We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

O procedimento descrito aqui produz infecção rigorosa e de alta qualidade de Drosophila melanogaster. Os exemplos ilustrados focado principalmente na infecção com Providencia rettgeri e E. coli, mas o protocolo é extremamente adaptável e pode ser aplicada a diversas infecções com bactérias ao longo de um intervalo de condições de criação de acolhimento e de manutenção. Os detalhes de uma abordagem experimental óptimo dependerá da bactéria utilizada para a infecção, o genótipo do hospedeiro e as condições experimentais gerais. É altamente recomendável para teste piloto quaisquer novas condições experimentais antes de iniciar projetos mais ambiciosos. Um bom ponto de partida é testar três doses de infecção ao longo de um intervalo de 100 vezes. Altamente patógenos virulentos são muitas vezes melhor introduzido em doses infecciosas muito baixos, na ordem de 10-100 células bacterianas por mosca. Agentes patogénicos mais moderadas podem ser injectados com doses mais elevadas de cerca de 1.000 bactérias por FLY, e não-patogénicos pode ser injectado em doses tão elevadas como 10.000 bactérias por mosca. Muitas vezes, é instrutivo para definir a cinética de infecções novas, acompanhando carga de patógenos, a mortalidade de acolhimento, e atividade do sistema imunológico através de uma série de tempo longitudinal. Como medida de carga de patógenos e de expressão génica do hospedeiro são ensaios destrutivos, é necessário infectar moscas distintas no início da experiência para cada ponto de tempo que é para ser medida. Ao decidir se quer usar ou picada de agulha de injeção baseada microcapilar, é importante notar que há vantagens e limitações de cada abordagem. Injecção capilar apresenta um volume de líquido para dentro da mosca, que tanto aumenta modestamente a pressão de turgescência e introduz sais ou outras moléculas que estão suspensos ou dissolvidos no veículo. Injeção capilar também exige o acesso a uma instalação de injecção ou compra do equipamento necessário. Alfinetada fossa séptica não requer nenhum equipamento especial e introduzmídia negligenciáveis ​​na mosca, e é normalmente mais eficiente para infectar um grande número de moscas. No entanto, as infecções pinprick não permitem o controlo preciso sobre a dose de infecção que pode ser conseguido com injecção capilar. O presente protocolo focada em um aparelho de injecção que regula mecanicamente volume de injecção, mas também são baseados em sistemas de injecção de pulsos discretos de ar pressurizado. 20,21 Estes são tipicamente mais caro do que o aparelho apresentado aqui e requerem calibração do impulso de ar para cada agulha, a fim de assegurar o volume de injecção consistente. Há um debate considerável, mas muito poucos dados sobre como se tornar sistemicamente moscas infectadas com a bactéria em estado selvagem. Alguns investigadores postulam que a maioria das infecções naturais ocorrem quando Drosophila ingerir bactérias patogénicas e as bactérias são capazes de escapar posteriormente do intestino para estabelecer uma infecção sistémica. No entanto, existem muito few bactérias conhecidas como sendo capazes de atravessar o intestino de D. melanogaster, e aqueles que têm essa capacidade são altamente letal para moscas 22,23. Uma teoria alternativa é que voa regularmente sustentar os ferimentos cuticulares através de fuga de tentativas fracassadas de predação ou o ataque de ácaros ectoparasitas. Esta hipótese é apoiada pela coleta frequente de D. selvagem melanogaster tendo pontos melanização que são indicativos de feridas cicatrizadas (observações não publicadas). Os ácaros foram mostrados para transmitir infecções bacterianas em Drosophila 24 e feridas deixadas por ácaros pode ser secundariamente infectadas por bactérias em abelhas de mel 25. No entanto, a freqüência na natureza da infecção do ácaro-driven ou de outra forma oportunista de D. melanogaster através de violações de cutícula não é conhecido. O protocolo descrito aqui permite introdução de bactérias diretamente na hemolinfa através de injeção quantitativo que ignora quaisquer barreiras epiteliais ou IMMU comportamentaisnidade. Métodos para a alimentação de bactérias patogénicas para D. melanogaster têm sido descritos em Vodovar et al. 22 e Nehme et ai. 23. Muitas bactérias entomopatogênicos representam pouco ou nenhum risco a saúde humana, permitindo aos pesquisadores para trabalhar com eles confortavelmente. Além disso, muito poucas bactérias têm a capacidade de infectar de Drosophila em contacto sem intervenção experimental, de modo que o risco de &quot;epidemia&quot; propagação da infecção bacteriana através de um laboratório através de superfícies contaminadas ou escapou moscas é geralmente muito baixa. No entanto, é aconselhável para assegurar que as medidas de contenção adequados estão no lugar para evitar moscas infectadas de escapar e para recapturar qualquer escapou moscas. O laboratório deve ser equipado com um nível de segurança biológica comensurável com a dos agentes patogénicos que está sendo utilizado, e melhores práticas padrão em microbiologia deve ser empregue. O infecti experimentalno método descrito aqui permite infecções de Drosophila melanogaster com qualquer dose de qualquer bactéria arbitrária. Uma vez que a infecção tenha sido estabelecido, é simples para medir a cinética de proliferação bacteriana ou recarga, para acompanhar a mortalidade hospedeiro, e a ensaio de indução do sistema imunitário do hospedeiro. Moscas infectadas podem facilmente ser submetido a outros ensaios fenotípicos, incluindo testes de funções fisiológicas que podem moldar ou ser moldados pela infecção. Os procedimentos descritos são baratos, requerem relativamente pouco equipamento especializado, e são facilmente aprendido, tornando-os propícios para o uso em diversos projetos através de uma amplitude de laboratórios de pesquisa e de ensino.

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Drosophila são baratos e fáceis de criar, são altamente passíveis de manipulação experimental, e são apoiados por uma extensa comunidade científica que desenvolveu uma ampla conjunto de ferramentas de pesquisa. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, incluindo a transdução de sinal mediada por receptores Toll-like e NF-kB, factores de transcrição da família de sinalização de JAK / STAT, e as respostas das vias JNK. 1,2 A função destes genes e vias lata ser consultado em D. melanogaster usando mutações ou RNAi knockdowns que as actividades de aumento ou diminuição da via. 3 - 6 Além disso, Drosophila pode ser usado para estudar as conseqüências fisiológicas de infecções e doenças, incluindo no contexto da teoria da história de vida evolutiva 7.- 9 Todos esses estudos, no entanto, depender da capacidade de infectar de forma fiável moscas experimentais sob condições de tratamento definidos. O procedimento aqui descrito apresenta um quadro metodológico para a entrega de infecções bacterianas robustos e repetíveis para Drosophila melanogaster e, posteriormente, medindo a gravidade da infecção e quantificar a resposta imune do hospedeiro. Drosophila pode ser natural e experimentalmente infectados por uma grande variedade de parasitas e organismos patogénicos, incluindo bactérias, fungos, vírus, nematóides e vespas parasitóides. O protocolo atual está focada no fornecimento infecção bacteriana sistêmica. Muitas bactérias diferentes podem ser usados ​​para infectar as moscas, e escolha do experimentador deve basear-se nas questões científicas precisas ser perguntado. Por exemplo, isolados clínicos humanos podem ser utilizados para estudar os mecanismos de virulência da bactéria 10, ou ecologicamente isolados relevantes podem ser preferred para o estudo evolutivo 11. Algumas bactérias são patógenos competentes do D. melanogaster, proliferando em cima de infecção e causando doença host ou morte. Outras bactérias são efectivamente controlado pelo sistema imunitário do hospedeiro e aclarado em poucos dias. Nesta demonstração, Providencia rettgeri vai ser utilizado como um agente patogénico proliferativa que pode causar mortalidade hospedeiro e persiste em sobreviventes hospedeiros. Escherichia coli vai ser utilizado como um agente patogénico que não é eliminado pelo sistema imunitário do hospedeiro. Infecção será estabelecido pela introdução de bactérias directamente para dentro da cavidade do corpo da mosca. Esta abordagem ignora barreiras epiteliais e comportamentos de proteção, permitindo a investigação de infecção sistêmica, independentemente do modo natural de transmissão. Existem dois métodos principais para estabelecer experimentalmente infecção sistêmica. Na primeira, uma nanoinjector capilares de vidro e puxado agulhas são utilizadas para injectar um número exacto debactérias na mosca. Este método tem a vantagem de permitir uma grande gama dinâmica de doses de infecção e de ser quantitativamente altamente repetível. A segunda abordagem é a de proporcionar a infecção com uma picada de agulha séptico. Esta abordagem tem as vantagens de ser rápida e não necessitando de equipamento especial. Uma vez estabelecidas as infecções, torna-se possível medir a carga sistêmica do patógeno, a mortalidade de acolhimento, e atividade do sistema imunológico induzível. É claro, qualquer número de fenótipos adicionais podem concebivelmente ser medidos em D. infectada melanogaster, incluindo pós-infecção fecundidade 12, capacidade de aprendizagem 13, estado metabólico 14, ou virtualmente qualquer outro traço que pode ser imaginado.

<table border="0" cellpadding="0" cellspacing="0" width="815">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Reagent</td>
			<td style="width:239px;">Company&#160;</td>
			<td style="width:177px;">Part Number</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Incubator</td>
			<td style="width:239px;">Powers Scientific, Inc</td>
			<td style="width:177px;">DROS52SD</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Paintbrush</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2 Flypads</td>
			<td style="width:239px;">FlyStuff</td>
			<td style="width:177px;">59-114</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2</td>
			<td style="width:239px;">Airgas</td>
			<td>CD FG50</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila rearing mix&#160;</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">6 oz Square Bottom Bottles, polypropylene</td>
			<td style="width:239px;">Genesee Scientific</td>
			<td style="width:177px;">32-130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Extra Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-882</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Microscope</td>
			<td style="width:239px;">Olympus Corporation</td>
			<td style="width:177px;">SZ51</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila Vials polystyrene</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">89092-720</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-883</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">2L flask</td>
			<td style="width:239px;">VWR international</td>
			<td>89000-370</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Petri Dishes with Clear Lids, Raised Ridge; 100 . x 15 mm;</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">25384-302</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">LB Agar, Miller</td>
			<td style="width:239px;">Difco</td>
			<td style="width:177px;">244520</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Innoculing Loop</td>
			<td style="width:239px;">VWR international</td>
			<td>80094-488</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:399px;">Rainin Clasic Pipettes in various sizes 
			0.1 &#181;l to 2 &#181;l, 
			2 &#181;l to 20 &#181;l, 
			20 &#181;l to 200 &#181;l, 
			100 &#181;l to 1000</td>
			<td style="width:239px;">Rainin</td>
			<td style="width:177px;">PR-2 
			PR-20 
			PR-200 
			PR-1000</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:399px;">Micropipette tips (assorted sizes)</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">30128-376 
			53503-810 
			16466-008</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria Broth Base, Miller</td>
			<td style="width:239px;">Difco</td>
			<td>241420</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Disposable Culture Tubes Borosilicate Glass</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">47729-576</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">S-500 Orbital Shaker</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">14005-830</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">centrifuge</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">37001-300</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">PBS pH 7.4 10x</td>
			<td style="width:239px;">Invitrogen</td>
			<td style="width:177px;">70011044</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">SmartSpec 3000 Spectrophotometer</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">170-2501</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Semimicrovolume Cuvettes</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">223-9955</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vertical Capillary Puller</td>
			<td style="width:239px;">Kopf Needle Pipette Puller</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">3.5&#39;&#39; Replacement glass Capillaries for Nanojet II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-203-G/X</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nanoject II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Forceps</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">11255-20</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">10mL Syringe</td>
			<td style="width:239px;">BD</td>
			<td style="width:177px;">309604</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mineral Oil, White, light</td>
			<td>Macron Fine Chemicals</td>
			<td>6358-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">minutein pins</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">26002-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">1.5mL&#160; Microcentrifuge tubes; Seal Rite</td>
			<td style="width:239px;">USA Scientific Inc.</td>
			<td style="width:177px;">1615-5500</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Motorized Pestle; Talboys Laboratory Stirrer</td>
			<td style="width:239px;">Troemner</td>
			<td style="width:177px;">103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Talboys High Throughput Homogenizer</td>
			<td style="width:239px;">OPS Diagnostics</td>
			<td style="width:177px;">930145</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">5/32&#39;&#39; Grinding Balls</td>
			<td>OPS Diagnostics</td>
			<td style="width:177px;">GBSS 156-5000-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vortex Genie</td>
			<td style="width:239px;">Scientific indurstries inc.</td>
			<td style="width:177px;">G560</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Multichannel Pipettor (10uL-300uL)</td>
			<td style="width:239px;">Sartorius</td>
			<td>730360</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;"></td>
			<td style="width:239px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">WASP2 Whitley Automated Spiral Plater</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:399px;">ProtoCOL automated colony counter / plate counter/ plate reader&#160;</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">TRIzol</td>
			<td style="width:239px;">Life Technologies</td>
			<td style="width:177px;">15596-026</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TLS0801</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR caps; Optical Flat 8-Cap Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TCS0803</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">RQ1 RNase-Free DNase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m610a</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">M-MLV Reverse Transcriptase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m170b</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">dNTPs</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">U1240</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Oligo-dT</td>
			<td style="width:239px;">IDT</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">&#160;SsoAdvanced SYBR Green Supermix</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">172-5260</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX Connect Real-Time PCR Detection System</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">185-5200</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNasin Ribonuclease Inhibitor</td>
			<td>Promega</td>
			<td>N2115</td>
		</tr>
	</tbody>
</table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, e uma vez que a Drosophila pode ser facilmente manipulado geneticamente e experimentalmente, que são poderosos para estudar a função do sistema imunitário e as consequências fisiológicas da doença. O processo demonstrado aqui permite a infecção de moscas através da introdução de bactérias directamente na cavidade do corpo, contornando barreiras epiteliais e formas mais passivas de defesa e permitindo que o foco sobre a infecção sistémica. O procedimento inclui protocolos para medir as taxas de mortalidade de acolhimento, carga patógeno sistémica, e grau de indução do sistema imunitário do hospedeiro. Este procedimento de infecção é barato, robusto e quantitativamente reprodutível, e pode ser utilizado em estudos de genética funcional, história de vida evolucionária, e fisiologia.

Esta secção ilustra os resultados que podem ser obtidos após a infecção bacteriana de Drosophila melanogaster. A Figura 1 mostra que a dose de infecção varia com a densidade óptica da suspensão bacteriana utilizada para a injecção, e que a dose administrada pode ser estimado de forma fiável por homogeneização e revestimento voa imediatamente após a injecção . Tal como ilustrado na Figura 2, diferentes agentes patogénicos podem causar diferentes níveis de mortalidade de acolhimento (Figura 2A) e de mortalidade hospedeira pode ser (Figura 2B), dependente da dose. Importante, este protocolo permite que diferentes tipos de infecções a atingir: Providencia rettgeri pode causar uma infecção crónica, sub-letal que persiste durante 20 dias ou mais (Figura 3A). No entanto, outras bactérias como Escerichia coli vai ser maioritariamente apuradas pela mosca acolhimento no prazo de seis horas após a infecção (Figura 3B). A indução dos sys imunesTEM pode ser estimado através do isolamento de ARN e subsequente qRT-PCR de transcritos de péptidos antibacterianos (Figura 4A e B). De forma análoga, mas menos quantitativamente, moscas expressando GFP sob o controlo de promotores de gene de um péptido antimicrobiano pode ser utilizado para visualizar a indução do sistema imunitário (Figura 4C). <img alt="Figura 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Figura 1: Determinação Dose Infecciosa Moscas foram injectados com 50 nl de suspensões bacterianas que cobrem uma gama de densidades ópticas (,0001-,05). As moscas foram imediatamente homogeneizados e plaqueados para determinar o número de bactérias introduzidas por injecção. A carga bacteriana inicial se correlaciona fortemente com o OD inicial injectado (r 2 = 0,96) <img alt="Figura 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Figura 2:. A sobrevida após injeção com bacterianas Pathogens Cinco a sete dias homens de idade foram injectados com 50 nl de qualquer suspensão bacteriana ou meios estéreis e monitorados para a sobrevivência. (A), as moscas de tipo selvagem foram injetados com aproximadamente 5.000 bactérias a partir de uma das três espécies diferentes. A taxa de mortalidade do hospedeiro depende fortemente das espécies bacterianas utilizadas para a infecção. (B) Tipo Selvagem moscas foram injectados com três doses diferentes de Enterococcous faecalis - 50, 500, e 5.000 bactérias por mosca. Moscas morrem mais rapidamente quando infectados com doses superiores infecciosas (C) Um mutante sistema imunológico e sua linha de controle isogênica de tipo selvagem foram injetados com aproximadamente 500 Burkholderia cepacia. Uma comparação aos pares de Log-Rank mostra que o de tipo selvagem mosca sobrevive à infecção significativamente melhor do que o mutante (χ 2 = 59,02, df = 1, p &lt;0,0001). Figura 3:. A carga bacteriana após injeção moscas foram injectados com aproximadamente (a) 5000 P. rettgeri (B) 3400 E. coli. A carga bacteriana foi determinada imediatamente após a injecção e em vários pontos de tempo subsequentes. Cada ponto de dados representa a carga bacteriana de uma única mosca. E. coli é rapidamente eliminado do anfitriões desafiados enquanto P. rettgeri persistir para o resto da vida do hospedeiro ,. <img alt="Figura 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Figura 4: Indução de Expressão Gênica imune após a injeção. (A) As moscas foram injectados com 50 nl de P. PBS rettgeri ou estéril tanto no abdómen ou tórax, ou foram deixados de lado unmanipulated de CO <sub&gt; 2 anestesia. Seis horas após a infecção, as moscas foram recolhidas para isolamento de ARN e a expressão do Diptericin Um gene foi determinada por meio de qRT-PCR. (A) Os níveis de expressão são representados graficamente como a razão entre Diptericin A transcrição de rp49 transcrição e dimensionado de tal modo que o controlo de CO 2 é definida como possuindo um nível de expressão 1. As barras representam a média e o erro padrão de rácios de cada condição (n = 4). Níveis (B) de expressão são representadas graficamente como um ΔΔCT 2 com o valor de C T média de CO 2 aesthesia moscas de controle usados ​​como a condição não induzida padrão. As barras representam o erro médio e padrão da ΔΔC T a partir de cada condição (n = 4). Embora não exista uma diferença na indução da transcrição devido ao local de injecção, a comparação dos painéis A e B mostra como o método ΔΔC T pode potencialmente sobrestimar os níveis de indução. (C) Moscas que expressa GFP sob o controle do promotor Diptericin A foram injectados com 50 nl de P. rettgeri (OD = 0,1) e em seguida trabalhada 7 dias mais tarde. O painel GFP mostra a expressão de GFP no corpo de gordura abdominal de moscas infectadas, indicando ativação do Diptericin Um promotor em moscas infectadas por bactérias, mas não controles injecção de mídia. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gene </td><td> Para a frente </td><td> Reversa </td></tr><tr><td> rp49 (também chamado rpL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> A Diptericin </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensina </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> A atacina </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabela 1: Iniciadores de qRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Infecção bacteriana sistêmica e Imune Defesa Phenotypes em<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.4K visualizações.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Vídeo: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Sete Passos para Stellate Células

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Imunologia e Infecção

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Medir a carga bacteriana e resposta imune em camundongos infectados com Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Apresentando tensão de cisalhamento em o Estudo da adesão bacteriana

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Uma Introdução à Vespas parasitas de<em&gt; Drosophila</em&gt; E Resposta Imune a antiparasitários

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Flow Cytometric Isolation of Primary Murine Type II Alveolar Epithelial Cells for Functional and Molecular Studies

Throughout the last years, the contribution of alveolar type II epithelial cells (AECII) to various aspects of immune regulation in the lung has been increasingly recognized. AECII have been shown to participate in cytokine production in inflamed airways and to even act as antigen-presenting cells in both infection and T-cell mediated autoimmunity 1-8. Therefore, they are especially interesting also in clinical contexts such as airway hyper-reactivity to foreign and self-antigens as well as infections that directly or indirectly target AECII. However, our understanding of the detailed immunologic functions served by alveolar type II epithelial cells in the healthy lung as well as in inflammation remains fragmentary. Many studies regarding AECII function are performed using mouse or human alveolar epithelial cell lines 9-12. Working with cell lines certainly offers a range of benefits, such as the availability of large numbers of cells for extensive analyses. However, we believe the use of primary murine AECII allows a better understanding of the role of this cell type in complex processes like infection or autoimmune inflammation. Primary murine AECII can be isolated directly from animals suffering from such respiratory conditions, meaning they have been subject to all additional extrinsic factors playing a role in the analyzed setting. As an example, viable AECII can be isolated from mice intranasally infected with influenza A virus, which primarily targets these cells for replication 13. Importantly, through ex vivo infection of AECII isolated from healthy mice, studies of the cellular responses mounted upon infection can be further extended.
Our protocol for the isolation of primary murine AECII is based on enzymatic digestion of the mouse lung followed by labeling of the resulting cell suspension with antibodies specific for CD11c, CD11b, F4/80, CD19, CD45 and CD16/CD32. Granular AECII are then identified as the unlabeled and sideward scatter high (SSChigh) cell population and are separated by fluorescence activated cell sorting 3.
In comparison to alternative methods of isolating primary epithelial cells from mouse lungs, our protocol for flow cytometric isolation of AECII by negative selection yields untouched, highly viable and pure AECII in relatively short time. Additionally, and in contrast to conventional methods of isolation by panning and depletion of lymphocytes via binding of antibody-coupled magnetic beads 14, 15, flow cytometric cell-sorting allows discrimination by means of cell size and granularity. Given that instrumentation for flow cytometric cell sorting is available, the described procedure can be applied at relatively low costs. Next to standard antibodies and enzymes for lung disintegration, no additional reagents such as magnetic beads are required. The isolated cells are suitable for a wide range of functional and molecular studies, which include in vitro culture and T-cell stimulation assays as well as transcriptome, proteome or secretome analyses 3, 4.

We describe the rapid isolation of primary murine type II alveolar epithelial cells (AECII) by flow cytometric negative selection. These AECII show high viability and purity and are suitable for a wide range of functional and molecular studies regarding their role in respiratory conditions such as autoimmune or infectious diseases.

Isolamento de citometria de fluxo de células primárias Murino Tipo II epiteliais alveolares de Estudos funcionais e Molecular

Throughout  the last years, the contribution of alveolar type II epithelial cells (AECII)  to various aspects of immune regulation in the lung has been ...

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Medição quantitativa da resposta imune e do sono em<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence factors, which can subvert and manipulate key host functions. The study of host/pathogen interactions is therefore extremely important to understand bacterial infections and develop alternative strategies to counter infectious diseases. This approach however, requires the development of new high-throughput assays for the unbiased, automated identification and characterization of bacterial virulence determinants. Here, we describe a method for the generation of a GFP-tagged mutant library by transposon mutagenesis and the development of high-content screening approaches for the simultaneous identification of multiple transposon-associated phenotypes. Our working model is the intracellular bacterial pathogen Coxiellaburnetii, the etiological agent of the zoonosis Q fever, which is associated with severe outbreaks with a consequent health and economic burden. The obligate intracellular nature of this pathogen has, until recently, severely hampered the identification of bacterial factors involved in host pathogen interactions, making of Coxiella the ideal model for the implementation of high-throughput/high-content approaches.

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Coxiella burnetii is an obligate intracellular Gram-negative bacterium responsible for the zoonotic disease Q fever. Here we describe methods for the generation of Coxiella fluorescent transposon mutants as well as the automated identification and analysis of the resulting internalization, replication and cytotoxic phenotypes.

Geração e Multi-fenotípica rastreio de alto teor de<em&gt; Coxiella burnetii</em&gt; mutantes por transposões

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence ...

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend themselves against pathogen attack. The contribution of a specific Arabidopsis gene to the overall plant immune response can be specifically and quantitatively assessed by assaying the pathogen growth within the infected tissue. For over three decades, the hemibiotrophic bacterium Pseudomonas syringae pv. maculicola ES4326 (Psm ES4326) has been widely applied as the model pathogen to investigate the molecular mechanisms underlying the Arabidopsis immune response. To deliver pathogens into the leaf tissue, multiple inoculation methods have been established, e.g., syringe infiltration, dip inoculation, spray, vacuum infiltration, and flood inoculation. The following protocol describes an optimized syringe infiltration method to deliver virulent Psm ES4326 into leaves of adult soil-grown Arabidopsis plants and accurately screen for enhanced disease susceptibility (EDS) towards this pathogen. In addition, this protocol can be supplemented with multiple pre-treatments to further dissect specific immune defects within different layers of plant defense, including Salicylic Acid (SA)-Triggered Immunity (STI) and MAMP-Triggered Immunity (MTI).

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

Quantification of pathogen growth is a powerful tool to characterize various Arabidopsis thaliana (hereafter: Arabidopsis) immune responses. The method described here presents an optimized syringe infiltration assay to quantify the Pseudomonas syringae pv. maculicola ES4326 growth in adult Arabidopsis leaves.

Bacteriana Folha Infiltração Ensaio para Belas Caracterização das respostas de defesa da planta usando o Arabidopsis thaliana-Pseudomonas syringae Patossistema

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extração de hemócitos de larvas de Drosophila melanogaster para infecção microbiana e análise

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Estabelecimento de infecção Viral e análise da interação vírus-hospedeiro em Drosophila Melanogaster.

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...