءات مرئية عن طريق الحقن ناجحة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إجراء في المختبر CAP رد فعل على النص نسخ الحمض النووي الريبي اهتمامك. في المختبر ، ونحن ادخال بشكل روتيني [كدنا] من الاهتمام الى ناقلات + pCS2 وإجراء كرد فعل التوليف المختبر كميات كبيرة من الحمض النووي الريبي توج باستخدام mMachine mMessage SP6 مجموعة (Ambion ، شركة ، AM1340). </li><li style=";text-align:right;direction:rtl"> تنقية عينة الحمض النووي الريبي التي تعمل من خلال مجموعة صغيرة RNeasy (Qiagen ، شركة ، 74104) أو الفينول : استخراج الكلوروفورم والأيزوبروبانول هطول الأمطار. </li><li style=";text-align:right;direction:rtl"> تحديد دقيق للتركيز على إعداد الجيش الملكي النيبالي وتخزينها في -80 درجة مئوية لتصبح جاهزة للاستخدام. </li><li style=";text-align:right;direction:rtl"> في يوم من الحقن ، وأذاب عينة الحمض النووي الريبي ، وتدور الدوامة طفيفة أسفل لفترة وجيزة. </li><li style=";text-align:right;direction:rtl"> يعد حل تعمل مع الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول (سيغما الدريخ شركة P0290). أحمر الفينول بمثابة علامة مرئية لحقن المحلول في جنين. في هذه المقالة ، سوف نستعد حلا مرنا من 100 عامل EGFP نانوغرام / UL مع أحمر الفينول 0.050 ٪. </li><li style=";text-align:right;direction:rtl"> إبقاء عينة تعمل على الجليد وعودة السهم إلى رنا -80 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة. </li></ol> الجزء 3 : إعداد morpholino وتستخدم على نطاق واسع Morpholino [أليغنوكليوتيد] العقاقير لتعديل التعبير الجيني عن طريق منع ترجمة البروتين المستهدف أو عن طريق تعديل قبل مرنا الربط 2،3. Morpholinos في الزرد بمثابة أداة الوراثة العكسية القوية التي هدمت وظيفة الجين. في هذه المقالة ، فإننا سوف microinject a morpholino جزئية تستهدف موقع من بدء متعدية pkd2 (5&#39; - AGGACGAACGCGACTGGAGCTCATC - 3 &#39;). على أساس العمل المحددة مسبقا ، ونحن نتوقع من حقن الأجنة لتقليد phenotypically pkd2 4 الأسماك متحولة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نأذن بشكل روتيني من 300 nmol بنسبة ضئيلة morpholino مصممة خصيصا لجينة من الاهتمام من أدوات الجينات ، LLC (Philomath ، OR). </li><li style=";text-align:right;direction:rtl"> إضافة الماء المعقم UL 100 لجعل مخزون 3 ملم الحل. قسامة الحل وتخزينها في -20 درجة مئوية لتصبح جاهزة للاستخدام. </li><li style=";text-align:right;direction:rtl"> في يوم من الحقن ، والحرارة الحل morpholino عند 65 درجة مئوية لمدة 5 دقائق. المفاجئة باردة على الجليد على الفور وتدور لفترة وجيزة. يبدل طبيعة هذه الخطوة أي الهياكل الثانوية في جزئية ويضمن solubilized تماما الحل. </li><li style=";text-align:right;direction:rtl"> يعد حل العامل تمييع الحل morpholino في الماء المعقم وتركيز النهائي من 0.025 -- 0.050 ٪ أحمر الفينول. في هذه المظاهرة ، سنكون إعداد حل عمل 0.50 ملي pkd2 morpholino مع أحمر الفينول 0.050 ٪. </li><li style=";text-align:right;direction:rtl"> مواصلة العمل على حل درجة حرارة الغرفة. </li><li style=";text-align:right;direction:rtl"> انتقل إلى الجزء 4 عندما تصبح جاهزة لحقن هذه العينة.---- </li></ol> الجزء 4 : تعبئة micropipette مع الحل الخاص العاملة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> قطع رأس القاصية من micropipette بالملقط أو razorblade الجراحية لإنشاء الافتتاح ان يكون مرئيا فقط تحت المجهر تشريح (نيكون الآلات ، وشركة ، SM2645) في التكبير 50X. </li><li style=";text-align:right;direction:rtl"> 2 UL مكان من الحل الخاص بك يعمل انخفاض في الصعود إلى ساترة. </li><li style=";text-align:right;direction:rtl"> نعلق الجزء الخلفي من micropipette إلى حقنة 5 مل مزودة أنابيب على إبرة تحت الجلد ويغرق قليلا الطرف البعيد من micropipette إلى إسقاط الخاص من محلول العمل. الحرص على عدم كسر غيض من micropipette. </li><li style=";text-align:right;direction:rtl"> سيفون الحل من خلال العمل في نهاية البعيدة للmicropipette عن طريق سحب المكبس من المحاقن. </li></ol> الجزء 5 : معايرة حجم الحقن micropipette <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وضع قطرة من الزيت المعدني (الاميركي Bioanalytical ، شركة ، AB00921 - 00025) على شريحة ميكرون (فايشير ، 12 SM1 - 561). </li><li style=";text-align:right;direction:rtl"> بدوره على السلطة والعرض الجوي للضغط نابض الدقيقة حاقن جهاز (وورلد شركة آلات دقيقة ، PV830). </li><li style=";text-align:right;direction:rtl"> إرفاق micropipette لصاحب micropipette جهاز حاقن الجزئي. حاقن هو الضغط الجزئي للتنظيم وتنشيط الإفرازات عن طريق الضغط على دواسة القدم. </li><li style=";text-align:right;direction:rtl"> تشريح تحت المجهر ، واختبار حجم الحقن باستخدام محقنة الدقيقة لوضع قطرة من حل العمل الخاص بك على النفط ميكرون. قياس قطرها من الانخفاض حيث يعوم كمجال على أعلى من النفط. </li><li style=";text-align:right;direction:rtl"> ضبط مدة وضغط الحقن لمعايرة الصوت الخاص بعناية من الحقن. هذه الخطوة يساعد في استنساخ التجربة microinjection. في هذه المظاهرة ، وسيتم ذلك عن microinjections مع قطره قطرة 0.15 ملم (حوالي 1.76 NL في الحجم). </li><li style=";text-align:right;direction:rtl"> مرة واحدة وقد تم معايرة حجم الحقن الخاص ، واستخدام &quot;عقد&quot; مفتاح على حاقن الدقيقة لمنع الردم وتسريب micropipette. </li></ol> الجزء 6 : إعداد الأجنة المخصبة الزرد لmicroinjection <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> والزرد لم عشوائيا في الساعات القليلة الأولى من صباح كل يوم. جمع الأجنة في مرحلة 1 - الخلية ووضعها في 1X المتوسطة E3. </li><li style=";text-align:right;direction:rtl"> باستخدام الماصة نقل 3 مل (بيكتون ديكنسون لابوار ، 357524) ، وترتيب الأجنة على طول أحواض اسفين على شكل لوحات في غرفة microinjection. </li><li style=";text-align:right;direction:rtl"> إزالة المتوسطة بحيث تكون مغمورة ضحلة الأجنة وغمرت لا. هذه الخطوة يساعد في تسوية الأجنة إلى أسفل هبوطا ، وكذلك في الاختراق من قبل المشيماء micropipette. </li></ol> الجزء 7 : Microinjection خلال المشيماء <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التلاعب في الأجنة مع micropipette بحيث السيتوبلازم الجنين مرحلة 1 - الخلية مرئية تحت المجهر تشريح. الحرص على عدم كسر غيض من micropipette. </li><li style=";text-align:right;direction:rtl"> اختراق المشيماء ثم صفار ومع micropipette من أجل حقن في الجنين. في هذه التظاهرة ، فإننا سوف تكون الأولى في microinjecting صفار مباشرة تحت الخلية ، والسماح لتدفق حشوية ونشرها لتحقيق الحل العاملين في الخلية. هذا التدفق غير مرئية بسبب أحمر الفينول وأضاف أن الحل العمل. </li><li style=";text-align:right;direction:rtl"> وسوف نظهر أيضا الحقن المباشر في السيتوبلازم الخلية. microinjection مباشرة في الخلية هو أكثر قوة ولكن وقتا طويلا في اتجاه الجنين السليم وتقنية microinjection هو مطلوب. كما غشاء الخلية هو أكثر صرامة من الغشاء المحي ، غالبا ما يكون أسرع لدخول micropipette صفار من خلال التوصل إلى السيتوبلازم الخلية. قد توجيه القطب الحيواني نحو قاع الحوض ، والعمل مع المعونة أيدي ثابتة في هذا الأسلوب من الحقن. </li><li style=";text-align:right;direction:rtl"> بعد microinjection ، وضع الأجنة في طبق بيتري مع E3 المتوسطة واحتضان لهم في التطور الطبيعي ل28.5 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> خلال الساعات القليلة المقبلة والأيام من تطور الجنين ، مراقبة الجنين عن الظواهر اهتمامك. </li></ol> الجزء 8 : نتائج الممثل EGFP مرنا overexpression : التحقق من نجاح microinjection ، وسوف نقوم بمراقبة التعبير عن GFP في الأجنة النامية في مرحلة بداية درع (~ 6 HPF) في الجسم الحي بواسطة المجهر مضان كامل الجنين (لايكا مايكروسيستمز GMBH ، MZFLIII). التعبير عن بناء أكثر قوية خلال الأحداث المبكرة من التطور الجنيني ، وسوف يقلل كثيرا خلال التنمية كما توج حقن الحمض النووي الريبي هو المتدهورة بشكل تدريجي ويعتمد على استقرار البروتين المعبر عنها. pkd2 متعدية حجب morpholino : بناء على النتائج المنشورة سابقا ، فإننا نتوقع أن morphants pkd2 لتقليد محور الجسم الظهري انحناء كما وجدت في pkd2 الزرد متحولة والخراجات الكلى حاضرا في حوالي 2 -- 3 4 DPF. <img src="/files/ftp_upload/1113/1113fig1.png" alt="الشكل 1" /> الشكل 1 : نتائج من الممثل microinjection من EGFP مرنا وpkd2 morpholino أغسطس (أ) كانت microinjected TAB الأجنة في مرحلة 1 - زنزانة مع 0.17 نانوغرام من EGFP مرنا وتصور في 1 DPF في التعبير عن GFP الجسم الحي. (ب ، ج) وmicroinjected TAB الأجنة في مرحلة 1 - NL زنزانة مع 1،7 ~ من morpholino متعدية pkd2 حظر عند 0.50 ملم وسجل للانحناء الجسم الظهري في 4 DPF.

<ol>
	<li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Nasevicius, A., Ekker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+targeted+gene+'knockdown'+in+zebrafish.">Effective targeted gene 'knockdown' in zebrafish.</a> Nat Genet. 26, 216-220 (2000).</li><li>Draper, B., Morcos, P., Kimmel, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+zebrafish+fgf8+pre-mRNA+splicing+with+morpholino+oligos:+a+quantifiable+method+for+gene+knockdown.">Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown.</a> Genesis. 30, 154-156 (2001).</li><li>Sun, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+zebrafish+identifies+cilia+genes+as+a+principal+cause+of+cystic+kidney.">A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney.</a> Development. 131, 4085-4093 (2004).</li><li>Stuart, G., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication,+integration+and+stable+germ-line+transmission+of+foreign+sequences+injected+into+early+zebrafish+embryos.">Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos.</a> Development. 103, 403-412 (1988).</li><li>Stuart, G., Vielkind, J., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+lines+of+transgenic+zebrafish+exhibit+reproducible+patterns+of+transgene+expression.">Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression.</a> Development. 109, 577-584 (1990).</li><li>Culp, P., N&#252;sslein-Volhard, C., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+germ-line+transmission+of+plasmid+DNA+sequences+injected+into+fertilized+zebrafish+eggs.">High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs.</a> Proc Natl Acad Sci U S A. 88, 7953-7957 (1991).</li><li>Strehlow, D., Heinrich, G., Gilbert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fates+of+the+blastomeres+of+the+16-cell+zebrafish+embryo.">The fates of the blastomeres of the 16-cell zebrafish embryo.</a> Development. 120, 1791-1798 (1994).</li><li>Helde, K., Wilson, E., Cretekos, C., Grunwald, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+early+cells+to+the+fate+map+of+the+zebrafish+gastrula.">Contribution of early cells to the fate map of the zebrafish gastrula.</a> Science. 265, 517-520 (1994).</li><li>Lin, S., Long, W., Chen, J., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+germ-line+chimeras+in+zebrafish+by+cell+transplants+from+genetically+pigmented+to+albino+embryos.">Production of germ-line chimeras in zebrafish by cell transplants from genetically pigmented to albino embryos.</a> Proc Natl Acad Sci U S A. 89, 4519-4523 (1992).</li><li>Long, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GATA-1+expression+pattern+can+be+recapitulated+in+living+transgenic+zebrafish+using+GFP+reporter+gene.">GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene.</a> Development. 124, 4105-4111 (1997).</li><li>Murphey, R., Zon, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecule+screening+in+the+zebrafish.">Small molecule screening in the zebrafish.</a> Methods. 39, 255-261 (2006).</li></ol>

Microinjection في الأجنة الزرد هي تقنية راسخة وقوية لاستكشاف دور جين خاص في مجال التنمية. وتشمل التطبيقات overexpression ، misexpression ، وضربة قاضية لفحوصات الجينات اهتمامك ، فضلا عن تحليل روكبي بين جينات متعددة. وقد Microinjection في الزرد المستخدمة على نطاق واسع لتوليد حيوانات معدلة وراثي?...

يتم سرد كافة المواد الأخرى في البروتوكول.

microinjection of mrna and morpholino antisense oligonucleotides in zebrafish embryos.

أداة أساسية للتحقيق في دور الجينات خلال التنمية هو القدرة على تنفيذ ضربة قاضية الجينات ، overexpression والدراسات misexpression. في الزرد (<em&gt; دانيو rerio</em&gt;) ، microinjection من الحمض النووي الريبي ، والحمض النووي والبروتينات والعقاقير [أليغنوكليوتيد] والجزيئات الصغيرة الأخرى في الجنين النامية تقدم الباحثون فحص سريعة وقوية لاستكشاف وظائف الجينات<em&gt; في الجسم الحي</em&gt;. في هذه المقالة عن طريق الفيديو ، وسوف نقوم شرح كيفية إعداد وmicroinject<em&gt; في المختبر</em&gt; توليفها EGFP مرنا ومتعدية للحظر جزئية ضد morpholino<em&gt; pkd2</em&gt; ، وهو الجين المرتبط راثي جسمي أمراض الكلى المتعدد الكيسات (ADPKD) ، إلى خلايا الأجنة 1 الزرد المرحلة. وسوف نقوم بتحليل ثم نجاح مرنا وmicroinjections morpholino من خلال التحقق من التعبير GFP وتحليل النمط الظاهري. تطبيقات واسعة من هذه التقنية تشمل الحيوانات المعدلة وراثيا وتوليد الوهم الجرثومية الخط ، ورسم خرائط مصير الخلايا وفحص الجينات. هنا نحن تصف بروتوكول للoverexpression من EGFP وضربة قاضية ل<em&gt; pkd2</em&gt; من جانب ومرنا morpholino حقن قليل النوكليوتيد.

Watch this Scientific Journal Video about Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos. at JoVE.com

Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Microinjection طريقة راسخة وفعالة لإدخال المؤثرات الأجنبية في الأجنة المخصبة الزرد. هنا ، علينا أن نظهر تقنية microinjection قوية لأداء overexpression مرنا ، والدراسات morpholino ضربة قاضية قليل النوكليوتيد الجينات في الزرد.

Microinjection من مرنا والعقاقير [أليغنوكليوتيد] Morpholino اسماك الزرد في الأجنة.

An essential tool for investigating the role of a gene during development is the ability to perform gene knockdown, overexpression, and misexpression ...

microinjection-mrna-morpholino-antisense-oligonucleotides-zebrafish

Research

JoVE Journal

Biology

36.6K Views.  Yale University School of Medicine. Microinjection طريقة راسخة وفعالة لإدخال المؤثرات الأجنبية في الأجنة المخصبة الزرد. هنا ، علينا أن نظهر تقنية microinjection قوية لأداء overexpression مرنا ، والدراسات morpholino ضربة قاضية قليل النوكليوتيد الجينات في الزرد.

Video: Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Infection of Zebrafish Embryos with Intracellular Bacterial Pathogens

Zebrafish (Danio rerio) embryos are increasingly used as a model for studying the function of the vertebrate innate immune system in host-pathogen interactions 1. The major cell types of the innate immune system, macrophages and neutrophils, develop during the first days of embryogenesis prior to the maturation of lymphocytes that are required for adaptive immune responses. The ease of obtaining large numbers of embryos, their accessibility due to external development, the optical transparency of embryonic and larval stages, a wide range of genetic tools, extensive mutant resources and collections of transgenic reporter lines, all add to the versatility of the zebrafish model. Salmonella enterica serovar Typhimurium (S. typhimurium) and Mycobacterium marinum can reside intracellularly in macrophages and are frequently used to study host-pathogen interactions in zebrafish embryos. The infection processes of these two bacterial pathogens are interesting to compare because S. typhimurium infection is acute and lethal within one day, whereas M. marinum infection is chronic and can be imaged up to the larval stage 2, 3. The site of micro-injection of bacteria into the embryo (Figure 1) determines whether the infection will rapidly become systemic or will initially remain localized. A rapid systemic infection can be established by micro-injecting bacteria directly into the blood circulation via the caudal vein at the posterior blood island or via the Duct of Cuvier, a wide circulation channel on the yolk sac connecting the heart to the trunk vasculature. At 1 dpf, when embryos at this stage have phagocytically active macrophages but neutrophils have not yet matured, injecting into the blood island is preferred. For injections at 2-3 dpf, when embryos also have developed functional (myeloperoxidase-producing) neutrophils, the Duct of Cuvier is preferred as the injection site. To study directed migration of myeloid cells towards local infections, bacteria can be injected into the tail muscle, otic vesicle, or hindbrain ventricle 4-6. In addition, the notochord, a structure that appears to be normally inaccessible to myeloid cells, is highly susceptible to local infection 7. A useful alternative for high-throughput applications is the injection of bacteria into the yolk of embryos within the first hours after fertilization 8. Combining fluorescent bacteria and transgenic zebrafish lines with fluorescent macrophages or neutrophils creates ideal circumstances for multi-color imaging of host-pathogen interactions. This video article will describe detailed protocols for intravenous and local infection of zebrafish embryos with S. typhimurium or M. marinum bacteria and for subsequent fluorescence imaging of the interaction with cells of the innate immune system.

Transparent zebrafish embryos have proved useful model hosts to visualize and functionally study interactions between innate immune cells and intracellular bacterial pathogens, such as Salmonella typhimurium and Mycobacterium marinum. Micro-injection of bacteria and multi-color fluorescence imaging are essential techniques involved in the application of zebrafish embryo infection models.

إصابة الأجنة الزرد مع مسببات الأمراض البكتيرية بين الخلايا

Zebrafish (Danio rerio) embryos are increasingly used as a model for studying the function of the vertebrate innate immune system in host-pathogen ...

Immunology and Infection

Microinjection of Zebrafish Embryos to Analyze Gene Function

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic oligonucleotides with antisense complementarity to target RNAs, can be added to the embryo to reduce the expression of a particular gene product.  Conversely, processed mRNA can be added to the embryo to increase levels of a gene product.  The vehicle for adding either mRNA or morpholino to an embryo is microinjection.  Microinjection is efficient and rapid, allowing for the injection of hundreds of embryos per hour.  This video shows all the steps involved in microinjection.  Briefly, eggs are collected immediately after being laid and lined up against a microscope slide in a Petri dish.  Next, a fine-tipped needle loaded with injection material is connected to a microinjector and an air source, and the microinjector controls are adjusted to produce a desirable injection volume.  Finally, the needle is plunged into the embryo's yolk and the morpholino or mRNA is expelled.

This video shows how morpholino or mRNA can be injected into zebrafish embryos at the one-cell stage to decrease or increase the level of specific gene products during subsequent development.

Microinjection الجنين اسماك الزرد إلى تحليل وظائف الجينات

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic ...

Micromanipulation of Gene Expression in the Adult Zebrafish Brain Using Cerebroventricular Microinjection of Morpholino Oligonucleotides

Manipulation of gene expression in tissues is required to perform functional studies. In this paper, we demonstrate the cerebroventricular microinjection (CVMI) technique as a means to modulate gene expression in the adult zebrafish brain. By using CVMI, substances can be administered into the cerebroventricular fluid and be thoroughly distributed along the rostrocaudal axis of the brain. We particularly focus on the use of antisense morpholino oligonucleotides, which are potent tools for knocking down gene expression in vivo. In our method, when applied, morpholino molecules are taken up by the cells lining the ventricular surface. These cells include the radial glial cells, which act as neurogenic progenitors. Therefore, knocking down gene expression in the radial glial cells is of utmost importance to analyze the widespread neurogenesis response in zebrafish, and also would provide insight into how vertebrates could sustain adult neurogenesis response. Such an understanding would also help the efforts for clinical applications in human neurodegenerative disorders and central nervous system regeneration. Thus, we present the cerebroventricular microinjection method as a quick and efficient way to alter gene expression and neurogenesis response in the adult zebrafish forebrain. We also provide troubleshooting tips and other useful information on how to carry out the CVMI procedure.

In this article, we demonstrate a method for manipulation of gene expression in the ventricular cells of the adult zebrafish telencephalon using antisense morpholino oligonucleotides. We present this method as an efficient and quick protocol that can be used for functional studies in the adult vertebrate brain.

المجهرية من التعبير الجيني في الدماغ اسماك الزرد الكبار عن طريق حقن مكروي Cerebroventricular [أليغنوكليوتيد] Morpholino

Manipulation of gene expression in tissues is  required to perform functional studies. In this paper, we demonstrate the  cerebroventricular ...

Neuroscience

Design and Microinjection of Morpholino Antisense Oligonucleotides and mRNA into Zebrafish Embryos to Elucidate Specific Gene Function in Heart Development

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression. Morpholinos (MOs) have the advantage in biological stability over DNA oligos because they are not susceptible to enzymatic degradation. For optimal effectiveness, MOs are injected into 1-4 cell stage embryos. The temporal efficacy of knockdown is variable, but MOs are believed to lose their effects due to dilution eventually. Morpholino dilution and injection amount should be closely controlled to minimize the occurrence of off-target effects while maintaining on-target efficacy. Additional complementary tools, such as CRISPR/Cas9 should be performed against the target gene of interest to generate mutant lines and to confirm the morphant phenotype with these lines. This article will demonstrate how to design, prepare, and microinject a translation-blocking morpholino against hand2 into the yolk of 1-4 cell stage zebrafish embryos to knockdown hand2 function and rescue these "morphants" by co-injection of mRNA encoding the corresponding cDNA. Subsequently, the efficacy of the morpholino microinjections is assessed by first verifying the presence of morpholino in the yolk (co-injected with phenol red) and then by phenotypic analysis. Moreover, cardiac functional analysis to test for knockdown efficacy will be discussed. Finally, assessing the effect of morpholino-induced blockage of gene translation via western blotting will be explained.

The present protocol describes designing, preparing, and microinjecting a translational-blocking morpholino against a representative cardiac gene; Heart And Neural Crest Derivatives Expressed2 (hand2) into the yolk of newly fertilized zebrafish embryos to knock down gene function. It also shows a transient rescue of these "morphants" by co-injection of mRNA encoding this gene product.

The morpholino oligomer-based knockdown system has been used to identify the function of various gene products through loss or reduced expression.  ...

Developmental Biology

Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development

In recent years, electroporation has become a popular technique for in vivo transfection of DNA, RNA, and morpholinos into various tissues, including the eye, brain, and somites of zebrafish. The advantage of electroporation over other methods of genetic manipulation is that specific tissues can be targeted, both spatially and temporally, for the introduction of macromolecules by the application of electrical current. Here we describe the use of electroporation for transfecting mif and mif-like morpholinos into the tissues of the developing inner ear of the zebrafish. In past studies, mif morpholino injected into embryos at the 1- to 8-cell stage resulted in widespread morphological changes in the nervous system and eye, as well as the ear. By targeting the tissues of the inner ear at later stages in development, we can determine the primary effects of MIF in the developing inner ear, as opposed to secondary effects that may result from the influence of other tissues. By using phalloidin and acetylated tubulin staining to study the morphology of neurons, neuronal processes, and hair cells associated with the posterior macula, we were able to assess the efficacy of electroporation as a method for targeted transfection in the zebrafish inner ear. The otic vesicles of 24hpf embryos were injected with morpholinos and electroporated and were then compared to embryos that had received no treatment or had been only injected or electroporated. Embryos that were injected and electroporated showed a decrease in hair cell numbers, decreased innervation by the statoacoustic ganglion (SAG) and fewer SAG neurons compared with control groups. Our results showed that direct delivery of morpholinos into otocysts at later stages avoids the non-specific nervous system and neural crest effects of morpholinos delivered at the 1-8 cell stage. It also allows examination of effects that are directed to the inner ear and not secondary effects on the ear from primary effects on the brain, neural crest or periotic mesenchyme.

A method to deliver morpholinos directly into the zebrafish otocyst at 24hpf has been developed. Using microinjection of morpholinos into the lumen of otic vesicle and electroporation to effect penetration, we were able to bypass the effect of morpholinos on the brain and obtain effects specific to the inner ear.

التسليم المباشر للMorpholinos MIF في Otocyst اسماك الزرد عن طريق الحقن وElectroporation يؤثر على التنمية الداخلية الأذن

In recent years, electroporation has become a popular technique for in vivo transfection of DNA, RNA, and morpholinos into various tissues, including the ...

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal neurons. In contrast, the adult zebrafish retina possesses the robust ability to spontaneously regenerate any neuronal class that is lost in a variety of different retinal damage models, including retinal puncture, chemical ablation, concentrated high temperature, and intense light treatment 1-8. Our lab extensively characterized regeneration of photoreceptors following constant intense light treatment and inner retinal neurons after intravitreal ouabain injection 2, 5, 9. In all cases, resident M&uuml;ller glia re-enter the cell cycle to produce neuronal progenitors, which continue to proliferate and migrate to the proper retinal layer, where they differentiate into the deficient neurons. 
	We characterized five different stages during regeneration of the light-damaged retina that were highlighted by specific cellular responses. We identified several differentially expressed genes at each stage of retinal regeneration by mRNA microarray analysis 10. Many of these genes are also critical for ocular development. To test the role of each candidate gene/protein during retinal regeneration, we needed to develop a method to conditionally limit the expression of a candidate protein only at times during regeneration of the adult retina. 
	Morpholino oligos are widely used to study loss of function of specific proteins during the development of zebrafish, Xenopus, chick, mouse, and tumors in human xenografts 11-14. These modified oligos basepair with complementary RNA sequence to either block the splicing or translation of the target RNA. Morpholinos are stable in the cell and can eliminate or "knockdown" protein expression for three to five days 12. 
	Here, we describe a method to efficiently knockdown target protein expression in the adult zebrafish retina. This method employs lissamine-tagged antisense morpholinos that are injected into the vitreous of the adult zebrafish eye. Using electrode forceps, the morpholino is then electroporated into all the cell types of the dorsal and central retina. Lissamine provides the charge on the morpholino for electroporation and can be visualized to assess the presence of the morpholino in the retinal cells. 
	Conditional knockdown in the retina can be used to examine the role of specific proteins at different times during regeneration. Additionally, this approach can be used to study the role of specific proteins in the undamaged retina, in such processes as visual transduction and visual processing in second order neurons.

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

A method to conditionally knockdown a target protein&#x2019;s expression in the adult zebrafish retina is described, which involves intravitreally injecting antisense morpholinos and electroporating them into the retina. The resulting protein is knocked down for several days, which allows testing the protein&#x2019;s role in the regenerating or intact retina.

في الجسم الحي من Electroporation Morpholinos في شبكية العين اسماك الزرد الكبار

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal ...

Reverse Genetic Morpholino Approach Using Cardiac Ventricular Injection to Transfect Multiple Difficult-to-target Tissues in the Zebrafish Larva

The zebrafish is an important model to understand the cell and molecular biology of organ and appendage regeneration. However, molecular strategies to employ reverse genetics have not yet been adequately developed to assess gene function in regeneration or tissue homeostasis during larval stages after zebrafish embryogenesis, and several tissues within the zebrafish larva are difficult to target. Intraventricular injections of gene-specific morpholinos offer an alternative method for the current inability to genomically target zebrafish genes in a temporally controlled manner at these stages. This method allows for complete dispersion and subsequent incorporation of the morpholino into various tissues throughout the body, including structures that were formerly impossible to reach such as those in the larval caudal fin, a structure often used to noninvasively research tissue regeneration. Several genes activated during larval finfold regeneration are also present in regenerating adult vertebrate tissues, so the larva is a useful model to understand regeneration in adults. This morpholino dispersion method allows for the quick and easy identification of genes required for the regeneration of larval tissues as well as other physiological phenomena regulating tissue homeostasis after embryogenesis. Therefore, this delivery method provides a currently needed strategy for temporal control to the evaluation of gene function after embryogenesis.&#160;

An adaptable reverse genetic method for zebrafish to assess gene function during later stages of development and physiological homeostasis such as tissue regeneration using intraventricular injections of gene-specific morpholinos.

عكس النهج الوراثية عن طريق القلب البطيني Morpholino حقن لبالنقل متعددة يصعب الهدف الأنسجة في الزرد اليرقة

The zebrafish is an important model to understand the cell and molecular biology of organ and appendage regeneration. However, molecular strategies to ...

Gene Silencing with Morpholinos

Morpholino-mediated gene silencing is a common technique used to study roles of specific genes during development. Morpholinos inhibit gene expression by hybridizing to complementary mRNAs. Due to their unique chemistry, morpholinos are easy to produce and store, which makes them remarkably cost effective compared to other gene silencing methods.
This video reviews proper experimental design when using these oligonucleotides. Following that, an explanation of morpholino microinjection techniques in zebrafish and the analysis of resulting phenotypes will be discussed. Finally, we showcase examples of specific applications where morpholino technology is used to model developmental disorders or to study tissue regeneration.

Morpholino Technology: Gene Silencing in Zebrafish

Morpholino-mediated gene silencing is a common technique used to study roles of specific genes during development. Morpholinos inhibit gene expression by ...

Education

JoVE Science Education

Advanced Biology

Zebrafish Microinjection Techniques

One of the major advantages to working with zebrafish (Danio rerio) is that their genetics can be easily manipulated by microinjection of early stage embryos. Using this technique, solutions containing genetic material or knockdown constructs are delivered into the blastomeres: the embryonic cells sitting atop the yolk of the newly fertilized egg. Delivery into the cytoplasm is achieved either through direct injection into the blastomere, or via natural cytoplasmic movements that occur after a solution is injected into the yolk. Successful genetic manipulations are usually followed by quantification of embryonic phenotypes in order to elucidate the genetic mechanisms of development.
This video will provide an introduction to carrying out microinjections in zebrafish embryos. The discussion begins with a review of the essential tools for the technique, including the injection apparatus and the microinjector, which controls fluid movement with pressure pulses of air. Next, important preparatory steps are demonstrated, such as the pouring of agar plates to stabilize embryos during injection and calibration of the microinjection apparatus. The injection procedure is then presented along with tips on when and where injections should be performed. Finally, applications of the microinjection technique are discussed, including gene overexpression via mRNA injection, gene silencing by delivery of antisense morpholino oligonucleotides, and the generation of transgenic zebrafish using specially engineered plasmid DNA.

Introduction to Microinjection of Early Zebrafish Embryos

One of the major advantages to working with zebrafish (Danio rerio) is that their genetics can be easily manipulated by microinjection of early stage ...

Basic Biology

Biology II: Mouse, Zebrafish, and Chick

Morpholino Injection: A Method to Knockdown Target Gene Expression to Study Function in Zebrafish

Source: Hyde D.R., et al. <a href="https://www.jove.com/v/3632/" target="_blank">In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin</a>. J. Vis. Exp. (2012)
The protocol describes targeted knockdown of gene expression in zebrafish by morpholino injection in the tail.