We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

الإجراء الموضح هنا غلة العدوى الجودة الصارمة وارتفاع ذبابة الفاكهة السوداء البطن. الأمثلة يتضح تركز في المقام الأول على الإصابة بروفيدنسيا الرتغرية وE. القولونية، ولكن البروتوكول هو متكيف جدا ويمكن تطبيقها على العدوى بالبكتيريا المتنوعة على مجموعة من الشروط تربية المضيفة والصيانة. وتفاصيل هذا النهج التجريبي الأمثل تعتمد على البكتيريا المستخدمة للعدوى، وراثى للمضيف، والظروف التجريبية الشاملة. فمن المستحسن لاختبار تجريبي أي ظروف تجريبية جديدة قبل الشروع في مشاريع أكثر طموحا. وهناك نقطة انطلاق جيدة لاختبار ثلاث جرعات العدوى على نطاق 100 أضعاف. للغاية في كثير من الأحيان أفضل عرض مسببات الأمراض الفتاكة المعدية عند تناول جرعات منخفضة جدا، بناء على أمر من 10-100 الخلايا البكتيرية في الطيران. ويمكن حقن مسببات الأمراض الأكثر اعتدالا في جرعات أعلى من حوالي 1،000 البكتيريا في فلوريداص، وغير الممرضة قد يتم حقنه بجرعات عالية مثل 10000 بكتيريا في كل الطاير. غالبا ما يكون من المفيد أن تعرف حركية العدوى الجديدة من خلال تتبع حمولة الممرض، وفيات المضيف، ونشاط الجهاز المناعي على سلسلة زمنية طولية. لأن قياس الحمولة الممرض والتعبير الجيني المضيف والمقايسات مدمرة، فمن الضروري أن تصيب الذباب متميزة في بداية التجربة في كل نقطة زمنية وهذا هو المراد قياسها. عند اتخاذ قرار ما إذا كان استخدام الوخز بالابر أو حقن القائم على microcapillary، فمن المهم أن نلاحظ أن هناك مزايا وعيوب كل نهج. حقن الشعرية يدخل حجم السائل في الطيران، وكلاهما يزيد متواضعة ضغط الامتلاء ويدخل الأملاح أو الجزيئات الأخرى التي يتم تعليق أو الذائبة في الناقل. يتطلب حقن الشعرية أيضا الوصول إلى مرفق حقن أو شراء المعدات اللازمة. ما تستهلكه الصرف الصحي لا يتطلب أي معدات خاصة ويدخلوسائل الاعلام لا تذكر في الطيران، وعادة ما يكون أكثر كفاءة لإصابة أعداد كبيرة من الذباب. ومع ذلك، والتهابات الوخز بالابر لا تسمح مراقبة دقيقة على جرعة العدوى التي يمكن أن يتحقق مع حقن الشعرية. ركز هذا البروتوكول على جهاز حقن أن ينظم ميكانيكيا حجم الحقن، ولكن هناك أيضا أنظمة حقن استنادا نبضات منفصلة من الهواء المضغوط. 20،21 هذه هي عادة أغلى من الأجهزة واردة هنا وتتطلب معايرة نبض الهواء على كل إبرة من أجل ضمان حقن كميات ثابتة. هناك جدلا كبيرا ولكن البيانات قليلة جدا عن كيف تصبح الذباب المصابة بشكل منتظم مع البكتيريا في البرية. بعض المحققين يفترضون أن غالبية الإصابات الطبيعية تحدث عندما ذبابة الفاكهة ابتلاع الجراثيم المسببة للأمراض والبكتيريا وبعد ذلك تمكن من الفرار القناة الهضمية لإقامة العدوى النظامية. ومع ذلك، هناك جدا الحديدالبكتيريا ث المعروفة لتكون قادرة على عبور القناة الهضمية من D. البطن، وتلك التي لديها هذه القدرة هي قاتلة للغاية لالذباب 22،23. نظرية بديلة هي التي تطير بانتظام إصابات جليدية من خلال الهروب من محاولات الافتراس فشل أو هجوم من قبل العث ectoparasitic. ويدعم هذه الفرضية من قبل مجموعة متكررة من البرية D. البطن تحمل بقع التصبغ التي تدل على الجروح تلتئم (الملاحظات غير منشورة). وقد ثبت العث لنقل العدوى البكتيرية في ذبابة الفاكهة 24 والجراح التي العث اليسار يمكن أن يصاب بشكل ثانوي عن طريق البكتيريا في عسل النحل 25. ومع ذلك، فإن تردد في طبيعة الإصابة سوس مدفوعة أو غير ذلك من الانتهازية D. البطن من خلال الخروقات بشرة غير معروف. بروتوكول الموصوفة هنا يسمح إدخال البكتيريا مباشرة في الدملمف من خلال حقن الكمي الذي يتجاوز أي حواجز الظهارية أو immu السلوكيةnity. طرق لتغذية البكتيريا الممرضة للD. وقد وصفت البطن في Vodovar وآخرون. 22 ونعمة وآخرون. 23. العديد من أنواع البكتيريا الممرضة للحشرات تشكل مخاطر قليلة أو معدومة على صحة الإنسان، مما يسمح للباحثين للعمل معهم بشكل مريح. وعلاوة على ذلك، عدد قليل جدا من البكتيريا لديها القدرة على إصابة ذبابة الفاكهة على اتصال دون تدخل التجريبية، وبالتالي فإن خطر &quot;وباء&quot; انتشار العدوى البكتيرية من خلال المختبر عبر الأسطح الملوثة أو هرب الذباب بشكل عام منخفضة جدا. ومع ذلك، فإنه من المستحسن للتأكد من أن تدابير احتواء الكافية في المكان لمنع الذباب المصابة من الهرب ويسترد أي الذباب لاذوا بالفرار. يجب تجهيزه المختبر على مستوى السلامة البيولوجية يتناسب مع أن من مسببات الأمراض المستخدمة، وينبغي استخدام أفضل الممارسات القياسية في علم الأحياء الدقيقة. وinfecti تجريبيعلى الطريقة الموصوفة هنا يسمح للأمراض المعدية من ذبابة الفاكهة السوداء البطن مع أي جرعة من أي بكتيريا التعسفي. بمجرد ثبوت العدوى، فإنه واضح ومباشر لقياس حركية انتشار البكتيريا أو التخليص، لتتبع وفيات المضيف، ومقايسة تحريض الجهاز المناعي المضيف. يمكن بسهولة الذباب المصابة التعرض للفحوصات المظهري الأخرى، بما في ذلك اختبارات الوظائف الفسيولوجية التي قد تشكل أو تكون على شكل من العدوى. الإجراءات المذكورة غير مكلفة، وتتطلب القليل نسبيا المعدات المتخصصة، وعلمت بسهولة، مما يجعلها قابلة للاستخدام في مشاريع متنوعة عبر مجموعة واسعة من البحث والتدريس مختبرات.

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. ذبابة الفاكهة هي غير مكلفة وسهلة العمق، هي قابلة للغاية للتلاعب التجريبية، والمدعومة من قبل المجتمع العلمي واسعة النطاق التي وضعت عريضة مجموعة من أدوات البحث. يتم حفظها العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، بما في ذلك نقل الإشارة بوساطة مستقبلات تول مثل وNF كيلوبايت عوامل النسخ الأسرة، JAK / STAT الإشارات، وردود مسار JNK 1،2 وظيفة هذه الجينات ومسارات يمكن يمكن الاستعلام في D. البطن باستخدام الطفرات أو رني knockdowns أن زيادة أو نقصان مسار الأنشطة 3 - 6 بالإضافة إلى ذلك، ذبابة الفاكهة يمكن استخدامها لدراسة الآثار الفسيولوجية للعدوى والمرض، بما في ذلك في سياق التطور نظرية التاريخ الحياة 7.- 9 جميع هذه الدراسات، ومع ذلك، تعتمد على القدرة على إصابة موثوق الذباب التجريبية في ظل ظروف العلاج المحددة. الإجراء الموضح هنا يمثل الإطار المنهجي لتقديم الالتهابات البكتيرية قوية ومتكررة لذبابة الفاكهة السوداء البطن وبعد ذلك قياس شدة الإصابة وقياس الاستجابة المناعية. ذبابة الفاكهة يمكن بطبيعة الحال وتجريبيا بالعدوى عن طريق مجموعة واسعة من الطفيليات ومسببات الأمراض، بما في ذلك البكتيريا والفطريات والفيروسات والديدان والطفيليات الدبابير. ويركز البروتوكول الحالي على تقديم عدوى بكتيرية النظامية. العديد من أنواع البكتيريا المختلفة التي يمكن استخدامها لتصيب الذباب، وينبغي أن يستند اختيار مجرب على الأسئلة العلمية الدقيقة التي طلب منها ذلك. على سبيل المثال، يمكن استخدامها العزلات السريرية البشرية لدراسة آليات الفوعة البكتيرية 10، أو بيئيا العزلات ذات الصلة قد تكون preferreد لدراسة تطورية. 11 بعض أنواع البكتيريا الممرضة المختصة D. البطن، تنتشر على العدوى والتسبب في المرض المضيف أو الموت. وتمكنت البكتيريا الأخرى على نحو فعال من قبل النظام المناعي المضيفة وبرأت في غضون أيام قليلة. في هذه المظاهرة، سيتم استخدام بروفيدنسيا الرتغرية كما الممرض التكاثري التي يمكن أن تسبب وفيات المضيفة واستمرت في المضيفين على قيد الحياة. وسوف تستخدم الإشريكية القولونية كغير الممرض التي يتم تطهيرها من قبل النظام المناعي المضيف. وسيتم إنشاء العدوى عن طريق إدخال البكتيريا مباشرة في تجويف الجسم من الطاير. هذا النهج يتجاوز الحواجز الظهارية والسلوكيات الوقائية، مما يتيح التحقيق في العدوى النظامية بصرف النظر عن طريقة طبيعية لانتقال العدوى. هناك طريقتان الأساسية لإنشاء تجريبيا العدوى النظامية. في المرحلة الأولى، يتم استخدام nanoinjector وسحب الزجاج الشعرية الإبر لحقن العدد الدقيق للالبكتيريا في الطيران. هذا الأسلوب له مزايا السماح لمجموعة ديناميكية كبيرة من جرعات العدوى وكونها من الناحية الكمية تكرار للغاية. النهج الثاني هو تقديم الإصابة بوخز الصرف الصحي. هذا النهج لديه مزايا يجري السريع والتي لا تتطلب أية معدات خاصة. مرة واحدة يتم وضع العدوى، يصبح من الممكن قياس حمولة النظامية الممرض، وفيات المضيف، ومحرض نشاط الجهاز المناعي. بالطبع، يمكن تصور أن يقاس أي عدد من الظواهر إضافية في D. المصاب البطن، بما في ذلك بعد الإصابة الخصوبة 12، القدرة على التعلم 13، والوضع الأيضي 14، أو تقريبا أي سمة أخرى يمكن أن يتصور.

<table><tbody><tr><td>Incubator</td><td>Powers Scientific, Inc</td><td>DROS52SD</td><td></td></tr><tr><td>Paintbrush</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Flypads</td><td>FlyStuff</td><td>59-114</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt;</td><td>Airgas</td><td>CD FG50</td><td></td></tr><tr><td>Drosophila rearing mix&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>6 oz Square Bottom Bottles, polypropylene</td><td>Genesee Scientific</td><td>32-130</td><td></td></tr><tr><td>Nosterile Extra Large Cotton Balls</td><td>Fisher brand</td><td>22-456-882</td><td></td></tr><tr><td>Microscope</td><td>Olympus Corporation</td><td>SZ51</td><td></td></tr><tr><td>Drosophila Vials polystyrene</td><td>VWR international</td><td>89092-720</td><td></td></tr><tr><td>Nosterile Large Cotton Balls</td><td>Fisher brand</td><td>22-456-883</td><td></td></tr><tr><td>2 L flask</td><td>VWR international</td><td>89000-370</td><td></td></tr><tr><td>Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm;</td><td>VWR international</td><td>25384-302</td><td></td></tr><tr><td>LB Agar, Miller</td><td>Difco</td><td>244520</td><td></td></tr><tr><td>Innoculing Loop</td><td>VWR international</td><td>80094-488</td><td></td></tr><tr><td>Rainin Clasic Pipettes in various sizes&lt;br/&gt; 0.1 &amp;micro;l to 2 &amp;micro;l,&lt;br/&gt; 2 &amp;micro;l to 20 &amp;micro;l,&lt;br/&gt; 20 &amp;micro;l to 200 &amp;micro;l,&lt;br/&gt; 100 &amp;micro;l to 1,000 &amp;micro;l</td><td>Rainin</td><td>PR-2&lt;br/&gt; PR-20&lt;br/&gt; PR-200&lt;br/&gt; PR-1000</td><td></td></tr><tr><td>Micropipette tips (assorted sizes)</td><td>VWR international</td><td>30128-376&lt;br/&gt; 53503-810&lt;br/&gt; 16466-008</td><td></td></tr><tr><td>Luria Broth Base, Miller</td><td>Difco</td><td>241420</td><td></td></tr><tr><td>Disposable Culture Tubes Borosilicate Glass</td><td>VWR international</td><td>47729-576</td><td></td></tr><tr><td>S-500 Orbital Shaker</td><td>VWR international</td><td>14005-830</td><td></td></tr><tr><td>Centrifuge</td><td>VWR international</td><td>37001-300</td><td></td></tr><tr><td>PBS pH 7.4 10X</td><td>Invitrogen</td><td>70011044</td><td></td></tr><tr><td>SmartSpec 3000 Spectrophotometer</td><td>Bio-Rad</td><td>170-2501</td><td></td></tr><tr><td>Semimicrovolume Cuvettes</td><td>Bio-Rad</td><td>223-9955</td><td></td></tr><tr><td>Vertical Capillary Puller</td><td>Kopf Needle Pipette Puller</td><td></td><td></td></tr><tr><td>3.5&#039;&#039; Replacement glass Capillaries for Nanojet II</td><td>Drummond Sientific Company</td><td>3-000-203-G/X</td><td></td></tr><tr><td>Nanoject II</td><td>Drummond Sientific Company</td><td>3-000-204</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11255-20</td><td></td></tr><tr><td>10 ml Syringe</td><td>BD</td><td>309604</td><td></td></tr><tr><td>Mineral Oil, White, light</td><td>Macron Fine Chemicals</td><td>6358-10</td><td></td></tr><tr><td>Minutein pins</td><td>Fine Science Tools</td><td>26002-10</td><td></td></tr><tr><td>1.5 ml&amp;nbsp; Microcentrifuge tubes; Seal Rite</td><td>USA Scientific Inc.</td><td>1615-5500</td><td></td></tr><tr><td>Motorized Pestle; Talboys Laboratory Stirrer</td><td>Troemner</td><td>103</td><td></td></tr><tr><td>Talboys High Throughput Homogenizer</td><td>OPS Diagnostics</td><td>930145</td><td></td></tr><tr><td>5/32&#039;&#039; Grinding Balls</td><td>OPS Diagnostics</td><td>GBSS 156-5000-01</td><td></td></tr><tr><td>Vortex Genie</td><td>Scientific indurstries inc.</td><td>G560</td><td></td></tr><tr><td>Multichannel Pipettor (10 &amp;mu;l - 300 &amp;mu;l)</td><td>Sartorius</td><td>730360</td><td></td></tr><tr><td>WASP2 Whitley Automated Spiral Plater</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>ProtoCOL automated colony counter / plate counter/ plate reader&amp;nbsp;</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-026</td><td></td></tr><tr><td>qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td><td>Bio-Rad</td><td>TLS0801</td><td></td></tr><tr><td>qPCR caps; Optical Flat 8-Cap Strips</td><td>Bio-Rad</td><td>TCS0803</td><td></td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>m610a</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Promega</td><td>m170b</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1240</td><td></td></tr><tr><td>Oligo-dT</td><td>IDT</td><td></td><td></td></tr><tr><td>&amp;nbsp;SsoAdvanced SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5260</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>Bio-Rad</td><td>185-5200</td><td></td></tr><tr><td>RNasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2115</td><td></td></tr></tbody></table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. هي الحفاظ العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، ومنذ ذبابة الفاكهة يمكن بسهولة وراثيا وتجريبيا التلاعب بها، فهي قوية لدراسة وظيفة الجهاز المناعي والآثار الفسيولوجية للمرض. الإجراء أثبت هنا يسمح إصابة الذباب بواسطة إدخال البكتيريا مباشرة في تجويف الجسم، وتجاوز الحواجز الظهارية وأشكال أكثر سلبية للدفاع والسماح التركيز على العدوى النظامية. ويشمل الإجراء بروتوكولات لمعدلات قياس وفيات المضيف، تحميل الممرض النظامية، ودرجة تحريض الجهاز المناعي المضيف. هذا الإجراء العدوى غير مكلفة وقوية وقابلة للتكرار كميا، ويمكن استخدامها في دراسات علم الوراثة وظيفية، التطوري تاريخ الحياة، وعلم وظائف الأعضاء.

يوضح هذا القسم النتائج التي يمكن الحصول عليها بعد العدوى البكتيرية من ذبابة الفاكهة السوداء البطن الشكل 1 يدل على أن جرعة العدوى يختلف مع الكثافة البصرية للتعليق البكتيرية المستخدمة للحقن، وأن الجرعة تسليمها يمكن تقديرها بشكل موثوق من قبل المجانسة والطلاء الذباب على الفور بعد الحقن . كما هو موضح في الشكل 2، يمكن أن مسببات الأمراض المختلفة يسبب مستويات مختلفة من وفيات المضيف (الشكل 2A) وفيات المضيف يمكن أن يكون (الشكل 2B) تعتمد على الجرعة. الأهم من ذلك، هذا البروتوكول يسمح لأنواع مختلفة من الالتهابات التي يتعين تحقيقها: بروفيدنسيا الرتغرية يمكن أن يسبب والعدوى الفرعي قاتلة المزمن الذي لا يزال قائما لمدة 20 يوما أو أكثر (الشكل 3A). ومع ذلك، فإن الغالب أن يتم مسح البكتيريا الأخرى مثل Escerichia القولونية التي كتبها الطاير المضيف في غضون ست ساعات بعد الإصابة (الشكل 3B). تحريض على تميز الكلية المناعيةويمكن تقدير تيم من خلال عزل الحمض النووي الريبي واللاحق QRT-PCR النصوص الببتيد مضادة للجراثيم (4A الشكل وB). بالقياس ولكن أقل من الناحية الكمية، الذباب معربا عن GFP تحت سيطرة المروجين الجين الببتيد مضادات الميكروبات يمكن استخدامها لتصور تحريض الجهاز المناعي (الشكل 4C). <img alt="الشكل 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> تم حقن الجرعة المعدية تحديد الذباب مع 50 NL من تعليق البكتيرية التي تغطي مجموعة واسعة من الكثافة الضوئية (،0001-،05): الشكل 1. كانت الذباب المتجانس على الفور ومطلي لتحديد عدد من بكتيريا التي أدخلتها الحقن. الحمولة الجرثومية الأولية يرتبط بقوة مع OD الأولي حقن (ص 2 = 0.96) <img alt="الرقم 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <s<html> ترونج&gt; الشكل 2: البقاء على قيد الحياة بعد حقن مع مسببات الأمراض البكتيرية تم حقن خمسة إلى سبعة أيام الذكور القديمة مع 50 NL إما تعليق البكتيرية أو وسائل الإعلام معقمة ومراقبتها من أجل البقاء. (A) حقنت الذباب نوع البرية مع ما يقرب من 5000 من البكتيريا واحد من ثلاثة أنواع مختلفة. معدل وفيات المضيف يعتمد بشكل كبير على الأنواع البكتيرية المستخدمة للعدوى. تم حقن (B) الذباب نوع البرية مع ثلاث جرعات مختلفة من Enterococcous البرازية - 50، 500، 5000 وبكتيريا في كل الطاير. الذباب يموت بسرعة أكبر عندما المصابة بجرعات أعلى المعدية (C) تم حقن أحد متحولة جهاز المناعة، والبرية من نوع خط السيطرة إسوي مع ما يقرب من 500 بيركولديريا الشرهة. وتظهر المقارنة البشرى تسجيل رتبة أن من النوع البري يطير يبقى العدوى أفضل بكثير من المسخ (χ 2 = 59.02، DF = 1، ص &lt;0.0001). FO: المحافظة على together.within صفحة = &quot;دائما&quot;&gt; <img alt="الشكل (3)" src="/files/ftp_upload/52613/52613fig3.jpg" /> الرقم 3: الحمولة الجرثومية بعد حقن الذباب تم حقن مع ما يقرب من (A) 5000 P. الرتغرية (B) 3400 E. القولونية. تم تحديد الحمولة الجرثومية فورا بعد الحقن وعلى مختلف نقاط زمنية لاحقة. كل نقطة تمثل بيانات الحمولة الجرثومية من ذبابة واحدة. E. تم مسح القولونية بسرعة من المضيفين تحدى بينما P. الرتغرية استمرت للفترة المتبقية من عمر المضيف،. <img alt="الرقم 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> الرقم 4: تحريض المناعة التعبير الجيني بعد الحقن. تم حقن (A) الذباب مع 50 NL من P. PBS الرتغرية أو معقمة سواء في البطن أو الصدر، أو تركت unmanipulated جانبا من CO <sيو بي&gt; 2 التخدير. بعد ست ساعات العدوى، تم جمع الذباب لعزل الحمض النووي الريبي والتعبير عن Diptericin تم تحديد الجينات باستخدام QRT-PCR. ورسوم بيانية (A) مستويات التعبير على أنها نسبة Diptericin يمكن الاطلاع على نص إلى نص rp49 وتوسيع نطاقها بحيث تحكم CO 2 وتعرف بأنها ذات مستوى التعبير 1. أشرطة تمثل المتوسط ​​والخطأ المعياري للنسب من كل شرط (ن = 4). يتم رسم المستويات (B) التعبير باعتبارها ΔΔCT 2 مع متوسط ​​قيمة C T من CO الذباب السيطرة 2 aesthesia تستخدم كشرط uninduced القياسية. القضبان تمثل الخطأ نفسه ومستوى ΔΔC T من كل شرط (ن = 4). في حين ليس هناك فرق في النص التعريفي بسبب موقع الحقن، والمقارنة لوحات A و B تبين كيف يمكن للطريقة ΔΔC T يحتمل المبالغة مستويات الاستقراء. (C) الذباب معربا عن GFP تحت سيطرة Diptericin حقنت A المروج مع 50 NL من P. الرتغرية (OD = 0.1)، ثم تصوير 7 أيام في وقت لاحق. تظهر لوحة GFP التعبير عن GFP في الجسم الدهون في منطقة البطن من الذباب المصابة، مشيرا إلى تفعيل Diptericin A المروج في الذباب المصابين البكتريا، ولكن ليس الرقابة حقن سائل الإعلام. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> جينة </td><td> إلى الأمام </td><td> الاتجاه المعاكس </td></tr><tr><td> rp49 (وتسمى أيضا rpL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> الجدول 1: كبسولة تفجير عن QRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

العدوى البكتيرية النظامية والمناعة الظواهر الدفاع في<em&gt; الدروسوفيلاميلانوجاستر</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K Views.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

مقدمة لالدبابير الطفيلية من<em&gt; ذبابة الفاكهة</em&gt; والاستجابة المناعية Antiparasite

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

تربية ذبابة الفاكهة<em&gt; ذبابة الفاكهة</em&gt; تحت ممحوضة ومعروف المعايشات شروط

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Developmental Biology

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

قياس كمية الاستجابة المناعية والنوم في<em&gt; ذبابة الفاكهة</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

استخراج هيموسيتيس من اليرقات melanogaster المورفولوجية للعدوى الميكروبية والتحليل

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

إنشاء العدوى الفيروسية، وتحليل التفاعل المضيف للفيروسات في Melanogaster المورفولوجية

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

تقييم الاستجابة المناعية الخلوية ذبابة الفاكهة، melanogaster المورفولوجية، استخدام "في فيفو البلعمه بالانزيم"

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

ذبابة الفاكهة ميلانوغاستر بروتوكول حقن اليرقة

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

شفوي من العدوى البكتيرية وإلقاء في melanogaster المورفولوجية

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biology

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

تقييم القدرة Phagocytic العمر محددة من الكبار دروسوزيلا الهيموسيات الميلانوغاستر باستخدام في فيفو الفاتن الدمج

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Infecting Flies with Bacterial Suspension Using a Nanoinjector

Source: Khalil, S. et al., <a href="https://app.jove.com/v/52613">Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.</a>&#160;J. Vis. Exp.&#160; (2015)
This video demonstrates the nano-injection of bacterial suspension into the fly body cavity, resulting in bacterial multiplication and infection. The fly&#39;s immune response clears some bacteria, while others escape immune clearance and survive within the host causing an infection.

إصابة الذباب بالتعليق البكتيري باستخدام حاقن نانوي

Source: Khalil, S. et al., Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.&#160;J. Vis. Exp.&#160; (2015)
This ...

العدوى البكتيرية النظامية والمناعة الظواهر الدفاع في

Summary

Explore More Videos

Chapters in this video

مقدمة لالدبابير الطفيلية من

تربية ذبابة الفاكهة

قياس كمية الاستجابة المناعية والنوم في