We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

الإجراء الموضح هنا غلة العدوى الجودة الصارمة وارتفاع ذبابة الفاكهة السوداء البطن. الأمثلة يتضح تركز في المقام الأول على الإصابة بروفيدنسيا الرتغرية وE. القولونية، ولكن البروتوكول هو متكيف جدا ويمكن تطبيقها على العدوى بالبكتيريا المتنوعة على مجموعة من الشروط تربية المضيفة والصيانة. وتفاصيل هذا النهج التجريبي الأمثل تعتمد على البكتيريا المستخدمة للعدوى، وراثى للمضيف، والظروف التجريبية الشاملة. فمن المستحسن لاختبار تجريبي أي ظروف تجريبية جديدة قبل الشروع في مشاريع أكثر طموحا. وهناك نقطة انطلاق جيدة لاختبار ثلاث جرعات العدوى على نطاق 100 أضعاف. للغاية في كثير من الأحيان أفضل عرض مسببات الأمراض الفتاكة المعدية عند تناول جرعات منخفضة جدا، بناء على أمر من 10-100 الخلايا البكتيرية في الطيران. ويمكن حقن مسببات الأمراض الأكثر اعتدالا في جرعات أعلى من حوالي 1،000 البكتيريا في فلوريداص، وغير الممرضة قد يتم حقنه بجرعات عالية مثل 10000 بكتيريا في كل الطاير. غالبا ما يكون من المفيد أن تعرف حركية العدوى الجديدة من خلال تتبع حمولة الممرض، وفيات المضيف، ونشاط الجهاز المناعي على سلسلة زمنية طولية. لأن قياس الحمولة الممرض والتعبير الجيني المضيف والمقايسات مدمرة، فمن الضروري أن تصيب الذباب متميزة في بداية التجربة في كل نقطة زمنية وهذا هو المراد قياسها. عند اتخاذ قرار ما إذا كان استخدام الوخز بالابر أو حقن القائم على microcapillary، فمن المهم أن نلاحظ أن هناك مزايا وعيوب كل نهج. حقن الشعرية يدخل حجم السائل في الطيران، وكلاهما يزيد متواضعة ضغط الامتلاء ويدخل الأملاح أو الجزيئات الأخرى التي يتم تعليق أو الذائبة في الناقل. يتطلب حقن الشعرية أيضا الوصول إلى مرفق حقن أو شراء المعدات اللازمة. ما تستهلكه الصرف الصحي لا يتطلب أي معدات خاصة ويدخلوسائل الاعلام لا تذكر في الطيران، وعادة ما يكون أكثر كفاءة لإصابة أعداد كبيرة من الذباب. ومع ذلك، والتهابات الوخز بالابر لا تسمح مراقبة دقيقة على جرعة العدوى التي يمكن أن يتحقق مع حقن الشعرية. ركز هذا البروتوكول على جهاز حقن أن ينظم ميكانيكيا حجم الحقن، ولكن هناك أيضا أنظمة حقن استنادا نبضات منفصلة من الهواء المضغوط. 20،21 هذه هي عادة أغلى من الأجهزة واردة هنا وتتطلب معايرة نبض الهواء على كل إبرة من أجل ضمان حقن كميات ثابتة. هناك جدلا كبيرا ولكن البيانات قليلة جدا عن كيف تصبح الذباب المصابة بشكل منتظم مع البكتيريا في البرية. بعض المحققين يفترضون أن غالبية الإصابات الطبيعية تحدث عندما ذبابة الفاكهة ابتلاع الجراثيم المسببة للأمراض والبكتيريا وبعد ذلك تمكن من الفرار القناة الهضمية لإقامة العدوى النظامية. ومع ذلك، هناك جدا الحديدالبكتيريا ث المعروفة لتكون قادرة على عبور القناة الهضمية من D. البطن، وتلك التي لديها هذه القدرة هي قاتلة للغاية لالذباب 22،23. نظرية بديلة هي التي تطير بانتظام إصابات جليدية من خلال الهروب من محاولات الافتراس فشل أو هجوم من قبل العث ectoparasitic. ويدعم هذه الفرضية من قبل مجموعة متكررة من البرية D. البطن تحمل بقع التصبغ التي تدل على الجروح تلتئم (الملاحظات غير منشورة). وقد ثبت العث لنقل العدوى البكتيرية في ذبابة الفاكهة 24 والجراح التي العث اليسار يمكن أن يصاب بشكل ثانوي عن طريق البكتيريا في عسل النحل 25. ومع ذلك، فإن تردد في طبيعة الإصابة سوس مدفوعة أو غير ذلك من الانتهازية D. البطن من خلال الخروقات بشرة غير معروف. بروتوكول الموصوفة هنا يسمح إدخال البكتيريا مباشرة في الدملمف من خلال حقن الكمي الذي يتجاوز أي حواجز الظهارية أو immu السلوكيةnity. طرق لتغذية البكتيريا الممرضة للD. وقد وصفت البطن في Vodovar وآخرون. 22 ونعمة وآخرون. 23. العديد من أنواع البكتيريا الممرضة للحشرات تشكل مخاطر قليلة أو معدومة على صحة الإنسان، مما يسمح للباحثين للعمل معهم بشكل مريح. وعلاوة على ذلك، عدد قليل جدا من البكتيريا لديها القدرة على إصابة ذبابة الفاكهة على اتصال دون تدخل التجريبية، وبالتالي فإن خطر &quot;وباء&quot; انتشار العدوى البكتيرية من خلال المختبر عبر الأسطح الملوثة أو هرب الذباب بشكل عام منخفضة جدا. ومع ذلك، فإنه من المستحسن للتأكد من أن تدابير احتواء الكافية في المكان لمنع الذباب المصابة من الهرب ويسترد أي الذباب لاذوا بالفرار. يجب تجهيزه المختبر على مستوى السلامة البيولوجية يتناسب مع أن من مسببات الأمراض المستخدمة، وينبغي استخدام أفضل الممارسات القياسية في علم الأحياء الدقيقة. وinfecti تجريبيعلى الطريقة الموصوفة هنا يسمح للأمراض المعدية من ذبابة الفاكهة السوداء البطن مع أي جرعة من أي بكتيريا التعسفي. بمجرد ثبوت العدوى، فإنه واضح ومباشر لقياس حركية انتشار البكتيريا أو التخليص، لتتبع وفيات المضيف، ومقايسة تحريض الجهاز المناعي المضيف. يمكن بسهولة الذباب المصابة التعرض للفحوصات المظهري الأخرى، بما في ذلك اختبارات الوظائف الفسيولوجية التي قد تشكل أو تكون على شكل من العدوى. الإجراءات المذكورة غير مكلفة، وتتطلب القليل نسبيا المعدات المتخصصة، وعلمت بسهولة، مما يجعلها قابلة للاستخدام في مشاريع متنوعة عبر مجموعة واسعة من البحث والتدريس مختبرات.

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. ذبابة الفاكهة هي غير مكلفة وسهلة العمق، هي قابلة للغاية للتلاعب التجريبية، والمدعومة من قبل المجتمع العلمي واسعة النطاق التي وضعت عريضة مجموعة من أدوات البحث. يتم حفظها العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، بما في ذلك نقل الإشارة بوساطة مستقبلات تول مثل وNF كيلوبايت عوامل النسخ الأسرة، JAK / STAT الإشارات، وردود مسار JNK 1،2 وظيفة هذه الجينات ومسارات يمكن يمكن الاستعلام في D. البطن باستخدام الطفرات أو رني knockdowns أن زيادة أو نقصان مسار الأنشطة 3 - 6 بالإضافة إلى ذلك، ذبابة الفاكهة يمكن استخدامها لدراسة الآثار الفسيولوجية للعدوى والمرض، بما في ذلك في سياق التطور نظرية التاريخ الحياة 7.- 9 جميع هذه الدراسات، ومع ذلك، تعتمد على القدرة على إصابة موثوق الذباب التجريبية في ظل ظروف العلاج المحددة. الإجراء الموضح هنا يمثل الإطار المنهجي لتقديم الالتهابات البكتيرية قوية ومتكررة لذبابة الفاكهة السوداء البطن وبعد ذلك قياس شدة الإصابة وقياس الاستجابة المناعية. ذبابة الفاكهة يمكن بطبيعة الحال وتجريبيا بالعدوى عن طريق مجموعة واسعة من الطفيليات ومسببات الأمراض، بما في ذلك البكتيريا والفطريات والفيروسات والديدان والطفيليات الدبابير. ويركز البروتوكول الحالي على تقديم عدوى بكتيرية النظامية. العديد من أنواع البكتيريا المختلفة التي يمكن استخدامها لتصيب الذباب، وينبغي أن يستند اختيار مجرب على الأسئلة العلمية الدقيقة التي طلب منها ذلك. على سبيل المثال، يمكن استخدامها العزلات السريرية البشرية لدراسة آليات الفوعة البكتيرية 10، أو بيئيا العزلات ذات الصلة قد تكون preferreد لدراسة تطورية. 11 بعض أنواع البكتيريا الممرضة المختصة D. البطن، تنتشر على العدوى والتسبب في المرض المضيف أو الموت. وتمكنت البكتيريا الأخرى على نحو فعال من قبل النظام المناعي المضيفة وبرأت في غضون أيام قليلة. في هذه المظاهرة، سيتم استخدام بروفيدنسيا الرتغرية كما الممرض التكاثري التي يمكن أن تسبب وفيات المضيفة واستمرت في المضيفين على قيد الحياة. وسوف تستخدم الإشريكية القولونية كغير الممرض التي يتم تطهيرها من قبل النظام المناعي المضيف. وسيتم إنشاء العدوى عن طريق إدخال البكتيريا مباشرة في تجويف الجسم من الطاير. هذا النهج يتجاوز الحواجز الظهارية والسلوكيات الوقائية، مما يتيح التحقيق في العدوى النظامية بصرف النظر عن طريقة طبيعية لانتقال العدوى. هناك طريقتان الأساسية لإنشاء تجريبيا العدوى النظامية. في المرحلة الأولى، يتم استخدام nanoinjector وسحب الزجاج الشعرية الإبر لحقن العدد الدقيق للالبكتيريا في الطيران. هذا الأسلوب له مزايا السماح لمجموعة ديناميكية كبيرة من جرعات العدوى وكونها من الناحية الكمية تكرار للغاية. النهج الثاني هو تقديم الإصابة بوخز الصرف الصحي. هذا النهج لديه مزايا يجري السريع والتي لا تتطلب أية معدات خاصة. مرة واحدة يتم وضع العدوى، يصبح من الممكن قياس حمولة النظامية الممرض، وفيات المضيف، ومحرض نشاط الجهاز المناعي. بالطبع، يمكن تصور أن يقاس أي عدد من الظواهر إضافية في D. المصاب البطن، بما في ذلك بعد الإصابة الخصوبة 12، القدرة على التعلم 13، والوضع الأيضي 14، أو تقريبا أي سمة أخرى يمكن أن يتصور.

<table border="0" cellpadding="0" cellspacing="0" width="815">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Reagent</td>
			<td style="width:239px;">Company&#160;</td>
			<td style="width:177px;">Part Number</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Incubator</td>
			<td style="width:239px;">Powers Scientific, Inc</td>
			<td style="width:177px;">DROS52SD</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Paintbrush</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2 Flypads</td>
			<td style="width:239px;">FlyStuff</td>
			<td style="width:177px;">59-114</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2</td>
			<td style="width:239px;">Airgas</td>
			<td>CD FG50</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila rearing mix&#160;</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">6 oz Square Bottom Bottles, polypropylene</td>
			<td style="width:239px;">Genesee Scientific</td>
			<td style="width:177px;">32-130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Extra Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-882</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Microscope</td>
			<td style="width:239px;">Olympus Corporation</td>
			<td style="width:177px;">SZ51</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila Vials polystyrene</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">89092-720</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-883</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">2L flask</td>
			<td style="width:239px;">VWR international</td>
			<td>89000-370</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Petri Dishes with Clear Lids, Raised Ridge; 100 . x 15 mm;</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">25384-302</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">LB Agar, Miller</td>
			<td style="width:239px;">Difco</td>
			<td style="width:177px;">244520</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Innoculing Loop</td>
			<td style="width:239px;">VWR international</td>
			<td>80094-488</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:399px;">Rainin Clasic Pipettes in various sizes 
			0.1 &#181;l to 2 &#181;l, 
			2 &#181;l to 20 &#181;l, 
			20 &#181;l to 200 &#181;l, 
			100 &#181;l to 1000</td>
			<td style="width:239px;">Rainin</td>
			<td style="width:177px;">PR-2 
			PR-20 
			PR-200 
			PR-1000</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:399px;">Micropipette tips (assorted sizes)</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">30128-376 
			53503-810 
			16466-008</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria Broth Base, Miller</td>
			<td style="width:239px;">Difco</td>
			<td>241420</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Disposable Culture Tubes Borosilicate Glass</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">47729-576</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">S-500 Orbital Shaker</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">14005-830</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">centrifuge</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">37001-300</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">PBS pH 7.4 10x</td>
			<td style="width:239px;">Invitrogen</td>
			<td style="width:177px;">70011044</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">SmartSpec 3000 Spectrophotometer</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">170-2501</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Semimicrovolume Cuvettes</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">223-9955</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vertical Capillary Puller</td>
			<td style="width:239px;">Kopf Needle Pipette Puller</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">3.5&#39;&#39; Replacement glass Capillaries for Nanojet II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-203-G/X</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nanoject II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Forceps</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">11255-20</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">10mL Syringe</td>
			<td style="width:239px;">BD</td>
			<td style="width:177px;">309604</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mineral Oil, White, light</td>
			<td>Macron Fine Chemicals</td>
			<td>6358-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">minutein pins</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">26002-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">1.5mL&#160; Microcentrifuge tubes; Seal Rite</td>
			<td style="width:239px;">USA Scientific Inc.</td>
			<td style="width:177px;">1615-5500</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Motorized Pestle; Talboys Laboratory Stirrer</td>
			<td style="width:239px;">Troemner</td>
			<td style="width:177px;">103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Talboys High Throughput Homogenizer</td>
			<td style="width:239px;">OPS Diagnostics</td>
			<td style="width:177px;">930145</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">5/32&#39;&#39; Grinding Balls</td>
			<td>OPS Diagnostics</td>
			<td style="width:177px;">GBSS 156-5000-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vortex Genie</td>
			<td style="width:239px;">Scientific indurstries inc.</td>
			<td style="width:177px;">G560</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Multichannel Pipettor (10uL-300uL)</td>
			<td style="width:239px;">Sartorius</td>
			<td>730360</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;"></td>
			<td style="width:239px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">WASP2 Whitley Automated Spiral Plater</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:399px;">ProtoCOL automated colony counter / plate counter/ plate reader&#160;</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">TRIzol</td>
			<td style="width:239px;">Life Technologies</td>
			<td style="width:177px;">15596-026</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TLS0801</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR caps; Optical Flat 8-Cap Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TCS0803</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">RQ1 RNase-Free DNase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m610a</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">M-MLV Reverse Transcriptase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m170b</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">dNTPs</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">U1240</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Oligo-dT</td>
			<td style="width:239px;">IDT</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">&#160;SsoAdvanced SYBR Green Supermix</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">172-5260</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX Connect Real-Time PCR Detection System</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">185-5200</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNasin Ribonuclease Inhibitor</td>
			<td>Promega</td>
			<td>N2115</td>
		</tr>
	</tbody>
</table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

ذبابة الفاكهة ذبابة الفاكهة السوداء البطن هو واحد من الكائنات النموذجية رئيس الوزراء لدراسة وظيفة وتطور الدفاع المناعي. هي الحفاظ العديد من الحصانة الفطرية الجوانب بين الحشرات والثدييات، ومنذ ذبابة الفاكهة يمكن بسهولة وراثيا وتجريبيا التلاعب بها، فهي قوية لدراسة وظيفة الجهاز المناعي والآثار الفسيولوجية للمرض. الإجراء أثبت هنا يسمح إصابة الذباب بواسطة إدخال البكتيريا مباشرة في تجويف الجسم، وتجاوز الحواجز الظهارية وأشكال أكثر سلبية للدفاع والسماح التركيز على العدوى النظامية. ويشمل الإجراء بروتوكولات لمعدلات قياس وفيات المضيف، تحميل الممرض النظامية، ودرجة تحريض الجهاز المناعي المضيف. هذا الإجراء العدوى غير مكلفة وقوية وقابلة للتكرار كميا، ويمكن استخدامها في دراسات علم الوراثة وظيفية، التطوري تاريخ الحياة، وعلم وظائف الأعضاء.

يوضح هذا القسم النتائج التي يمكن الحصول عليها بعد العدوى البكتيرية من ذبابة الفاكهة السوداء البطن الشكل 1 يدل على أن جرعة العدوى يختلف مع الكثافة البصرية للتعليق البكتيرية المستخدمة للحقن، وأن الجرعة تسليمها يمكن تقديرها بشكل موثوق من قبل المجانسة والطلاء الذباب على الفور بعد الحقن . كما هو موضح في الشكل 2، يمكن أن مسببات الأمراض المختلفة يسبب مستويات مختلفة من وفيات المضيف (الشكل 2A) وفيات المضيف يمكن أن يكون (الشكل 2B) تعتمد على الجرعة. الأهم من ذلك، هذا البروتوكول يسمح لأنواع مختلفة من الالتهابات التي يتعين تحقيقها: بروفيدنسيا الرتغرية يمكن أن يسبب والعدوى الفرعي قاتلة المزمن الذي لا يزال قائما لمدة 20 يوما أو أكثر (الشكل 3A). ومع ذلك، فإن الغالب أن يتم مسح البكتيريا الأخرى مثل Escerichia القولونية التي كتبها الطاير المضيف في غضون ست ساعات بعد الإصابة (الشكل 3B). تحريض على تميز الكلية المناعيةويمكن تقدير تيم من خلال عزل الحمض النووي الريبي واللاحق QRT-PCR النصوص الببتيد مضادة للجراثيم (4A الشكل وB). بالقياس ولكن أقل من الناحية الكمية، الذباب معربا عن GFP تحت سيطرة المروجين الجين الببتيد مضادات الميكروبات يمكن استخدامها لتصور تحريض الجهاز المناعي (الشكل 4C). <img alt="الشكل 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> تم حقن الجرعة المعدية تحديد الذباب مع 50 NL من تعليق البكتيرية التي تغطي مجموعة واسعة من الكثافة الضوئية (،0001-،05): الشكل 1. كانت الذباب المتجانس على الفور ومطلي لتحديد عدد من بكتيريا التي أدخلتها الحقن. الحمولة الجرثومية الأولية يرتبط بقوة مع OD الأولي حقن (ص 2 = 0.96) <img alt="الرقم 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <s<html> ترونج&gt; الشكل 2: البقاء على قيد الحياة بعد حقن مع مسببات الأمراض البكتيرية تم حقن خمسة إلى سبعة أيام الذكور القديمة مع 50 NL إما تعليق البكتيرية أو وسائل الإعلام معقمة ومراقبتها من أجل البقاء. (A) حقنت الذباب نوع البرية مع ما يقرب من 5000 من البكتيريا واحد من ثلاثة أنواع مختلفة. معدل وفيات المضيف يعتمد بشكل كبير على الأنواع البكتيرية المستخدمة للعدوى. تم حقن (B) الذباب نوع البرية مع ثلاث جرعات مختلفة من Enterococcous البرازية - 50، 500، 5000 وبكتيريا في كل الطاير. الذباب يموت بسرعة أكبر عندما المصابة بجرعات أعلى المعدية (C) تم حقن أحد متحولة جهاز المناعة، والبرية من نوع خط السيطرة إسوي مع ما يقرب من 500 بيركولديريا الشرهة. وتظهر المقارنة البشرى تسجيل رتبة أن من النوع البري يطير يبقى العدوى أفضل بكثير من المسخ (χ 2 = 59.02، DF = 1، ص &lt;0.0001). FO: المحافظة على together.within صفحة = &quot;دائما&quot;&gt; <img alt="الشكل (3)" src="/files/ftp_upload/52613/52613fig3.jpg" /> الرقم 3: الحمولة الجرثومية بعد حقن الذباب تم حقن مع ما يقرب من (A) 5000 P. الرتغرية (B) 3400 E. القولونية. تم تحديد الحمولة الجرثومية فورا بعد الحقن وعلى مختلف نقاط زمنية لاحقة. كل نقطة تمثل بيانات الحمولة الجرثومية من ذبابة واحدة. E. تم مسح القولونية بسرعة من المضيفين تحدى بينما P. الرتغرية استمرت للفترة المتبقية من عمر المضيف،. <img alt="الرقم 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> الرقم 4: تحريض المناعة التعبير الجيني بعد الحقن. تم حقن (A) الذباب مع 50 NL من P. PBS الرتغرية أو معقمة سواء في البطن أو الصدر، أو تركت unmanipulated جانبا من CO <sيو بي&gt; 2 التخدير. بعد ست ساعات العدوى، تم جمع الذباب لعزل الحمض النووي الريبي والتعبير عن Diptericin تم تحديد الجينات باستخدام QRT-PCR. ورسوم بيانية (A) مستويات التعبير على أنها نسبة Diptericin يمكن الاطلاع على نص إلى نص rp49 وتوسيع نطاقها بحيث تحكم CO 2 وتعرف بأنها ذات مستوى التعبير 1. أشرطة تمثل المتوسط ​​والخطأ المعياري للنسب من كل شرط (ن = 4). يتم رسم المستويات (B) التعبير باعتبارها ΔΔCT 2 مع متوسط ​​قيمة C T من CO الذباب السيطرة 2 aesthesia تستخدم كشرط uninduced القياسية. القضبان تمثل الخطأ نفسه ومستوى ΔΔC T من كل شرط (ن = 4). في حين ليس هناك فرق في النص التعريفي بسبب موقع الحقن، والمقارنة لوحات A و B تبين كيف يمكن للطريقة ΔΔC T يحتمل المبالغة مستويات الاستقراء. (C) الذباب معربا عن GFP تحت سيطرة Diptericin حقنت A المروج مع 50 NL من P. الرتغرية (OD = 0.1)، ثم تصوير 7 أيام في وقت لاحق. تظهر لوحة GFP التعبير عن GFP في الجسم الدهون في منطقة البطن من الذباب المصابة، مشيرا إلى تفعيل Diptericin A المروج في الذباب المصابين البكتريا، ولكن ليس الرقابة حقن سائل الإعلام. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> جينة </td><td> إلى الأمام </td><td> الاتجاه المعاكس </td></tr><tr><td> rp49 (وتسمى أيضا rpL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> الجدول 1: كبسولة تفجير عن QRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

العدوى البكتيرية النظامية والمناعة الظواهر الدفاع في<em&gt; الدروسوفيلاميلانوجاستر</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K Views.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

سبع خطوات لخلايا النجمية

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

قياس الحمولة الجرثومية والاستجابات المناعية في الفئران المصابة المستوحدة الليستيريا</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

إدخال إجهاد القص في دراسة الالتصاق الجرثومي

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

Flow Cytometric Isolation of Primary Murine Type II Alveolar Epithelial Cells for Functional and Molecular Studies

Throughout the last years, the contribution of alveolar type II epithelial cells (AECII) to various aspects of immune regulation in the lung has been increasingly recognized. AECII have been shown to participate in cytokine production in inflamed airways and to even act as antigen-presenting cells in both infection and T-cell mediated autoimmunity 1-8. Therefore, they are especially interesting also in clinical contexts such as airway hyper-reactivity to foreign and self-antigens as well as infections that directly or indirectly target AECII. However, our understanding of the detailed immunologic functions served by alveolar type II epithelial cells in the healthy lung as well as in inflammation remains fragmentary. Many studies regarding AECII function are performed using mouse or human alveolar epithelial cell lines 9-12. Working with cell lines certainly offers a range of benefits, such as the availability of large numbers of cells for extensive analyses. However, we believe the use of primary murine AECII allows a better understanding of the role of this cell type in complex processes like infection or autoimmune inflammation. Primary murine AECII can be isolated directly from animals suffering from such respiratory conditions, meaning they have been subject to all additional extrinsic factors playing a role in the analyzed setting. As an example, viable AECII can be isolated from mice intranasally infected with influenza A virus, which primarily targets these cells for replication 13. Importantly, through ex vivo infection of AECII isolated from healthy mice, studies of the cellular responses mounted upon infection can be further extended.
Our protocol for the isolation of primary murine AECII is based on enzymatic digestion of the mouse lung followed by labeling of the resulting cell suspension with antibodies specific for CD11c, CD11b, F4/80, CD19, CD45 and CD16/CD32. Granular AECII are then identified as the unlabeled and sideward scatter high (SSChigh) cell population and are separated by fluorescence activated cell sorting 3.
In comparison to alternative methods of isolating primary epithelial cells from mouse lungs, our protocol for flow cytometric isolation of AECII by negative selection yields untouched, highly viable and pure AECII in relatively short time. Additionally, and in contrast to conventional methods of isolation by panning and depletion of lymphocytes via binding of antibody-coupled magnetic beads 14, 15, flow cytometric cell-sorting allows discrimination by means of cell size and granularity. Given that instrumentation for flow cytometric cell sorting is available, the described procedure can be applied at relatively low costs. Next to standard antibodies and enzymes for lung disintegration, no additional reagents such as magnetic beads are required. The isolated cells are suitable for a wide range of functional and molecular studies, which include in vitro culture and T-cell stimulation assays as well as transcriptome, proteome or secretome analyses 3, 4.

We describe the rapid isolation of primary murine type II alveolar epithelial cells (AECII) by flow cytometric negative selection. These AECII show high viability and purity and are suitable for a wide range of functional and molecular studies regarding their role in respiratory conditions such as autoimmune or infectious diseases.

عزل تدفق Cytometric من نوع خلايا الفئران الابتدائية السنخية II طلائي للدراسات الوظيفية والجزيئية

Throughout  the last years, the contribution of alveolar type II epithelial cells (AECII)  to various aspects of immune regulation in the lung has been ...

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

قياس كمية الاستجابة المناعية والنوم في<em&gt; ذبابة الفاكهة</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend themselves against pathogen attack. The contribution of a specific Arabidopsis gene to the overall plant immune response can be specifically and quantitatively assessed by assaying the pathogen growth within the infected tissue. For over three decades, the hemibiotrophic bacterium Pseudomonas syringae pv. maculicola ES4326 (Psm ES4326) has been widely applied as the model pathogen to investigate the molecular mechanisms underlying the Arabidopsis immune response. To deliver pathogens into the leaf tissue, multiple inoculation methods have been established, e.g., syringe infiltration, dip inoculation, spray, vacuum infiltration, and flood inoculation. The following protocol describes an optimized syringe infiltration method to deliver virulent Psm ES4326 into leaves of adult soil-grown Arabidopsis plants and accurately screen for enhanced disease susceptibility (EDS) towards this pathogen. In addition, this protocol can be supplemented with multiple pre-treatments to further dissect specific immune defects within different layers of plant defense, including Salicylic Acid (SA)-Triggered Immunity (STI) and MAMP-Triggered Immunity (MTI).

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

Quantification of pathogen growth is a powerful tool to characterize various Arabidopsis thaliana (hereafter: Arabidopsis) immune responses. The method described here presents an optimized syringe infiltration assay to quantify the Pseudomonas syringae pv. maculicola ES4326 growth in adult Arabidopsis leaves.

بكتيريا ورقة تسلل الفحص لتوصيف غرامة الردود الدفاع النبات باستخدام<em&gt; نبات الأرابيدوبسيس thaliana-الزائفة syringae</em&gt; Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

استخراج هيموسيتيس من اليرقات melanogaster المورفولوجية للعدوى الميكروبية والتحليل

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

إنشاء العدوى الفيروسية، وتحليل التفاعل المضيف للفيروسات في Melanogaster المورفولوجية

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Toxicity Study of Zinc Oxide Nanoparticles in Cell Culture and in Drosophila melanogaster

Zinc oxide nanoparticles (ZnO NPs) have a wide range of applications, but the number of reports on ZnO NP-associated toxicity has grown rapidly in recent years. However, studies that elucidate the underlying mechanisms for ZnO NP-induced toxicity are scanty. We determined the toxicity profiles of ZnO NPs using both in vitro and in vivo experimental models. A significant decrease in cell viability was observed in ZnO NP-exposed MRC5 lung fibroblasts, showing that ZnO NPs exert cytotoxic effects. Similarly, interestingly, gut exposed to ZnO NPs exhibited a dramatic increase in reactive oxygen species levels (ROS) in the fruit fly Drosophila. More in-depth studies are required to establish a risk assessment for the increased usage of ZnO NPs by consumers.

Toxicity Study of Zinc Oxide Nanoparticles in Cell Culture and in Drosophila melanogaster

We describe a detailed protocol for evaluating the toxicological profiles of zinc oxide nanoparticles (ZnO NPs) in particular, the type of cell death in human MRC5 lung fibroblasts and ROS formation in the fruit fly Drosophila.

دراسة سمية الجسيمات النانوية أكسيد الزنك في ثقافة الخلية وفي Drosophila melanogaster

Zinc oxide nanoparticles (ZnO NPs) have a wide range of applications, but the number of reports on ZnO NP-associated toxicity has grown rapidly in recent ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

تقييم الاستجابة المناعية الخلوية ذبابة الفاكهة، melanogaster المورفولوجية، استخدام "في فيفو البلعمه بالانزيم"

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

العدوى البكتيرية النظامية والمناعة الظواهر الدفاع في

Summary

Explore More Videos

Chapters in this video