نشكر أعضاء مختبراتنا لإجراء مناقشات مثمرة والمساعدة التقنية. وقد أيد هذا العرض الفيديو من قبل العميد المشارك للأبحاث وإدارة البيولوجيا المرضية البيطرية ، ومركز للعلوم الصحية البيطرية ، جامعة ولاية أوكلاهوما. هبوا لر التر Sitlington تم تمويل البحث من قبل دي MINISTERIO Innovación ه Ciencia ، إسبانيا (BFU2008-01244/BMC المشروع) ، ومشروع CSIC جماعية لPA1002451 JF ، رئيسة للبحوث الحيوانية الغذائية إلى KMK ، CVHS 2009 RAC المنحة ، OAES صناديق صحة الحيوانية وزارة الزراعة ، وطني المنحة مبادرة البحوث التنافسية ، رقم 2007-04613.

1. جيل من الرنا المزدوج الجديلة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> توليف الاشعال قليل النوكليوتيد تحتوي على تسلسل T7 مروج للالنسخ في المختبر وتوليف الرنا المزدوج الجديلة (على سبيل المثال ، لاستخدام ناخس variabilis subolesin الاشعال قليل النوكليوتيد D8AAT75 : 5&#39; - TAATACGACTCACTATAGGGTACTGACTGGGATCCCCTGCACAGT - 3 &quot;و D8DVT73 : 5&#39; - TAATACGACTCACTATAGGGTACTCGAGCTTGGTGGAAAGGACG - 3&#39;). </li><li style=";text-align:right;direction:rtl"> تضخيم الجين الهدف بواسطة RT - PCR باستخدام 10 بمول كل التمهيدي قليل النوكليوتيد و10-10 نانوغرام من الحمض النووي الريبي مجموع القراد. </li><li style=";text-align:right;direction:rtl"> تنقية المنتج PCR. </li><li style=";text-align:right;direction:rtl"> توليف الرنا المزدوج الجديلة باستخدام 8 ميكرولتر للمنتج PCR المنقى. </li><li style=";text-align:right;direction:rtl"> قياس الطيف بواسطة الرنا المزدوج الجديلة. </li></ol> 2. القراد مع حقن الرنا المزدوج الجديلة. 2.1. إعداد القراد عن طريق الحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أولا ، اغسل القراد في سلسلة من الحلول التي تهز لهم في كل حل في أنبوب الطرد المركزي المتاح 50 مل ، الصب الحل من خلال شاشة سلكية غرامة على أعلى أنبوب للاحتفاظ القراد. تسلسل الحلول لالقراد غسل ماء الصنبور ، و 3 ٪ فوق أكسيد الهيدروجين ، واثنين من يغسل الماء المقطر ، والإيثانول 70 ٪ واثنين اخرين من يغسل بالماء المقطر. </li><li style=";text-align:right;direction:rtl"> وصمة عار الجافة القراد على مناشف ورقية. </li><li style=";text-align:right;direction:rtl"> عد القراد في مجموعات من 20 إلى 50 ، وهذا يتوقف على التجربة ، ومكان القراد من كل مجموعة في كوب من البلاستيك 1.25 أوقية مع غطاء محكم تركيبها والتسمية مع عدد المجموعة التجريبية. </li></ol> 2.2. قراد فريق الحقن. رني فريق يتكون من ثلاثة أشخاص : (1) شخص واحد كل المناصب علامة على شريط لاصق مزدوج الملصقة على ورقة من الشمع الأحمر الأسنان ، (2) شخص واحد يضخ القراد و (3) شخص واحد يشرف على بعد القراد الحقن ، ويتنفس CO 2 على القراد لتفعيلها وبحساب القراد يعيشون في الكؤوس المسمى مع عدد المجموعة التجريبية. يجب على جميع أعضاء الفريق ارتداء قفازات المتاح. 2.3. وضع علامات التجزئة للحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> التقاط القراد باستخدام الملقط دومون الجميلة وضعه الجانب البطني حتى على شريط لاصق مزدوج اضافته على ورقة 3 &quot;× 6&quot; من الشمع الأحمر الأسنان. يتم وضع عن كثب القراد معا في مجموعات من 5 القراد. </li><li style=";text-align:right;direction:rtl"> وضع شريط صغير من الشريط اللاصق على فمها لجميع القراد 5 من أجل كبح جماح المزيد منها ولكن مع ترك معظم الجسم يتعرض بحيث يمكن ملاحظة عملية الحقن التي حاقن القراد (الشكل 1). </li></ol> 2.4. حقن القراد. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وسيتم حقن القراد في الربع السفلي الأيمن من السطح البطني من الهيكل الخارجي. </li><li style=";text-align:right;direction:rtl"> أولا ، بيرس ثقب في الهيكل الخارجي باستخدام حقنة الانسولين Monoject مزودة ½ &quot;، 29 إبرة قياس (الشكل 2A). </li><li style=";text-align:right;direction:rtl"> حقن القراد مباشرة مع 0،2-0،5 ميكرولتر من محلول الرنا المزدوج الجديلة (5 × 10 حتي 05 أكتوبر 11 × 10 الجزيئات في ميكرولتر) باستخدام حقنة مخصصة هاميلتون الصنع يبلغ 1 بوصة ، و 33 إبرة قياس نقطة مع 45 درجة مشطوف (الشكل 2B) . ينبغي أن توضع الإبرة جيدا في تجويف القراد لضمان التنسيب والإبقاء على الرنا المزدوج الجديلة. بعض السوائل من المرجح أن يتخلصوا من موقع الحقن (الشكل 2C). وينبغي الحرص على عدم ضخ أكثر من القراد والتي من شأنها أن تسبب فقدان الدملمف ويمكن أن يسبب وفاة القراد. </li><li style=";text-align:right;direction:rtl"> تنظيف حقنة هاميلتون بعد الانتهاء من الحقن في كل مجموعة تجريبية. قبل استخدام لمجموعة أخرى تجريبية. ملء الحقنة الأولى من دورق يحتوي على 3 ٪ فوق أكسيد الهيدروجين ثم طرد في حاوية النفايات ، وكرر 15 مرة. ملء الحقنة التي تحتوي على كوب من الماء المعقم ، ثم طرد في حاوية النفايات ، وكرر 15 مرة. الحرص على عدم ثني المكبس من المحاقن هاملتون ، لأنه إذا عازمة ، الغطاس لن تتحرك بسلاسة ، والاستجابة لمسة رقيقة المطلوبة للحقن من القراد. </li></ol> 2.5. علاج القراد بعد الحقن. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> يلتقط القراد حقنه مباشرة من الشريط لزجة مع مضاعفة الغرامة ملقط ووضعها في وعاء من البلاستيك الانتعاش (حوالي 6 &quot;× 6&quot; وتحيط بشريط لمنع هروب القراد). سوف تكون خاملة لفترة وجيزة القراد بعد الحقن ولكن ينبغي أن تبدأ قريبا في الزحف نحو الصحن. </li><li style=";text-align:right;direction:rtl"> CO 2 على التنفس القراد مباشرة بعد وضعها في حاوية للمساعدة في الانتعاش تنشيط القراد. بمجرد أن يتم الزحف القراد ونشطة ، وسوف يشفي الجرح الحقن بسرعة وسوف البقاء على قيد الحياة على الأرجح. </li><li style=";text-align:right;direction:rtl"> عد القراد وفقا لعدد في كل مجموعة تجريبية وضعها في كوب من البلاستيك المسمى مزودة بغطاء محكم. ينبغي حقن القراد استبدال لاستبدال أي أن أي توفي قبل حقن المجموعة التالية التجريبية. </li></ol> 2.6. قراد القابضة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> مكان القراد في غرفة الرطوبة (12hr النور : 12 ساعة في الإضاءة الداكنة 22-25 درجة مئوية ، ونسبة 95 ٪ حumidity) وعقد لمدة 1 يوم. </li><li style=";text-align:right;direction:rtl"> القراد في مكان القراد تغذية الخلايا ، واحد في المجموعة التجريبية ، لصقها على الأغنام ، والسماح لهم بأن يغذ مع عدد متساو من uninjected القراد ذكرا أو أنثى (أيهما الجنس لم يكن حقن). الإناث القراد التي تتغذى على امتلاء ، وانخفضت تلك التي يتم إزالتها من الأغنام بعد 10 يوما من التغذية أو عند الإناث مراقبة قبالة المضيفة يتم جمعها وزنه. </li><li style=";text-align:right;direction:rtl"> مكان القراد في كرتون ، وعقد في غرفة الرطوبة حتى الانتهاء من oviposition. تقييم oviposition بواسطة الترجيح كتلة البيض التي تنتجها جميع القراد في المجموعة. </li></ol> 2.7. تحليل النمط الظاهري التجزئة بعد رني. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تقييم وضع علامة النمط الظاهري بعد الرضاعة من خلال تحديد عدد من القراد التي نجت ، والوزن القراد ، والخصوبة oviposition البيض. ومع ذلك ، قد يتم تنفيذ تحليلات أخرى اعتمادا على الجينات المستهدفة وأهداف الدراسة. </li></ol> 3. تحليل لتأكيد إسكات الجينات التي كتبها RT - PCR. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تشريح الغدد اللعابية والشجاعة من القراد فردية من مجموعات المراقبة حقن حقن الرنا المزدوج الجديلة وبعد والتغذية. </li><li style=";text-align:right;direction:rtl"> استخراج الحمض النووي الريبي مجموع من عينات الأنسجة الفردية. </li><li style=";text-align:right;direction:rtl"> تحليل النصوص الجينات المستهدفة في الأنسجة الفردية في الوقت الحقيقي RT - PCR وتطبيع مستويات الحمض النووي الريبي لمكافحة القراد 16S الرنا الريباسي باستخدام الأسلوب genNorm (أسلوب ddCT كما تنفذها بيو راد iQ5 الإصدار القياسي ، الإصدار 2.0). </li><li style=";text-align:right;direction:rtl"> تشغيل منحنيات التفكك في نهاية رد فعل لضمان تشكيل واحد فقط amplicon وأن تفسد amplicons باستمرار في نطاق نفس درجة الحرارة عن كل عينة. </li><li style=";text-align:right;direction:rtl"> مقارنة مستويات مرنا (تطبيع القيم CT) بين السيطرة وحقن الرنا المزدوج الجديلة حقن القراد باستخدام طالبة سيصدره اختبار t (P = 0.05). </li></ol> 4. ممثل النتائج : وصف بروتوكول وقد استخدمت هنا في المختبر لدينا [رني في العديد من الأنواع المختلفة القراد ixodid (الجدول 1). كمية الرنا المزدوج الجديلة حقنها في القراد يتفاوت مع حجم القراد ؛ الأنواع أكبر التجزئة يمكن أن تستوعب حجم أكبر. ينبغي حقن القراد السيطرة السلبية مع الرنا المزدوج الجديلة غير ذات صلة. ويمكن استخدام dsRNAs عدة مثل subolesin 14-19،22-25،27-32،34 وبيتا أكتين 20،21 والضوابط الإيجابية. علما أنه من المهم أن تغسل الحقنة بين العلاجات لتجنب الخلط حلول الرنا المزدوج الجديلة. إذا لم يفعل البروتوكول بشكل صحيح ، يجب الحصول على أقل من 5 ٪ من وفيات إجراء الحقن بعد 24 ساعة. ويرد النمط الظاهري نموذجي بعد ضربة قاضية الجينات في القراد في الشكل 3 مع فريق من القراد حقنوا برك من الرنا المزدوج الجديلة من أجل وضع علامة الشاشة لمستضدات الواقية. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> قراد الأنواع </td><td> حقن الرنا المزدوج الجديلة </td><td> المراجع </td></tr><tr><td> اللبود الكتفي </td><td> [كدنا] مكتبة ، subolesin ، أكتين ، nucleotidase ، NF - KB ، akirin </td><td> 21 ، 22 ، 29 ، 30 </td></tr><tr><td> ناخس variabilis </td><td> subolesin ، GST ، اليوبيكويتين ، vATPase ، selenoproteins M وW2A ، الجذعية المكونة للدم / السلف خلايا البروتين مثل الوحيدات 26S أكتين Proteasome ، ferritin1 ، varisin ، akirin </td><td> 15 ، 19 ، 22 ، 24 ، 26 ، 30-32 </td></tr><tr><td> ناخس الجلد الهامشي </td><td> subolesin </td><td> 22 </td></tr><tr><td> اليغموش الأمريكي </td><td> [كدنا] مكتبة ، subolesin ، akirin </td><td> 17 ، 22 ، 30 </td></tr><tr><td> اليغموش الهبراوي </td><td> subolesin ، voraxin </td><td> 28 </td></tr><tr><td> مروحية الرأس الدموية </td><td> Rs86 ، subolesin </td><td> 22 ، 23 </td></tr><tr><td> مروحية الرأس المتثني </td><td> GST ، اليوبيكويتين ، selenoprotein ، Bm86 ، Bm91 ، subolesin ومعهد جوته ، GIII ، EF1a ، سوطي الشكل بروتين الحرير ، وفون ويلبراند عامل </td><td> 16 ، 18 ، 25 ، 27 </td></tr><tr><td> مروحية الرأس الحلقي </td><td> اليوبيكويتين ، subolesin ، EF1a ، GIII </td><td> 16 </td></tr></tbody></table> الجدول 1. القراد الأنواع التي تم فيها استخدام بروتوكول رني. <img src="/files/ftp_upload/2474/2474fig1.jpg" alt="الشكل 1" /> الشكل 1. تنسيب القراد ، حتى الجانب البطني ، على شريط لاصق مزدوج انضمت إلى ورقة من الشمع الأحمر الأسنان. توضع القراد في مجموعات من 5 ، وبعد ذلك يتم وضع شريط صغير من الشريط اللاصق على فمها من أجل تأمين مزيد من القراد بينما يسمح للحاقن لمراقبة الجسم من خلال وضع علامة الحقن. <img src="/files/ftp_upload/2474/2474fig2.jpg" alt="الشكل 2" /> الشكل 2. الإجراء يتضمن حقن (أ) ثقب السفلي رباعي اليمنى من الهيكل الخارجي القراد مع سي الأنسولينringe مزودة إبرة قياس 29 من أجل إنشاء موقع الحقن ، (ب) الحقن المباشر للالرنا المزدوج الجديلة في هذا الموقع باستخدام حقنة هاميلتون مع إبرة قياس 33 منها (ج) على الأرجح سوف يؤدي إلى تسرب بعض الدملمف قراد / السوائل. <img src="/files/ftp_upload/2474/2474fig3.jpg" alt="الشكل 3" /> الشكل 3. لجنة من ست مجموعات التجزئة التي كانت تستخدم للكشف عن رني مستضدات القراد واقية في americanum اليغموش. ويمكن رؤية التغييرات في القراد المظهري بالمقارنة مع مراقبة إيجابية رني subolesin والسيطرة السلبية الرنا المزدوج الجديلة غير ذات صلة. في هذه التجربة تم تحليلها إحصائيا تأثير على وفيات رني القراد ، والأوزان ، وoviposition من كل مجموعة.

<ol>
	<li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview:+Ticks+as+vectors+of+pathogens+that+cause+disease+in+humans+and+animals.">Overview: Ticks as vectors of pathogens that cause disease in humans and animals.</a> Front. Biosci. 13, 6938-6946 (2008).</li><li>Peter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mosquito+control-Lessons+from+the+past,+solutions+for+the+future.">mosquito control-Lessons from the past, solutions for the future.</a> Vet. Parasitol. 132, 205-215 (2005).</li><li>Barker, S. C., Murrell, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematics+and+evolution+of+ticks+with+a+list+of+valid+genus+and+species+names.">Systematics and evolution of ticks with a list of valid genus and species names.</a> Parasitol. 129, S15-S36 (2004).</li><li>Willadsen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tick+control:+Thoughts+on+a+research+agenda.">Tick control: Thoughts on a research agenda.</a> Vet. Parasitol. 138, 161-168 (2006).</li><li>de la Fuente, J., Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+development+of+vaccines+for+control+of+ixodid+tick+species.">Strategies for development of vaccines for control of ixodid tick species.</a> Parasite Immunol. 28, 275-283 (2006).</li><li>Fire, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391, 806-811 (1998).</li><li>Cerutti, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference:+traveling+in+the+cell+and+gaining+functions.">RNA interference: traveling in the cell and gaining functions.</a> Trends Genet. 19, 39-46 (2003).</li><li>Kavi, H. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+silencing+in+Drosophila.">RNA silencing in Drosophila.</a> FEBS Lett. 579, 5940-5949 (2005).</li><li>Mello, C. C., Conte, D. J. r. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+world+of+RNA+interference.">Revealing the world of RNA interference.</a> Nature. 431, 338-342 (2004).</li><li>Zhou, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+and+potential+applications.">RNA interference and potential applications.</a> Curr. Top. Med. Chem. 6, 901-911 (2006).</li><li>Ramakrishnan, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+RNA+interference+in+tick+salivary+gland+research.">Application of RNA interference in tick salivary gland research.</a> J. Biomol. Tech. 16, 297-305 (2005).</li><li>Aljamali, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference:+applicability+in+tick+research.">RNA interference: applicability in tick research.</a> Exp. Appl. Acarol. 28, 89-96 (2002).</li><li>Aljamali, M. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+in+ticks:+a+study+using+histamine+binding+protein+dsRNA+in+the+female+tick+Amblyomma+americanum.">RNA interference in ticks: a study using histamine binding protein dsRNA in the female tick Amblyomma americanum.</a> Insect. Mol. Biol. 12, 299-305 (2003).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+for+the+study+and+genetic+manipulation+of+ticks.">RNA interference for the study and genetic manipulation of ticks.</a> Trends Parasitol. 23, 427-433 (2007).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+studies+of+tick+cells+in+response+to+infection+with+the+cattle+pathogen,+Anaplasma+marginale.">Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale.</a> Genomics. 90, 712-722 (2007).</li><li>Almaz&#228;N, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+Rhipicephalus+(Boophilus)+microplus+candidate+protective+antigens+for+the+control+of+cattle+tick+infestations.">Identification and characterization of Rhipicephalus (Boophilus) microplus candidate protective antigens for the control of cattle tick infestations.</a> Parasitol. Res. 106, 471-479 (2010).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+protective+antigens+by+RNA+interference+for+control+of+the+lone+star+tick,+Amblyomma+americanum.">Identification of protective antigens by RNA interference for control of the lone star tick, Amblyomma americanum.</a> Vaccine. 28, 1786-1795 (2010).</li><li>Zivkovic, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+expression+of+genes+in+salivary+glands+of+male+Rhipicephalus+(Boophilus)+microplus+in+response+to+infection+with+Anaplasma+marginale.">Differential expression of genes in salivary glands of male Rhipicephalus (Boophilus) microplus in response to infection with Anaplasma marginale.</a> BMC Genomics. 11, 186-186 (2010).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+tick+infections+with+Anaplasma+marginale+and+A.+phagocytophilum+by+targeting+the+tick+protective+antigen+subolesin.">Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin.</a> Parasitol. Res. 100, 85-91 (2006).</li><li>Narasimhan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruption+of+Ixodes+scapularis+anticoagulation+by+using+RNA+interference.">Disruption of Ixodes scapularis anticoagulation by using RNA interference.</a> Proc. Natl. Acad. Sci U.S.A. 101, 1141-1146 (2004).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference+screening+in+ticks+for+identification+of+protective+antigens.">RNA interference screening in ticks for identification of protective antigens.</a> Parasitol. Res. 96, 137-141 (2005).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+tick+protective+antigen,+4D8,+is+a+conserved+protein+involved+in+modulation+of+tick+blood+ingestion+and+reproduction.">The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction.</a> Vaccine. 24, 4082-4095 (2006).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synergistic+effect+of+silencing+the+expression+of+tick+protective+antigens+4D8+and+Rs86+in+Rhipicephalus+sanguineus+by+RNA+interference.">Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference.</a> Parasitol. Res. 99, 108-113 (2006).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autocidal+control+of+ticks+by+silencing+of+a+single+gene+by+RNA+interference.">Autocidal control of ticks by silencing of a single gene by RNA interference.</a> Biochem. Biophys. Res. Commun. 344, 332-338 (2006).</li><li>Nijhof, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bm86,+Bm91+and+subolesin,+in+the+silencing+of+the+tick+protective+antigens.">Bm86, Bm91 and subolesin, in the silencing of the tick protective antigens.</a> Int. J. Parasitol. 37, 653-662 (2007).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+defensin,+varisin,+in+male+Dermacentor+variabilis+by+RNA+interference+results+in+reduced+Anaplasma+marginale+infections.">Silencing of the defensin, varisin, in male Dermacentor variabilis by RNA interference results in reduced Anaplasma marginale infections.</a> Exp. Appl. Acarol. 46, 17-28 (2008).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+of+the+role+of+tick+subolesin+in+gene+expression.">Evidence of the role of tick subolesin in gene expression.</a> BMC Genomics. 9, 372-372 (2008).</li><li>Smith, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+impact+of+RNA+interference+of+the+subolesin+and+voraxin+genes+in+male+Amblyomma+hebraeum+(Acari:+Ixodidae)+on+female+engorgement+and+oviposition.">The impact of RNA interference of the subolesin and voraxin genes in male Amblyomma hebraeum (Acari: Ixodidae) on female engorgement and oviposition.</a> Exp. Appl. Acarol. 47, 71-86 (2009).</li><li>Galindo, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tick+subolesin+is+an+ortholog+of+the+akirins+described+in+insects+and+vertebrates.">Tick subolesin is an ortholog of the akirins described in insects and vertebrates.</a> Dev. Comp. Immunol. 33, 612-617 (2009).</li><li>Canales, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conservation+and+immunogenicity+of+the+mosquito+ortholog+of+the+tick+protective+antigen,+subolesin.">Conservation and immunogenicity of the mosquito ortholog of the tick protective antigen, subolesin.</a> Parasitol. Res. 105, 97-111 (2009).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+genes+involved+in+Anaplasma+marginale-tick+interactions+affects+the+pathogen+developmental+cycle+in+Dermacentor+variabilis.">Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis.</a> BMC Dev. Biol. 9, 42-42 (2009).</li><li>Zivkovic, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subolesin+expression+in+response+to+pathogen+infection+in+ticks.">Subolesin expression in response to pathogen infection in ticks.</a> BMC Immunol. 11, 7-7 (2010).</li><li>Karim, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+tool:+gene+silencing+in+Ixodes+scapularis+eggs+and+nymphs+by+electroporated+dsRNA.">Functional genomics tool: gene silencing in Ixodes scapularis eggs and nymphs by electroporated dsRNA.</a> BMC Biotechnol. 10, 1-1 (2010).</li><li>Kocan, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transovarial+silencing+of+the+subolesin+gene+in+three-host+ixodid+tick+species+after+injection+of+replete+females+with+subolesin+dsRNA.">Transovarial silencing of the subolesin gene in three-host ixodid tick species after injection of replete females with subolesin dsRNA.</a> Parasitol. Res. 100, 1411-1415 (2007).</li><li>de la Fuente, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+the+tick-pathogen+interface+for+novel+control+strategies.">Targeting the tick-pathogen interface for novel control strategies.</a> Front. Biosci. 13, 6947-6956 (2008).</li><li>Kurscheid, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+of+a+tick+RNAi+pathway+by+comparative+genomics+and+reverse+genetics+screen+of+targets+with+known+loss-of-function+phenotypes+in+Drosophila.">Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila.</a> BMC Mol. Biol. 10, 26-26 (2009).</li></ol>

الإعلان عن أي تضارب في المصالح.

على الرغم من أن وصفت وسائل أخرى لرني القراد في 14 و 33 ، وصفت حقن الرنا المزدوج الجديلة هنا هو الأكثر استخداما على نطاق واسع في كل من غير مغذى (الجدول 1) وتغذى القراد 16،25،34. وقد تبين رني أن يكون أداة قيمة لدراسة وظائف الجينات التجزئة ، وتوصيف واجهة القراد الممرض والفرز وتحديد خصائص وقائية من المضادات القراد 14،35. على وجه الخصوص ، أصبح رني الأداة الأكثر قيمة للتحليلات الفنية في القراد 35. منهجيا ، وسوف تتطور رني الأرجح أكثر كفاءة في أساليب التي قد تسمح ضربة قاضية الجين في عدد كبير من الأفراد. ينبغي تحسين آلية الرنا المزدوج الجديلة التي يسببها رني القراد في المساهمة في التوصل إلى فهم أفضل والاستفادة من هذا النهج الوراثية في هذا النوع 35،36. مدى خارج الهدف آثار رني في القراد هو أيضا مسألة مهمة لا بد من معالجتها بشكل كامل 14،27. أخيرا ، سوف رني الأرجح تقديم مساهمات شاملة لدراسة تنظيم الجينات والبيولوجيا أنظمة التجزئة والقراد الممرض واجهة قد يكون لها تأثير على تطوير لقاحات لمكافحة تفشي التجزئة ونقل مسببات الأمراض التي تنتقل عن طريق القراد.

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Access RT-PCR system</td>
<td>&nbsp;</td>
<td>Promega</td>
<td>A1250</td>
<td>&nbsp;</td>
<tr>
<td>Purelink PCR purification kit</td>
<td>&nbsp;</td>
<td>Invitrogen</td>
<td>K3100-02</td>
<td>&nbsp;</td>
<tr>
<td>Megascript RNAi kit</td>
<td>&nbsp;</td>
<td>Ambion</td>
<td>AM1626M</td>
<td>&nbsp;</td>
<tr>
<td>Red dental wax</td>
<td>&nbsp;</td>
<td>Electron Microscopy Sciences</td>
<td>72674</td>
<td>&nbsp;</td>
<tr>
<td>Plastic cups, 1.25 oz and lids</td>
<td>&nbsp;</td>
<td>Solo Cup Company, Urbana Ill.</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<tr>
<td>Fine forceps</td>
<td>&nbsp;</td>
<td>Electron Microscopy Sciences</td>
<td>Various</td>
<td>&nbsp;</td>
<tr>
<td>Insulin syringe</td>
<td>&nbsp;</td>
<td>Monoject</td>
<td>&nbsp;</td>
<td>Fitted with a &frac12;&#x201D;, 29 gauge needle</td>
</tr>
<tr>
<td>Hamilton syringe</td>
<td>&nbsp;</td>
<td>Hamilton</td>
<td>701SN,33/.375&#x201D;/45DGR</td>
<td>Custom made</td>
</tr>
<tr>
<td>TriReagent</td>
<td>&nbsp;</td>
<td>Sigma</td>
<td>93289</td>
<td>&nbsp;</td>
<tr>
<td>iScript One-Step RT-PCR Kit with SYBR Green</td>
<td>&nbsp;</td>
<td>Bio-Rad</td>
<td>170-8892</td>
<td>&nbsp;</td>
<tr>
<td>Real-time PCR detection system</td>
<td>&nbsp;</td>
<td>Bio-Rad</td>
<td>Several</td>
<td>Please refer to <a href="http://www.bio-rad.com/">http://www.bio-rad.com/</a></td>
</tr>		</tbody>
		</table>
		</div>

rna interference in ticks

القراد والطفيليات الخارجية بالعة الدم يلزم من الحيوانات البرية والداجنة والبشر ، وتعتبر في جميع أنحاء العالم والثانية لبعوض الناقل للأمراض البشرية (1) وناقلات أهم تؤثر على صناعة الماشية في جميع أنحاء العالم 2. تصنف القراد في Acari فرعية ، Parasitiformes النظام ، Ixodida رتيبة ، وتوزع في جميع أنحاء العالم من القطب الشمالي الى المناطق الاستوائية 3. على الرغم من الجهود للسيطرة على تفشي التجزئة ، وهذه الطفيليات الخارجية لا تزال تمثل مشكلة خطيرة على صحة الإنسان والحيوان 4،5. تدخل الحمض النووي الريبي (رني) 6 هو حمض النووي عكس النهج القائم على الوراثية التي تنطوي على خلل في التعبير الجيني من أجل تحديد وظيفة الجين أو تأثيره على المسار الأيضي. الرناوات التدخل الصغيرة (siRNAs) هي جزيئات المستجيب للمسار رني التي بدأها المزدوج تقطعت بهم السبل الحمض النووي الريبي (الرنا المزدوج الجديلة) ونتائج قوية في تدهور محددة تسلسل mRNAs حشوية تحتوي على نفس تسلسل الزناد الرنا المزدوج الجديلة 7-9. وقد اكتشفت بعد الترانسكربتي آليات إسكات جينات الرنا المزدوج الجديلة التي بدأتها في جميع حقيقيات النوى درست حتى الآن ، وقد رني نموا سريعا في مجموعة متنوعة من الكائنات الحية كأداة لدراسات الجينوم الفنية وغيرها من التطبيقات 10. أصبح رني الأكثر استخداما إسكات الجينات التقنية في القراد وغيرها من الكائنات حيث النهج البديلة للتلاعب الجيني ليست متوافرة أو غير موثوق 5،11. وقد تم توصيف وراثية محدودة من القراد حتى التطبيق مؤخرا رني 12،13. في الوقت القصير الذي تم رني المتاحة ، وقد ثبت لها أن تكون أداة قيمة لدراسة وظائف الجينات التجزئة ، وتوصيف واجهة القراد الممرض والفرز وتحديد خصائص وقائية من المضادات القرادة 14. هنا ، هو طريقة لوصف رني من خلال حقن الرنا المزدوج الجديلة في القراد غير مغذى. فمن المرجح أن المعرفة المكتسبة من هذا النهج التجريبية ستساهم بشكل ملحوظ في فهم الأنظمة البيولوجية الأساسية وتطوير لقاحات لمكافحة تفشي التجزئة ومنع انتقال مسببات الأمراض التي تنتقل عن طريق القراد 15-19.

Watch this Scientific Journal Video about RNA Interference in Ticks at JoVE.com

RNA Interference in Ticks

وصفت طريقة للتدخل الحمض النووي الريبي (رني) عن طريق الحقن في القراد من الرنا المزدوج الجديلة غير مغذى. رني هي الأكثر استخداما إسكات الجينات التقنية في القراد حيث اقتصر على استخدام وسائل أخرى للتلاعب الجيني.

التدخل في الحمض النووي الريبي القراد

Ticks are obligate hematophagous ectoparasites of wild and domestic animals and humans, and are considered to be second worldwide to mosquitoes as vectors ...

Research

JoVE Journal

Immunology and Infection

18.0K Views.  Oklahoma State University. وصفت طريقة للتدخل الحمض النووي الريبي (رني) عن طريق الحقن في القراد من الرنا المزدوج الجديلة غير مغذى. رني هي الأكثر استخداما إسكات الجينات التقنية في القراد حيث اقتصر على استخدام وسائل أخرى للتلاعب الجيني.

Video: RNA Interference in Ticks

Development of Cell-type specific anti-HIV gp120 aptamers for siRNA delivery

The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering (si)RNAs to inhibit the expression of complementary RNA transcripts is being exploited as a new class of therapeutics for a variety of diseases including HIV. Many previous reports have shown that novel RNAi-based anti-HIV/AIDS therapeutic strategies have considerable promise; however, a key obstacle to the successful therapeutic application and clinical translation of siRNAs is efficient delivery. Particularly, considering the safety and efficacy of RNAi-based therapeutics, it is highly desirable to develop a targeted intracellular siRNA delivery approach to specific cell populations or tissues. The HIV-1 gp120 protein, a glycoprotein envelope on the surface of HIV-1, plays an important role in viral entry into CD4 cells. The interaction of gp120 and CD4 that triggers HIV-1 entry and initiates cell fusion has been validated as a clinically relevant anti-viral strategy for drug discovery. 
Herein, we firstly discuss the selection and identification of 2'-F modified anti-HIV gp120 RNA aptamers. Using a conventional nitrocellulose filter SELEX method, several new aptamers with nanomolar affinity were isolated from a 50 random nt RNA library. In order to successfully obtain bound species with higher affinity, the selection stringency is carefully controlled by adjusting the conditions. The selected aptamers can specifically bind and be rapidly internalized into cells expressing the HIV-1 envelope protein. Additionally, the aptamers alone can neutralize HIV-1 infectivity. Based upon the best aptamer A-1, we also create a novel dual inhibitory function anti-gp120 aptamer-siRNA chimera in which both the aptamer and the siRNA portions have potent anti-HIV activities. Further, we utilize the gp120 aptamer-siRNA chimeras for cell-type specific delivery of the siRNA into HIV-1 infected cells. This dual function chimera shows considerable potential for combining various nucleic acid therapeutic agents (aptamer and siRNA) in suppressing HIV-1 infection, making the aptamer-siRNA chimeras attractive therapeutic candidates for patients failing highly active antiretroviral therapy (HAART).

Several 2&#x2019;-Fluoro RNA aptamers against HIV-1Ba-L gp120 with nanomole affinity are isolated from a RNA library by in vitro SELEX procedure. A new dual inhibitory function anti-gp120 aptamer-siRNA chimera is created and shows considerable promise for systemic anti-HIV therapy.

تطوير خلية من نوع معين الأبتامرات gp120 المضادة لفيروس الإيدز لتسليم سيرنا

The global epidemic of infection by HIV has created an urgent need for new classes of antiretroviral agents. The potent ability of small interfering ...

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne relapsing fever (Borrelia spp.), Rocky Mountain Spotted fever (Rickettsia rickettsii), ehrlichiosis (Ehrlichia chaffeensis and E. equi), anaplasmosis (Anaplasma phagocytophilum), encephalitis (tick-borne encephalitis virus), babesiosis (Babesia spp.), Colorado tick fever (Coltivirus), and tularemia (Francisella tularensis) 1-8. To be properly transmitted into the host these infectious agents differentially regulate gene expression, interact with tick proteins, and migrate through the tick 3,9-13. For example, the Lyme disease agent, Borrelia burgdorferi, adapts through differential gene expression to the feast and famine stages of the tick's enzootic cycle 14,15. Furthermore, as an Ixodes tick consumes a bloodmeal Borrelia replicate and migrate from the midgut into the hemocoel, where they travel to the salivary glands and are transmitted into the host with the expelled saliva 9,16-19.
As a tick feeds the host typically responds with a strong hemostatic and innate immune response 11,13,20-22. Despite these host responses, I. scapularis can feed for several days because tick saliva contains proteins that are immunomodulatory, lytic agents, anticoagulants, and fibrinolysins to aid the tick feeding 3,11,20,21,23. The immunomodulatory activities possessed by tick saliva or salivary gland extract (SGE) facilitate transmission, proliferation, and dissemination of numerous tick-borne pathogens 3,20,24-27. To further understand how tick-borne infectious agents cause disease it is essential to dissect actively feeding ticks and collect tick saliva. This video protocol demonstrates dissection techniques for the collection of hemolymph and the removal of salivary glands from actively feeding I. scapularis nymphs after 48 and 72 hours post mouse placement. We also demonstrate saliva collection from an adult female I. scapularis tick.

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

The collection of infected tick hemolymph, salivary glands, and saliva is important to study how tick-borne pathogens cause disease. In this protocol we demonstrate how to collect hemolymph and salivary glands from feeding Ixodes scapularis nymphs. We also demonstrate saliva collection from female I. scapularis adults.

اللعاب، الغدد اللعابية، وجمع اللمف الدموي من القراد اللبود الكتفي

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Feeding of Ticks on Animals for Transmission and Xenodiagnosis in Lyme Disease Research

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the attachment and blood feeding of Ixodes species ticks on mammalian hosts. In nature, this zoonotic bacterial pathogen may use a variety of reservoir hosts, but the white-footed mouse (Peromyscus leucopus) is the primary reservoir for larval and nymphal ticks in North America. Humans are incidental hosts most frequently infected with B. burgdorferi by the bite of ticks in the nymphal stage. B. burgdorferi adapts to its hosts throughout the enzootic cycle, so the ability to explore the functions of these spirochetes and their effects on mammalian hosts requires the use of tick feeding. In addition, the technique of xenodiagnosis (using the natural vector for detection and recovery of an infectious agent) has been useful in studies of cryptic infection. In order to obtain nymphal ticks that harbor B. burgdorferi, ticks are fed live spirochetes in culture through capillary tubes. Two animal models, mice and nonhuman primates, are most commonly used for Lyme disease studies involving tick feeding. We demonstrate the methods by which these ticks can be fed upon, and recovered from animals for either infection or xenodiagnosis.

Lyme disease is the most commonly-reported vector-borne disease in North America. The causative agent, Borrelia burgdorferi is a spirochete bacterium transmitted by Ixodid ticks. Transmission and detection of infection in animal models is optimized by the use of tick feeding, which we describe here.

Transmission of the etiologic agent of Lyme disease, Borrelia burgdorferi, occurs by the  attachment and blood feeding of Ixodes species ticks on ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

باستخدام الحمض النووي الريبي التدخل للتحقيق في الاستجابة المناعية الفطرية في الفأر الضامة

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Nucleocapsid Annealing-Mediated Electrophoresis (NAME) Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral proteins involved in the regulation of the virus activity recognize several nucleic acids. The nucleocapsid protein NCp7 (NC) is a key protein regulating several processes during virus replication. NC is in fact a chaperone destabilizing the secondary structures of RNA and DNA and facilitating their annealing. The inactivation of NC is a new approach and an interesting target for anti-HIV therapy. The Nucleocapsid Annealing-Mediated Electrophoresis (NAME) assay was developed to identify molecules able to inhibit the melting and annealing of RNA and DNA folded in thermodynamically stable tridimensional conformations, such as hairpin structures of TAR and cTAR elements of HIV, by the nucleocapsid protein of HIV-1. The new assay employs either the recombinant or the synthetic protein, and oligonucleotides without the need of their previous labeling. The analysis of the results is achieved by standard polyacrylamide gel electrophoresis (PAGE) followed by conventional nucleic acid staining. The protocol reported in this work describes how to perform the NAME assay with the full-length protein or its truncated version lacking the basic N-terminal domain, both competent as nucleic acids chaperones, and how to assess the inhibition of NC chaperone activity by a threading intercalator. Moreover, NAME can be performed in two different modes, useful to obtain indications on the putative mechanism of action of the identified NC inhibitors.

Nucleocapsid Annealing-Mediated Electrophoresis NAME Assay Allows the Rapid Identification of HIV-1 Nucleocapsid Inhibitors

This protocol describes NAME, an assay that allows the rapid identification of molecules able to inhibit in vitro the chaperone activities of HIV-1 nucleocapsid protein.

قفيصة منواة التليين بوساطة الكهربائي (NAME) الفحص يسمح للتحديد السريع لHIV-1 قفيصة منواة مثبطات

RNA or DNA folded in stable tridimensional folding are interesting targets in the development of antitumor or antiviral drugs. In the case of HIV-1, viral ...

Applying an Inducible Expression System to Study Interference of Bacterial Virulence Factors with Intracellular Signaling

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a signaling pathway. The method is based, on the one hand, on the inducible expression of a specific protein to initiate a signaling event at a defined and predetermined step in the selected signaling cascade. Concomitant expression, on the other hand, of the gene of interest then allows the investigator to evaluate if the activity of the expressed target protein is located upstream or downstream of the initiated signaling event, depending on the readout of the signaling pathway that is obtained. Here, the apoptotic cascade was selected as a defined signaling pathway to demonstrate protocol functionality. Pathogenic bacteria, such as Coxiella burnetii, translocate effector proteins that interfere with host cell death induction in the host cell to ensure bacterial survival in the cell and to promote their dissemination in the organism. The C. burnetii effector protein CaeB effectively inhibits host cell death after induction of apoptosis with UV-light or with staurosporine. To narrow down at which step CaeB interferes with the propagation of the apoptotic signal, selected proteins with well-characterized pro-apoptotic activity were expressed transiently in a doxycycline-inducible manner. If CaeB acts upstream of these proteins, apoptosis will proceed unhindered. If CaeB acts downstream, cell death will be inhibited. The test proteins selected were Bax, which acts at the level of the mitochondria, and caspase 3, which is the major executioner protease. CaeB interferes with cell death induced by Bax expression, but not by caspase 3 expression. CaeB, thus, interacts with the apoptotic cascade between these two proteins.

The method described here is used to induce the apoptotic signaling cascade at defined steps in order to dissect the activity of an anti-apoptotic bacterial effector protein. This method can also be used for inducible expression of pro-apoptotic or toxic proteins, or for dissecting interference with other signaling pathways.

تطبيق نظام التعبير محرض لدراسة التدخل من العوامل البكتيرية الفوعة مع اشارة بين الخلايا

The technique presented here allows one to analyze at which step a target protein, or alternatively a small molecule, interacts with the components of a ...

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. However, isolating bacterial RNA from infected cells or tissues is a challenging task, since mammalian RNA mostly dominates the lysates of infected cells. Here we describe an optimized method for RNA isolation of Listeria monocytogenes bacteria growing within bone marrow derived macrophage cells. Upon infection, cells are mildly lysed and rapidly filtered to discard most of the host proteins and RNA, while retaining intact bacteria. Next, bacterial RNA is isolated using hot phenol-SDS extraction followed by DNase treatment. The extracted RNA is suitable for gene transcription analysis by multiple techniques. This method is successfully employed in our studies of Listeria monocytogenes gene regulation during infection of macrophage cells 1-4. The protocol can be easily modified to study other bacterial pathogens and cell types.

RNA Purification from Intracellularly Grown Listeria monocytogenes in Macrophage Cells

Here we describe a method for bacterial RNA isolation from Listeria monocytogenes bacteria growing inside murine macrophages. This technique can be used with other intracellular pathogens and mammalian host cells.

RNA تنقية من داخل الخلية المزروعة<em&gt; المستوحدة الليستيريا</em&gt; في خلايا البلاعم

Analysis of the transcriptome of bacterial pathogens during mammalian infection is a valuable tool for studying genes and factors that mediate infection. ...

Small RNA Transfection in Primary Human Th17 Cells by Next Generation Electroporation

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated from na&#239;ve CD4+ T cells in vitro by activating them in the presence of the polarizing cytokines IL-1&#946;, IL-6, IL-23, and TGF&#946;. Th17 cells orchestrate immunity against extracellular bacteria and fungi, but their aberrant activity has also been associated with several autoimmune and inflammatory diseases. Th17 cells are identified by the chemokine receptor CCR6 and defined by their master transcription factor, ROR&#947;t, and characteristic effector cytokine, IL-17A. Optimized culture conditions for Th17 cell differentiation facilitate mechanistic studies of human T cell biology in a controlled environment. They also provide a setting for studying the importance of specific genes and gene expression programs through RNA interference or the introduction of microRNA (miRNA) mimics or inhibitors. This protocol provides an easy to use, reproducible, and highly efficient method for transient transfection of differentiating primary human Th17 cells with small RNAs using a next generation electroporation device.

Next generation electroporation is an efficient method for transfecting human Th17 cells with small RNAs to alter gene expression and cell behavior.

الصغيرة RNA ترنسفكأيشن في الخلايا الأولية Th17 الإنسان من قبل الجيل القادم Electroporation لل

CD4+ T cells can differentiate into several subsets of effector T helper cells depending on the surrounding cytokine milieu. Th17 cells can be generated ...

Identification of Coding and Non-coding RNA Classes Expressed in Swine Whole Blood

The advent of innovative and increasingly powerful next generation sequencing techniques has opened new avenues into the ability to examine the underlying gene expression related to biological processes of interest. These innovations not only allow researchers to observe expression from the mRNA sequences that code for genes that effect cellular function, but also the non-coding RNA (ncRNA) molecules that remain untranslated, but still have regulatory functions. Although researchers have the ability to observe both mRNA and ncRNA expression, it has been customary for a study to focus on one or the other. However, when studies are interested in both mRNA and ncRNA expression, many times they use separate samples to examine either coding or non-coding RNAs due to the difference in library preparations. This can lead to the need for more samples which can increase time, consumables, and animal stress. Additionally, it may cause researchers to decide to prepare samples for only one analysis, usually the mRNA, limiting the number of biological questions that can be investigated. However, ncRNAs span multiple classes with regulatory roles that effect mRNA expression. Because ncRNA are important to fundamental biologic processes and disorder of these processes in during infection, they may, therefore, make attractive targets for therapeutics. This manuscript demonstrates a modified protocol for the generation mRNA and non-coding RNA expression libraries, including viral RNA, from a single sample of whole blood. Optimization of this protocol, improved RNA purity, increased ligation for recovery of methylated RNAs, and omitted&#160;size selection, to allow capture of more RNA species.

Here, we present a protocol optimized for the processing of coding (mRNA) and non-coding&#160;(ncRNA) globin reduced RNA-seq libraries from a single whole blood sample.

وأعرب عن تحديد الترميز وفئات الحمض النووي الريبي غير الترميز في الخنازير الدم كله

The advent of innovative and increasingly powerful next generation sequencing techniques has opened new avenues into the ability to examine the underlying ...

Confocal Imaging of Double-Stranded RNA and Pattern Recognition Receptors in Negative-Sense RNA Virus Infection

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors (PRRs) such as the retinoic acid (RIG-I) like receptors (RLRs) RIG-I and melanoma differentiation-associated protein 5 (MDA-5) leads to the induction of the innate immune response. The formation and intracellular distribution of dsRNA in positive-sense RNA virus infection has been well characterized by microscopy. Many negative-sense RNA viruses, including some arenaviruses, trigger the innate immune response during infection. However, negative-sense RNA viruses were thought to produce low levels of dsRNA, which hinders the imaging study of PRR recognition of viral dsRNA. Additionally, infection experiments with highly pathogenic arenaviruses must be performed in high containment biosafety level facilities (BSL-4). The interaction between viral RNA and PRRs for highly pathogenic RNA virus is largely unknown due to the additional technical challenges that researchers need to face in the BSL-4 facilities. Recently, a monoclonal antibody (Mab) (clone 9D5) originally used for pan-enterovirus detection has been found to specifically detect dsRNA with a higher sensitivity than the traditional J2 or K1 anti-dsRNA antibodies. Herein, by utilizing the 9D5 antibody, we describe a confocal microscopy protocol that has been used successfully to visualize dsRNA, viral protein and PRR simultaneously in individual cells infected by arenavirus. The protocol is also suitable for imaging studies of dsRNA and PRR distribution in pathogenic arenavirus infected cells in BSL4 facilities.

Double-stranded RNA produced during RNA virus replication can be recognized by pattern recognition receptors to induce an innate immune response. For negative-sense RNA viruses, the interaction between the low-level dsRNA and PRRs remains unclear. We have developed a confocal microscopy method to visualize arenavirus dsRNA and PRR in individual cells.

تصوير [كنفوكل] الحمض النووي الريبي مزدوج-الذين تقطعت بهم السبل ونمط الاعتراف مستقبلات في الإصابة بفيروسات الرنا الشعور السلبي

Double-stranded (ds) RNA is produced as a replicative intermediate during RNA virus infection. Recognition of dsRNA by host pattern recognition receptors ...