이 작품은 ZS에 NIH와 PKD 기초에 의해 지원되었다. 모든 동물 실험은 예일 동물 자원 센터 (YARC) 및 기관 동물 관리 및 사용위원회 (IACUC) 지침에 따라 실시되었다.

1 부 : micropipettes의 작성, 그리고 microinjection 챔버 플레이트 <ol><li> 난방 및 micropipette의 끌어당기는 장치 borosilicate 유리 모세관 튜브 (세계 정밀 계측기, 주식 회사, 1B100 - 4) 당기 (셔터 인 스트 루먼트 주식 회사, 플라밍 / 브라운 P - 97)에 의해 micropipettes를 조작. 점토 또는 접착 테이프의 소량 위에는 배양 접시에 보관하십시오. </li><li> (같은 &#39;Zebrafish 도서 &quot;에서 설명)를 주사하는 동안 태아를 들고위한 쉬운 방법으로 될 것입니다 쐐기 모양의 골짜기로 성형 1X E3 중간 플레이트에서 1.5 % 아가로 오스를 (미국 Bioanlytical, 주식 회사, AB00972 - 00500) 부어 1. 한천 챔버 플레이트 4 º C.에서 사용하고 저장하기 전에 응고하자 </li></ol> 2 부 : RNA의 준비 유전자 기능 연구에 대한 하나의 강력한 접근 방식은 zebrafish 배아의 체외 베꼈는데 덮인 RNA에 microinject하는 것입니다. 뒤덮힌 RNA는 CAP 아날로그의 존재에 의한 생체내에있는 진핵세포 mRNAs와 비슷하게 동작합니다. Zebrafish 연구자들은 일상적으로 관심이 자신의 유전자를 overexpress 또는 misexpress이 방법을 활용합니다. 이 예제에서 우리는 EGFP - 태그 사본을 microinject하고 성공적인 주사에 대한 눈에 띄는 판독으로 살고 전체 - 배아 GFP 표현을 사용합니다. <ol><li> 관심의 사본에 체외 CAP RNA의 전사 반응을 수행합니다. 우리가 실험실에서, 우리는 정기적으로 pCS2 + 벡터에 관심이 cDNA를 삽입하고 mMessage mMachine SP6 키트 (앰비온, 주식 회사, AM1340)를 사용 덮인 RNA의 대량의 체외 합성 반응을 수행합니다. </li><li> RNeasy 미니 키트 (Qiagen, 주식, 74104)를 통해 그것을 실행하거나 페놀에 의해 RNA 샘플을 정화 : 클로로포름 추출 및 이소프로판올 석출합니다. </li><li> 신중하게 사용하기 위해 준비까지 -80 º C에서 RNA의 준비와 저장소의 농도를 결정합니다. </li><li> 주사 당일, 가볍게 RNA 샘플, 소용돌이를 해동하고 간단히 스핀 다운. </li><li> 0.050 % 페놀 레드 (시그마 - 알드리치 (주), P0290) - 살균 물, 0.025의 최종 농도와 함께 작동하는 솔루션을 준비합니다. 페놀 레드는 배아로 솔루션의 주입에 대한 눈에 띄는 표지 역할을합니다. 이 문서에서는, 우리는 0.050 % 페놀 레드 100 NG / UL EGFP의 mRNA의 작업 솔루션을 준비합니다. </li><li> -80 ° C.에 얼음과 반환 RNA 재고 작업 샘플을 보관 </li><li> 경우이 샘플을 주입 준비 4 부로 진행합니다. </li></ol> 파트 3 : morpholino의 작성 Morpholino 안티 센스 oligonucleotides 널리 타겟 단백질의 번역을 차단하거나 사전 mRNA의 splicing 2,3를 수정하여 유전자 발현을 수정하는 데 사용됩니다. zebrafish에 Morpholinos는 유전자 기능을 쓰러뜨린하여 강력한 반대 유전학의 도구로 제공하고 있습니다. 이 문서에서는, 우리는 pkd2의 translational 개시 사이트 (5&#39; - AGGACGAACGCGACTGGAGCTCATC - 3 &#39;)를 타겟으로하는 morpholino oligo를 microinject 것입니다. 이전에 설립 작업을 바탕으로, 우리는 주입된 배아가 phenotypically pkd2 돌연변이 물고기 4 모방 것으로 기대합니다. <ol><li> 우리는 일상적으로 특별히 진 도구에서 관심의 유전자, LLC (필로 매스, OR)을위한 morpholino oligo 300 nmol 주문. </li><li> 3 MM 주식 솔루션을 100 UL 멸균 물을 추가합니다. 사용을위한 준비까지 -20 ° C에서 나누어지는 솔루션 및 저장합니다. </li><li> 주사 당일, 65에서 morpholino 솔루션을 열 5 분 ° C. 즉시 얼음에 냉각 스냅 그리고 짧게 스핀. 이 단계는 oligo에 보조 구조 denatures 및 솔루션 완전히 solubilized 것을 보장합니다. </li><li> 0.050 % 페놀 레드 - 살균 물, 0.025의 최종 농도에 morpholino 솔루션을 diluting에 의해 작동하는 솔루션을 준비합니다. 이 예제에서, 우리는 0.050 % 페놀 레드와 0.50 MM pkd2 morpholino의 작업 솔루션을 준비할 것이다. </li><li> 실온에서 솔루션을 계속해. </li><li> 경우이 샘플을 주입 준비 4 부로 진행합니다 .---- </li></ol> 4 부 : 귀하의 작업 솔루션 micropipette를 필링 <ol><li> 포셉와 micropipette의 말초 팁 또는 50X 배율에서 해부 현미경 (니콘 인스 트루먼 트 주식 회사, SM2645)의 단지 보이는 개방을 만드는 수술 razorblade 컷. </li><li> coverslip에 드롭으로 작업 솔루션의 플레이스 2 UL. </li><li> 피하 주사 바늘과 약간 잠수함 작업 솔루션의 드롭에 micropipette의 말초 팁을에 튜브가 장착되어 5 ML의 주사기에 micropipette의 뒷면을 연결합니다. micropipette의 팁을 휴식 않도록주의를 가져가라. </li><li> 주사기의 플런저를 당기는하여 micropipette의 말초 끝에 통해 작업 솔루션을 사이픈. </li></ol> 5 부 : micropipette 사출 볼륨을 눈금 보정 <ol><li> 마이크로 미터 슬라이드에 광유의 드롭 (미국 Bioanalytical, 주식 회사, AB00921 - 00025) (FI를 배치쉐어, 12-561 - SM1). </li><li> 압력 펄스 마이크로 연료 분사 장치 (세계 정밀 계측기 주식 회사, PV830)에 전원 및 공기 공급을 켜십시오. </li><li> 마이크로 연료 분사 장치의 micropipette 홀더에 micropipette을 첨부합니다. 마이크로 연료 분사 압력과 배출 규제가 발 페달을 눌러 활성화됩니다있다. </li><li> 해부 현미경 아래에서 마이크로 미터 기름에 귀하의 작업 솔루션의 한 방울을 배치하기 위해 마이크로 인젝터를 사용하여 사출 볼륨을 테스트합니다. 그것은 기름 위에 구형의 수레로 드롭의 직경을 측정합니다. </li><li> 기간 및 신중하게 분사의 볼륨을 조정하기 위해 사출 압력을 조정합니다. 이 단계는 microinjection 실험의 재현성에 에이즈. 이 예제에서는 모든 microinjections은 0.15 mm (볼륨에서 약 1.76 NL)의 드롭 직경 할 것입니다. </li><li> 주사 볼륨이 보정되면 backfilling 및 micropipette의 누출을 방지하기 위해 마이크로 인젝터에있는 &quot;대기&quot;노브를 사용합니다. </li></ol> 6 부 : microinjection에 대비하여 수정된 zebrafish의 배아 <ol><li> Zebrafish는 무작위로 매일 아침의 처음 몇 시간 짝짓기합니다. 1 세포 단계에서 배아를 수집하고 1X E3 미디어에서 그들을 놓으십시오. </li><li> 3 ML 전송 pipet (백톤 디킨슨 Labware, 357,524)를 사용하여 microinjection 챔버 플레이트에 쐐기 모양의 골짜기를 따라 배아를 준비. </li><li> 배아가 shallowly 잠수과 침수되지 않도록 매체를 제거합니다. 이 단계는 아니라 micropipette하여 chorion의 침투에로 골짜기의 바닥에 배아를 정착 에이즈. </li></ol> 7 부 : chorion 통해 Microinjection <ol><li> 1 세포 단계의 배아의 세포질은 해부 현미경으로 볼 수 있도록 micropipette으로 배아를 조작. micropipette의 팁을 휴식 않도록주의를 가져가라. </li><li> 배아에 주입하기 위해 micropipette와 chorion 노른자를 침투. 이 예제에서, 우리는 먼저 직접 셀에 아래의 노른자에 microinjecting 수 있으며, 세포로 작업 솔루션을 제공할 수 세포질 유동 및 확산을 수 있습니다. 이 흐름은 작업 솔루션에 추가 페놀 레드로 인해 볼 수 있습니다. </li><li> 우리는 또한 세포 세포질에 직접 주입을 설​​명합니다. 셀에 직접 microinjection 더 강력한하지만 적절한 배아 오리 엔테이션과 microinjection 기술이 필요합니다 같은 시간 소모됩니다. 세포막은 노른자 막보다 엄격한이기 때문에, 그것은 세포 세포질에 도달 노른자를 통해 micropipette를 입력하는 것이 빠르다. 여물 하단으로 동물 극을 Orienting하고 지속적인 손으로 작업하는 것은 주입이 방법에 도움이됩니다. </li><li> microinjection 후, E3 매체와 페트리 접시에 배아를 장소와 28.5에서 그들을 품어 ° C를 일반 개발. </li><li> 배아 개발의 다음 몇 시간 일 동안 관심의 phenotypes에 대한 배아를 관찰합니다. </li></ol> 8 부 : 대표 결과 EGFP의 mRNA의 overexpression : microinjection의 성공을 확인하려면, 우리는 (Leica 마이크로 GmbH를, MZFLIII) 생체내 전체 - 배아 형광 현미경에 의해 보호막 단계 (~ 6 HPF)에서 시작 개발 배아에서 GFP의 표현을 모니터링합니다. 구조 표현 배아 발달의 초기 이벤트 기간 동안 가장 강력한이며 주입 뒤덮힌 RNA가 점진적으로 저하되고 표현 단백질의 안정성에 따라 자주 개발하는 동안 감소됩니다. pkd2 translational 차단 morpholino : 이전에 게시된 결과를 바탕으로, 우리가 pkd2 morphants과 같이 약 2 pkd2 돌연변이 zebrafish와 현재 신장 cysts에있는 등 지느러미 본문 축 곡률 모방 기대 - 3 DPF 4. <img src="/files/ftp_upload/1113/1113fig1.png" alt="그림 1" /> 그림 1 : EGFP의 mRNA와 pkd2 AUG morpholino의 microinjection에서 대표 발생합니다. (A) 탭 배아는 EGFP mRNA의 0.17 NG와 1 세포 단계에서 microinjected 및 생체내 GFP 발현에 1 DPF에 시각되었습니다. (B, C) ​​탭 배아는 0.50 밀리미터에서 pkd2 translational 차단 morpholino의 ~ 1.7 NL과 1 세포 단계에서 microinjected 4 DPF에서 지느러미 신체 곡률에 대한 채점했다.

<ol>
	<li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Nasevicius, A., Ekker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effective+targeted+gene+'knockdown'+in+zebrafish.">Effective targeted gene 'knockdown' in zebrafish.</a> Nat Genet. 26, 216-220 (2000).</li><li>Draper, B., Morcos, P., Kimmel, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+zebrafish+fgf8+pre-mRNA+splicing+with+morpholino+oligos:+a+quantifiable+method+for+gene+knockdown.">Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown.</a> Genesis. 30, 154-156 (2001).</li><li>Sun, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+screen+in+zebrafish+identifies+cilia+genes+as+a+principal+cause+of+cystic+kidney.">A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney.</a> Development. 131, 4085-4093 (2004).</li><li>Stuart, G., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication,+integration+and+stable+germ-line+transmission+of+foreign+sequences+injected+into+early+zebrafish+embryos.">Replication, integration and stable germ-line transmission of foreign sequences injected into early zebrafish embryos.</a> Development. 103, 403-412 (1988).</li><li>Stuart, G., Vielkind, J., McMurray, J., Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+lines+of+transgenic+zebrafish+exhibit+reproducible+patterns+of+transgene+expression.">Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression.</a> Development. 109, 577-584 (1990).</li><li>Culp, P., N&#252;sslein-Volhard, C., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-frequency+germ-line+transmission+of+plasmid+DNA+sequences+injected+into+fertilized+zebrafish+eggs.">High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs.</a> Proc Natl Acad Sci U S A. 88, 7953-7957 (1991).</li><li>Strehlow, D., Heinrich, G., Gilbert, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fates+of+the+blastomeres+of+the+16-cell+zebrafish+embryo.">The fates of the blastomeres of the 16-cell zebrafish embryo.</a> Development. 120, 1791-1798 (1994).</li><li>Helde, K., Wilson, E., Cretekos, C., Grunwald, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+early+cells+to+the+fate+map+of+the+zebrafish+gastrula.">Contribution of early cells to the fate map of the zebrafish gastrula.</a> Science. 265, 517-520 (1994).</li><li>Lin, S., Long, W., Chen, J., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+germ-line+chimeras+in+zebrafish+by+cell+transplants+from+genetically+pigmented+to+albino+embryos.">Production of germ-line chimeras in zebrafish by cell transplants from genetically pigmented to albino embryos.</a> Proc Natl Acad Sci U S A. 89, 4519-4523 (1992).</li><li>Long, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GATA-1+expression+pattern+can+be+recapitulated+in+living+transgenic+zebrafish+using+GFP+reporter+gene.">GATA-1 expression pattern can be recapitulated in living transgenic zebrafish using GFP reporter gene.</a> Development. 124, 4105-4111 (1997).</li><li>Murphey, R., Zon, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecule+screening+in+the+zebrafish.">Small molecule screening in the zebrafish.</a> Methods. 39, 255-261 (2006).</li></ol>

zebrafish 배아에 Microinjection 개발에서 특정 유전자의 역할을 탐험 잘 설립하고 강력한 기술입니다. 응용 프로그램 overexpression, misexpression와 관심뿐만 아니라 여러 유전자 간의 epistatic 분석의 유전자의 최저의 assays를 포함합니다. zebrafish의 Microinjection은 널리 유전자 변형 동물을 생성하고, 초기 배아 blastula 5,6,7,8,9의 세포 운명을 매핑에 사용되고 있습니다. 또한,이 기법의 응용 프로그램은 ?...

다른 모든 자료는 프로토콜에 나열되어 있습니다.

microinjection of mrna and morpholino antisense oligonucleotides in zebrafish embryos.

개발하는 동안 유전자의 역할을 조사하는 필수적인 도구가 유전자 최저, overexpression, 그리고 misexpression 연구를 수행하는 능력입니다. zebrafish에서 (<em&gt; Danio rerio</em&gt;), 개발 배아에 RNA, DNA, 단백질, 안티 센스 oligonucleotides와 다른 작은 분자의 microinjection은 연구자에게 유전자 기능을 탐험에 대한 신속하고 강력한 분석을 제공합니다<em&gt; 생체내에</em&gt;. 이 동영상 기사에서는, 우리는 준비하고 microinject하는 방법을 보여줍니다 것입니다<em&gt; 체외에서</em&gt; 합성 EGFP의 mRNA와 translational 차단 morpholino oligo에 대한<em&gt; pkd2</em&gt; 1 - 세포 단계의 배아 zebrafish에 autosomal 지배 polycystic 신장병 (ADPKD)과 관련된 유전자. 우리는 다음 GFP 표현 및 표현형 분석을 확인하여 mRNA 및 morpholino의 microinjections의 성공을 분석합니다. 이 기술의 광범위한 응용 프로그램을 생성하는 유전자 변형 동물 및 세균 라인 chimeras, 세포 - 운명의 매핑 및 유전자 검사를 포함합니다. 여기에 우리의 EGFP와 최저의 overexpression을위한 프로토콜을 설명<em&gt; pkd2</em&gt; mRNA와 morpholino의 oligonucleotide 주입에 의해.

Watch this Scientific Journal Video about Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos. at JoVE.com

Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Microinjection은 수정된 zebrafish의 배아에 이물질을 소개하는 잘 설립하고 효과적인 방법입니다. 여기, 우리는 강력한 mRNA의 overexpression을 수행하기위한 microinjection 기술 및 zebrafish에서 morpholino의 oligonucleotide 유전자 최저 연구를 보여줍니다.

Zebrafish 태아의 mRNA와 Morpholino의 안티 센스 Oligonucleotides의 Microinjection.

An essential tool for investigating the role of a gene during development is the ability to perform gene knockdown, overexpression, and misexpression ...

microinjection-mrna-morpholino-antisense-oligonucleotides-zebrafish

Research

JoVE Journal

Biology

36.6K 조회수.  Yale University School of Medicine. Microinjection은 수정된 zebrafish의 배아에 이물질을 소개하는 잘 설립하고 효과적인 방법입니다. 여기, 우리는 강력한 mRNA의 overexpression을 수행하기위한 microinjection 기술 및 zebrafish에서 morpholino의 oligonucleotide 유전자 최저 연구를 보여줍니다.

비디오: Microinjection of mRNA and Morpholino Antisense Oligonucleotides in Zebrafish Embryos.

Microinjection of A. aegypti Embryos to Obtain Transgenic Mosquitoes

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue fever.  The techniques for correctly preparing microinjection needles, dessicating embryos, and performing microinjection are demonstrated.

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue fever. The techniques for correctly preparing microinjection needles, dessicating embryos, and performing microinjection are demonstrated.

트렌스 제닉 모기를 구하는 A. aegypti의 태아의 Microinjection

In this video, Nijole Jasinskiene demonstrates the methodology employed to generate transgenic Aedes aegypti mosquitoes, which are vectors for dengue ...

연구

생물학

Microinjection of Zebrafish Embryos to Analyze Gene Function

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic oligonucleotides with antisense complementarity to target RNAs, can be added to the embryo to reduce the expression of a particular gene product.  Conversely, processed mRNA can be added to the embryo to increase levels of a gene product.  The vehicle for adding either mRNA or morpholino to an embryo is microinjection.  Microinjection is efficient and rapid, allowing for the injection of hundreds of embryos per hour.  This video shows all the steps involved in microinjection.  Briefly, eggs are collected immediately after being laid and lined up against a microscope slide in a Petri dish.  Next, a fine-tipped needle loaded with injection material is connected to a microinjector and an air source, and the microinjector controls are adjusted to produce a desirable injection volume.  Finally, the needle is plunged into the embryo's yolk and the morpholino or mRNA is expelled.

This video shows how morpholino or mRNA can be injected into zebrafish embryos at the one-cell stage to decrease or increase the level of specific gene products during subsequent development.

유전자 기능을 분석 Zebrafish 배아들 중 Microinjection

One of the advantages of studying zebrafish is the ease and speed of manipulating protein levels in the embryo.  Morpholinos, which are synthetic ...

Generating Chimeric Zebrafish Embryos by Transplantation

One of the most powerful tools used to gain insight into complex developmental processes is the analysis of chimeric embryos. A chimera is defined as an organism that contains cells from more than one animal; mosaics are one type of chimera in which cells from more than one genotype are mixed, usually wild-type and mutant. In the zebrafish, chimeras can be readily made by transplantation of cells from a donor embryo into a host embryo at the appropriate embryonic stage. Labeled donor cells are generated by injection of a lineage marker, such as a fluorescent dye, into the one-cell stage embryo. Labeled donor cells are removed from donor embryos and introduced into unlabeled host embryos using an oil-controlled glass pipette mounted on either a compound or dissecting microscope. Donor cells can in some cases be targeted to a specific region or tissue of the developing blastula or gastrula stage host embryo by choosing a transplantation site in the host embryo based on well-established fate maps.

A step-by-step guide to generating targeted chimeric zebrafish embryos by transplantation at the blastula or gastrula stage.

이식에 의해 키메라 Zebrafish의 배아를 생성

One of the most powerful tools used to gain insight into complex developmental processes is the analysis of chimeric embryos. A chimera is defined as an ...

Two-Photon-Based Photoactivation in Live Zebrafish Embryos

Photoactivation of target compounds in a living organism has proven a valuable approach to investigate various biological processes such as embryonic development, cellular signaling and adult physiology. In this respect, the use of multi-photon microscopy enables quantitative photoactivation of a given light responsive agent in deep tissues at a single cell resolution. As zebrafish embryos are optically transparent, their development can be monitored in vivo. These traits make the zebrafish a perfect model organism for controlling the activity of a variety of chemical agents and proteins by focused light. Here we describe the use of two-photon microscopy to induce the activation of chemically caged fluorescein, which in turn allows us to follow cell's destiny in live zebrafish embryos. We use embryos expressing a live genetic landmark (GFP) to locate and precisely target any cells of interest. This procedure can be similarly used for precise light induced activation of proteins, hormones, small molecules and other caged compounds.

Multiphoton microscopy allows control of low energy photons with deep optical penetration and reduced phototoxicity. We describe the use of this technology for live cell labeling in zebrafish embryos. This protocol can be readily adapted for photo-induction of various light-responsive molecules.

라이브 Zebrafish 태아에서 두 광자 기반 Photoactivati​​on

Photoactivation of target compounds in a living organism has proven a valuable approach to investigate various biological processes such as embryonic ...

Microinjection of Medaka Embryos for use as a Model Genetic Organism

In this video, we demonstrate the technique of microinjection into one-cell stage medaka embryos. Medaka is a small egg-laying freshwater fish that allows both genetic and embryological analyses and is one of the vertebrate model organisms in which genome-wide phenotype-driven mutant screens were carried out 1, as in zebrafish and the mouse. Divergence of functional overlap of related genes between medaka and zebrafish allows identification of novel phenotypes that are unidentifiable in a single species 2, thus medaka and zebrafish are complementary for genetic dissection of vertebrate genome functions.
To take advantage of medaka fish whose embryos are transparent and develop externally, microinjection is an essential technique to inject cell-tracers for labeling cells, mRNAs or anti-sense oligonucleotides for over-expressing and knocking-down genes of interest, and DNAs for making transgenic lines.

Medaka and zebrafish are complementary for genetic dissection of vertebrate genome functions. This protocol highlights the key points for successful microinjection into medaka embryos, an important technique for embryological and genetic analysis using medaka and zebrafish in a laboratory.

모델 생물체 유전자로 사용하기 위해 Medaka의 태아의 Microinjection

In this video, we demonstrate the technique of microinjection into one-cell stage medaka embryos. Medaka is a small egg-laying freshwater fish that allows ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Microinjection하여 포유 동물 세포에서 mRNA 원자력 수출 속도론 분석

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

Imaging Glycans in Zebrafish Embryos by Metabolic Labeling and Bioorthogonal Click Chemistry

Imaging glycans in vivo has recently been enabled using a bioorthogonal chemical reporter strategy by treating cells or organisms with azide- or alkyne-tagged monosaccharides1, 2. The modified monosaccharides, processed by the glycan biosynthetic machinery, are incorporated into cell surface glycoconjugates. The bioorthogonal azide or alkyne tags then allow covalent conjugation with fluorescent probes for visualization, or with affinity probes for enrichment and glycoproteomic analysis. This protocol describes the procedures typically used for noninvasive imaging of fucosylated glycans in zebrafish embryos, including: 1) microinjection of one-cell stage embryos with GDP-5-alkynylfucose (GDP-FucAl), 2) labeling fucosylated glycans in the enveloping layer of zebrafish embryos with azide-conjugated fluorophores via biocompatible Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC), and 3) imaging by confocal microscopy3. The method described here can be readily extended to visualize other classes of glycans, e.g. glycans containing sialic acid4 and N-acetylgalactosamine5, 6, in developing zebrafish and in other living organisms.

A click-chemistry based method that allows for the rapid, noninvasive, and robust labeling of alkyne-tagged glycans in zebrafish embryos is described. Fucosylated glycans in the enveloping layer of zebrafish embryos in the late gastrulation stage were imaged in this study.

신진 대사 라벨링 및 Bioorthogonal 클릭 화학에 의해 Zebrafish 태아의 영상 Glycans

Imaging glycans in vivo has recently been enabled using a bioorthogonal chemical reporter strategy by treating cells or organisms with azide- or ...

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1. Apoptosis can be triggered when cells encounter a wide range of cytotoxic stresses. These insults initiate signaling cascades that ultimately cause the release of cytochrome c from the mitochondrial intermembrane space to the cytoplasm2. The release of cytochrome c from mitochondria is a key event that triggers the rapid activation of caspases, the key cellular proteases which ultimately execute cell death3-4.
The pathway of apoptosis is regulated at points upstream and downstream of cytochrome c release from mitochondria5. In order to study the post-mitochondrial regulation of caspase activation, many investigators have turned to direct cytoplasmic microinjection of holocytochrome c (heme-attached) protein into cells6-9. Cytochrome c is normally localized to the mitochondria where attachment of a heme group is necessary to enable it to activate apoptosis10-11. Therefore, to directly activate caspases, it is necessary to inject the holocytochrome c protein instead of its cDNA, because while the expression of cytochrome c from cDNA constructs will result in mitochondrial targeting and heme attachment, it will be sequestered from cytosolic caspases. Thus, the direct cytosolic microinjection of purified heme-attached cytochrome c protein is a useful tool to mimic mitochondrial cytochrome c release and apoptosis without the use of toxic insults which cause cellular and mitochondrial damage.
In this article, we describe a method for the microinjection of cytochrome c protein into cells, using mouse embryonic fibroblasts (MEFs) and primary sympathetic neurons as examples. While this protocol focuses on the injection of cytochrome c for investigations of apoptosis, the techniques shown here can also be easily adapted for microinjection of other proteins of interest.

Activation of Apoptosis by Cytoplasmic Microinjection of Cytochrome c

In this protocol, we describe the direct cytoplasmic microinjection of cytochrome c protein into fibroblasts and primary sympathetic neurons. This technique allows for the introduction of cytochrome c protein into the cytoplasm of cells and mimics the release of cytochrome c from mitochondria, which occurs during apoptosis.

시토크롬의 세포질 Microinjection 의한 Apoptosis의 활성화 C</em

Apoptosis, or programmed cell death, is a conserved and highly regulated pathway by which cells die1.  Apoptosis can be triggered when cells encounter a ...

Metabolic Profile Analysis of Zebrafish Embryos

A growing goal in the field of metabolism is to determine the impact of genetics on different aspects of mitochondrial function. Understanding these relationships will help to understand the underlying etiology for a range of diseases linked with mitochondrial dysfunction, such as diabetes and obesity. Recent advances in instrumentation, has enabled the monitoring of distinct parameters of mitochondrial function in cell lines or tissue explants. Here we present a method for a rapid and sensitive analysis of mitochondrial function parameters in vivo during zebrafish embryonic development using the Seahorse bioscience XF 24 extracellular flux analyser. This protocol utilizes the Islet Capture microplates where a single embryo is placed in each well, allowing measurement of bioenergetics, including: (i) basal respiration; (ii) basal mitochondrial respiration (iii) mitochondrial respiration due to ATP turnover; (iv) mitochondrial uncoupled respiration or proton leak and (iv) maximum respiration. Using this approach embryonic zebrafish respiration parameters can be compared between wild type and genetically altered embryos (mutant, gene over-expression or gene knockdown) or those manipulated pharmacologically. It is anticipated that dissemination of this protocol will provide researchers with new tools to analyse the genetic basis of metabolic disorders in vivo in this relevant vertebrate animal model.

Zebrafish represent a powerful vertebrate model that has been under-utilised for metabolic studies. Here we describe a rapid way to measure the in vivo metabolic profile of developing zebrafish that allows the comparison of different mitochondrial function parameters between genetically or pharmacologically manipulated embryos, thereby increasing the applicability of this organism.

Zebrafish 태아의 대사 프로필 분석

A growing goal in the field of metabolism is to determine the impact of genetics on different aspects of mitochondrial function. Understanding these ...

Analysis of Oxidative Stress in Zebrafish Embryos

High levels of reactive oxygen species (ROS) may cause a change of cellular redox state towards oxidative stress condition. This situation causes oxidation of molecules (lipid, DNA, protein) and leads to cell death. Oxidative stress also impacts the progression of several pathological conditions such as diabetes, retinopathies, neurodegeneration, and cancer. Thus, it is important to define tools to investigate oxidative stress conditions not only at the level of single cells but also in the context of whole organisms. Here, we consider the zebrafish embryo as a useful in vivo system to perform such studies and present a protocol to measure in vivo oxidative stress. Taking advantage of fluorescent ROS probes and zebrafish transgenic fluorescent lines, we develop two different methods to measure oxidative stress in vivo: i) a &#8220;whole embryo ROS-detection method&#8221; for qualitative measurement of oxidative stress and ii) a &#8220;single-cell&#160;ROS detection method&#8221; for quantitative measurements of oxidative stress. Herein, we demonstrate the efficacy of these procedures by increasing oxidative stress in tissues by oxidant agents and physiological or genetic methods. This protocol is amenable for forward genetic screens and it will help address cause-effect relationships of ROS in animal models of oxidative stress-related pathologies such as neurological disorders and cancer.

Here we report a protocol to measure oxidative stress in living zebrafish embryos. This procedure allows reactive oxygen species (ROS) detection in both whole embryo tissues and single-cell populations. This protocol will accomplish both qualitative and quantitative analyses.

Zebrafish 태아의 mRNA와 Morpholino의 안티 센스 Oligonucleotides의 Microinjection.

요약

더 많은 비디오 탐색

이 비디오의 챕터

트렌스 제닉 모기를 구하는 A. aegypti의 태아의 Microinjection

유전자 기능을 분석 Zebrafish 배아들 중 Microinjection

이식에 의해 키메라 Zebrafish의 배아를 생성

라이브 Zebrafish 태아에서 두 광자 기반 Photoactivation

모델 생물체 유전자로 사용하기 위해 Medaka의 태아의 Microinjection

Microinjection하여 포유 동물 세포에서 mRNA 원자력 수출 속도론 분석

신진 대사 라벨링 및 Bioorthogonal 클릭 화학에 의해 Zebrafish 태아의 영상 Glycans

시토크롬의 세포질 Microinjection 의한 Apoptosis의 활성화 C

Zebrafish 태아의 대사 프로필 분석

제브라 피쉬 배아에서 산화 스트레스의 분석

Zebrafish 태아의 mRNA와 Morpholino의 안티 센스 Oligonucleotides의 Microinjection.

요약

더 많은 비디오 탐색

이 비디오의 챕터

트렌스 제닉 모기를 구하는 A. aegypti의 태아의 Microinjection

유전자 기능을 분석 Zebrafish 배아들 중 Microinjection

이식에 의해 키메라 Zebrafish의 배아를 생성

라이브 Zebrafish 태아에서 두 광자 기반 Photoactivati​​on

모델 생물체 유전자로 사용하기 위해 Medaka의 태아의 Microinjection

Microinjection하여 포유 동물 세포에서 mRNA 원자력 수출 속도론 분석

신진 대사 라벨링 및 Bioorthogonal 클릭 화학에 의해 Zebrafish 태아의 영상 Glycans

시토크롬의 세포질 Microinjection 의한 Apoptosis의 활성화 C

Zebrafish 태아의 대사 프로필 분석

제브라 피쉬 배아에서 산화 스트레스의 분석

라이브 Zebrafish 태아에서 두 광자 기반 Photoactivation