We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

Das hier beschriebene Verfahren ergibt strenge und hohe Qualität Infektion von Drosophila melanogaster. Die dargestellten Beispiele in erster Linie auf eine Infektion mit Providencia rettgeri und E. konzentriert coli, aber das Protokoll ist sehr anpassungsfähig und kann zu Infektionen mit verschiedenen Bakterien über einen Bereich von Wirts Aufzucht und Wartungsbedingungen angewendet werden. Die Einzelheiten einer optimalen Versuchsansatz wird auf dem Bakterium zur Infektion verwendet, dem Genotyp des Wirts, und der allgemeinen experimentellen Bedingungen abhängen. Es wird dringend Pilotversuch keine neuen Versuchsbedingungen vor Einleitung ehrgeiziger Projekte empfohlen. Ein guter Ausgangspunkt ist es, drei Infektion Dosen über einen 100-fachen Bereich zu testen. Hoch virulenten Erreger sind oft am besten bei sehr niedrigen infektiösen Dosen eingebracht, in der Größenordnung von 10 bis 100 Bakterienzellen pro fly. Moderater Erreger können bei höheren Dosen von etwa 1.000 Bakterien pro fl injiziert werdeny, und nicht-Pathogene in Dosen bis zu 10.000 Bakterien pro Fliege injiziert werden. Es ist oft hilfreich, die besonderen Kinetik neuartiger Infektionen durch Verfolgen Keimmenge sorgt Mortalität und Aktivität des Immunsystems über einen Längenzeitreihe zu definieren. Weil Messung Keimmenge und Wirts Genexpression sind destruktiv Assays ist es notwendig, verschiedene entfernt zu Beginn des Experiments für jeden Zeitpunkt, der zu messen ist, zu infizieren. Bei der Entscheidung über Nadelstich oder Mikrokapillare-basierte Einspritz verwenden, ist es wichtig zu beachten, gibt es Vorteile und Grenzen zu jedem Ansatz. Kapillarinjektion führt ein Flüssigkeitsvolumen in die Fliege, die beide geringfügig erhöht Turgor und führt Salze oder andere Moleküle, die suspendiert sind, oder in dem Träger gelöst. Kapillarinjektion erfordert auch den Zugang zu einer Einspritzeinrichtung oder Kauf der erforderlichen Ausrüstung. Septic Nadelstich erfordert keine spezielle Ausrüstung und stelltvernachlässigbar Medien in die Fliege und ist typischerweise effizienter zu infizieren eine große Anzahl von Fliegen. Allerdings haben pinprick Infektionen erlauben die genaue Kontrolle über die Infektionsdosis, die mit Kapillarinjektion erreicht werden kann. Das vorliegende Protokoll das sich auf einer Einspritzvorrichtung, die mechanisch reguliert Injektionsvolumen, es gibt aber auch Einspritzsysteme Basis diskreter Impulse von Druckluft. 20,21 Dies sind in der Regel teurer ist als die Vorrichtung, die hier gekennzeichnet und erfordern eine Kalibrierung des Luftimpulses zu jedem Nadel, um eine konsistente Injektionsvolumina zu gewährleisten. Es gibt beträchtliche Debatte aber nur sehr wenig Daten darüber, wie Fliegen werden systemisch infizierten mit Bakterien in der Wildnis. Einige Forscher postulieren, daß die Mehrzahl der natürlichen Infektionen auftritt, wenn Drosophila einnehmen pathogene Bakterien und die Bakterien werden anschließend in der Lage, den Darm zu entkommen, um eine systemische Infektion zu etablieren. Es gibt jedoch sehr few Bakterien bekannt, dass in der Lage, den Darm von D. überqueren melanogaster, und diejenigen, die diese Fähigkeit zu tun sind sehr tödlich Fliegen 22,23. Eine alternative Theorie ist, dass regelmäßig fliegt aufrecht kutikulären Verletzungen durch Flucht aus dem gescheiterten Raubversuchen oder Angriffen durch ektoparasitären Milben. Diese Hypothese wird durch die häufige Sammlung von Wild D. unterstützt melanogaster Lager Melanisierung sichtbare Flecken weisen auf geheilten Wunden (unveröffentlichte Beobachtungen) sind. Milben wurde gezeigt, dass bakterielle Infektionen in Drosophila 24 übertragen und Wunden durch Milben links sekundär durch Bakterien bei der Honigbiene 25 infiziert werden. Die Häufigkeit in der Natur von milben angetrieben oder anderweitig opportunistische Infektion von D. melanogaster durch Kutikula Verletzungen ist nicht bekannt. Das hier beschriebene Protokoll ermöglicht Einführung der Bakterien direkt in die Hämolymphe durch quantitative Injektion, die keine Epithelbarrieren oder Verhaltens immu umgehtschaft. Verfahren zum Zuführen von pathogenen Bakterien zu D. melanogaster in Vodovar et al. 22 und Nehme et al. 23 beschrieben worden. Viele entomopathogenen Bakterien darstellen wenig oder gar keine Gefährdung der menschlichen Gesundheit, so dass die Forscher mit ihnen bequem arbeiten. Außerdem haben nur sehr wenige Bakterien die Fähigkeit, auf Drosophila Kontakt ohne experimentelle Intervention zu infizieren, so das Risiko einer &quot;Epidemie&quot; Ausbreitung der bakteriellen Infektion durch eine Labor über kontaminierte Flächen oder entkam Fliegen ist in der Regel sehr gering. Dennoch ist es ratsam, um sicherzustellen, dass angemessene Eindämmungsmaßnahmen vorhanden sind, um infizierte Fliegen Flucht zu verhindern und für die Rückeroberung jede entgangen Fliegen. Das Labor sollte in einem biologischen Sicherheitsniveau im Einklang mit, dass der Erreger verwendet ausgestattet werden, und Standard-Best Practices in der Mikrobiologie sollte eingesetzt werden. Die experimentelle infectihier beschriebene Verfahren ermöglicht Infektionen von Drosophila melanogaster mit jeder Dosis von jedem beliebigen Bakterium. Tretener Infektion festgestellt wurde, ist es einfach, die Kinetik der bakterielle Proliferation oder Luft mißt, die Wirts-Sterblichkeit zu verfolgen und die Induktion von dem Immunsystem des Wirts zu testen. Infizierten Fliegen können leicht auf andere phänotypischen Assays, einschließlich Tests der physiologischen Funktionen, die Form oder durch die Infektion förmigen, zu unterziehen. Die beschriebenen Verfahren sind kostengünstig, erfordern relativ wenig spezialisierte Ausrüstung, und sind leicht zu erlernen, so dass sie zugänglich für die Verwendung in verschiedenen Projekten in einer Breite von Forschung und Lehre Labors.

Die Fruchtfliege Drosophila melanogaster ist einer der führenden Modellorganismen zur Untersuchung der Funktion und Evolution der Immunabwehr. Drosophila sind billig und leicht nach hinten, sind sehr offen für experimentelle Manipulation und werden von einer umfangreichen wissenschaftlichen Gemeinschaft, die ein breites entwickelt hat, gesichert Reihe von Forschungswerkzeuge. Viele Aspekte der angeborenen Immunität zwischen Insekten und Säugetieren 1,2 konserviert, einschließlich Signaltransduktion von Toll-like Rezeptoren und NF-kB-Familie Transkriptionsfaktoren, JAK / STAT-Signalisierung und JNK-Weg vermittelten Reaktionen. Die Funktion dieser Gene und Signalwege können in D. abgefragt werden melanogaster mit Mutationen oder RNAi Niederschläge, Zunahme oder Abnahme Weg Aktivitäten. 3 - 6 Zusätzlich Drosophila kann verwendet werden, um die physiologischen Folgen der Infektion und Krankheit zu untersuchen, auch im Rahmen der Evolutionstheorie Lebensgeschichte werden 7.- 9. Allen diesen Untersuchungen ist jedoch abhängig von der Fähigkeit, zuverlässig zu infizieren Versuchslinie unter definierten Behandlungsbedingungen. Das hier beschriebene Verfahren stellt einen methodischen Rahmen für die Bereitstellung von robusten und wiederholbare bakterielle Infektionen zu Drosophila melanogaster und anschließend Messen Infektion Schwere und die Quantifizierung der Immunantwort des Wirts. Drosophila können natürlich und experimentell durch eine große Vielzahl von Parasiten und Krankheitserreger, wie Bakterien, Pilze, Viren, Nematoden und Parasitenwespen infiziert werden. Das aktuelle Protokoll wird auf die Bereitstellung von systemischen bakteriellen Infektion konzentriert. Viele verschiedene Bakterien verwendet werden, um Fliegen zu infizieren, und die Wahl des Experimentators sollte über die genauen wissenschaftlichen Fragen auf der Grundlage aufgefordert werden. Zum Beispiel können menschliche klinische Isolate verwendet, um bakterielle Virulenzmechanismen 10 zu untersuchen, oder ökologisch relevanten Isolate liebsten mit seind für evolutionäre Studie. 11 Einige Bakterien sind Krankheitserreger der zuständigen D. melanogaster, wuchernden bei Infektion und verursacht Host Krankheit oder Tod. Andere Bakterien werden effektiv durch das Immunsystem des Wirts verwaltet und innerhalb von wenigen Tagen vollständig. In dieser Demonstration werden Providencia rettgeri als proliferative Krankheitserreger, der Host Sterblichkeit verursachen und bleibt in lebenden Hosts. Escherichia coli wird als nicht-pathogen, die vom Immunsystem des Wirtes freigegeben wird, verwendet werden, verwendet werden. Infektion wird durch die Einführung von Bakterien direkt in die Körperhöhle des Fliegen hergestellt werden. Dieser Ansatz umgeht Epithelbarrieren und Schutzverhalten, so dass Untersuchung der systemischen Infektion unabhängig von der natürlichen Form der Übertragung. Es gibt grundsätzlich zwei Methoden zur Festlegung experimentell systemische Infektion. In der ersten, eine nanoinjector und zog Glaskapillare Nadeln verwendet werden, um eine genaue Anzahl von injizierenBakterien in der Fliege. Dieses Verfahren hat den Vorteil, dass sie einen großen dynamischen Bereich der Infektionsdosis und der quantitativ höchst reproduzierbar. Der zweite Ansatz ist, um eine Infektion mit einem septischen Nadelstich zu liefern. Dieser Ansatz hat den Vorteil, dass eine schnelle und keine spezielle Ausrüstung erforderlich ist. Sobald die Infektion festgestellt werden, wird es möglich, die systemische Belastung Erreger, Wirt Mortalität und induzierbare Aktivität des Immunsystems zu messen. Natürlich könnte eine beliebige Anzahl von zusätzlichen Phänotypen denkbar in infizierten D. mess melanogaster, auch nach der Infektion Fruchtbarkeit 12, Lernfähigkeit 13, 14 Stoffwechsellage oder praktisch jede andere Eigenschaft, die man sich vorstellen kann.

<table border="0" cellpadding="0" cellspacing="0" width="815">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Reagent</td>
			<td style="width:239px;">Company&#160;</td>
			<td style="width:177px;">Part Number</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Incubator</td>
			<td style="width:239px;">Powers Scientific, Inc</td>
			<td style="width:177px;">DROS52SD</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Paintbrush</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2 Flypads</td>
			<td style="width:239px;">FlyStuff</td>
			<td style="width:177px;">59-114</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">CO2</td>
			<td style="width:239px;">Airgas</td>
			<td>CD FG50</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila rearing mix&#160;</td>
			<td style="width:239px;"></td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">6 oz Square Bottom Bottles, polypropylene</td>
			<td style="width:239px;">Genesee Scientific</td>
			<td style="width:177px;">32-130</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Extra Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-882</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Microscope</td>
			<td style="width:239px;">Olympus Corporation</td>
			<td style="width:177px;">SZ51</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Drosophila Vials polystyrene</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">89092-720</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nosterile Large Cotton Balls</td>
			<td style="width:239px;">Fisher brand</td>
			<td style="width:177px;">22-456-883</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">2L flask</td>
			<td style="width:239px;">VWR international</td>
			<td>89000-370</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Petri Dishes with Clear Lids, Raised Ridge; 100 . x 15 mm;</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">25384-302</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">LB Agar, Miller</td>
			<td style="width:239px;">Difco</td>
			<td style="width:177px;">244520</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Innoculing Loop</td>
			<td style="width:239px;">VWR international</td>
			<td>80094-488</td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:399px;">Rainin Clasic Pipettes in various sizes 
			0.1 &#181;l to 2 &#181;l, 
			2 &#181;l to 20 &#181;l, 
			20 &#181;l to 200 &#181;l, 
			100 &#181;l to 1000</td>
			<td style="width:239px;">Rainin</td>
			<td style="width:177px;">PR-2 
			PR-20 
			PR-200 
			PR-1000</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:399px;">Micropipette tips (assorted sizes)</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">30128-376 
			53503-810 
			16466-008</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Luria Broth Base, Miller</td>
			<td style="width:239px;">Difco</td>
			<td>241420</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Disposable Culture Tubes Borosilicate Glass</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">47729-576</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">S-500 Orbital Shaker</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">14005-830</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">centrifuge</td>
			<td style="width:239px;">VWR international</td>
			<td style="width:177px;">37001-300</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">PBS pH 7.4 10x</td>
			<td style="width:239px;">Invitrogen</td>
			<td style="width:177px;">70011044</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">SmartSpec 3000 Spectrophotometer</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">170-2501</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Semimicrovolume Cuvettes</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">223-9955</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vertical Capillary Puller</td>
			<td style="width:239px;">Kopf Needle Pipette Puller</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">3.5&#39;&#39; Replacement glass Capillaries for Nanojet II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-203-G/X</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Nanoject II</td>
			<td style="width:239px;">Drummond Sientific Company</td>
			<td style="width:177px;">3-000-204</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Forceps</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">11255-20</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">10mL Syringe</td>
			<td style="width:239px;">BD</td>
			<td style="width:177px;">309604</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mineral Oil, White, light</td>
			<td>Macron Fine Chemicals</td>
			<td>6358-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">minutein pins</td>
			<td style="width:239px;">Fine Science Tools</td>
			<td style="width:177px;">26002-10</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">1.5mL&#160; Microcentrifuge tubes; Seal Rite</td>
			<td style="width:239px;">USA Scientific Inc.</td>
			<td style="width:177px;">1615-5500</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Motorized Pestle; Talboys Laboratory Stirrer</td>
			<td style="width:239px;">Troemner</td>
			<td style="width:177px;">103</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Talboys High Throughput Homogenizer</td>
			<td style="width:239px;">OPS Diagnostics</td>
			<td style="width:177px;">930145</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">5/32&#39;&#39; Grinding Balls</td>
			<td>OPS Diagnostics</td>
			<td style="width:177px;">GBSS 156-5000-01</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Vortex Genie</td>
			<td style="width:239px;">Scientific indurstries inc.</td>
			<td style="width:177px;">G560</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Multichannel Pipettor (10uL-300uL)</td>
			<td style="width:239px;">Sartorius</td>
			<td>730360</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;"></td>
			<td style="width:239px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">WASP2 Whitley Automated Spiral Plater</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:399px;">ProtoCOL automated colony counter / plate counter/ plate reader&#160;</td>
			<td style="width:239px;">Microbiology International</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">TRIzol</td>
			<td style="width:239px;">Life Technologies</td>
			<td style="width:177px;">15596-026</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TLS0801</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">qPCR caps; Optical Flat 8-Cap Strips</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">TCS0803</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">RQ1 RNase-Free DNase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m610a</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">M-MLV Reverse Transcriptase</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">m170b</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">dNTPs</td>
			<td style="width:239px;">Promega</td>
			<td style="width:177px;">U1240</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">Oligo-dT</td>
			<td style="width:239px;">IDT</td>
			<td style="width:177px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:399px;">&#160;SsoAdvanced SYBR Green Supermix</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">172-5260</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CFX Connect Real-Time PCR Detection System</td>
			<td style="width:239px;">Bio-Rad</td>
			<td style="width:177px;">185-5200</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNasin Ribonuclease Inhibitor</td>
			<td>Promega</td>
			<td>N2115</td>
		</tr>
	</tbody>
</table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

Die Fruchtfliege Drosophila melanogaster ist einer der führenden Modellorganismen zur Untersuchung der Funktion und Evolution der Immunabwehr. Viele Aspekte der angeborenen Immunität zwischen Insekten und Säugetieren konserviert, und da Drosophila leicht genetisch und experimentell manipuliert werden, stark für die Untersuchung der Funktion des Immunsystems und die physiologischen Folgen der Krankheit sind. Das hier gezeigte Verfahren ermöglicht Infektion von Fliegen durch die Einführung von Bakterien direkt in die Körperhöhle, unter Umgehung Epithelbarrieren und passive Formen der Verteidigung und damit Fokussierung auf systemische Infektion. Das Verfahren umfasst Protokolle für die Messrate der Wirts Mortalität, systemische Keimmenge und der Grad der Induktion von dem Immunsystem des Wirts. Diese Infektion Verfahren ist preiswert, robust und quantitativ reproduzierbar und kann in Studien der funktionellen Genetik, evolutionäre Lebensgeschichte und Physiologie verwendet werden.

Dieser Teil zeigt Ergebnisse, die nach der bakteriellen Infektion von Drosophila melanogaster, erhalten werden kann. Figur 1 zeigt, dass die Infektionsdosis variiert mit der optischen Dichte der bakteriellen Suspension zur Injektion verwendet werden, und dass das gelieferte zuverlässig durch Homogenisieren und Plattieren abschätzen Dosis fliegt unmittelbar nach der Injektion . Wie in Figur 2 dargestellt ist, kann verschiedene Erreger verschiedenen Ebenen der Host Mortalität (2A) und Host-Sterblichkeit führen kann dosisabhängig (2B) ist. Wichtig ist, ermöglicht dieses Protokoll für verschiedene Typen von Infektionen erreicht werden: Providencia rettgeri kann eine chronische subletaler Infektion, für 20 Tage oder länger (3A) besteht verursachen. Aber auch andere Bakterien wie Escerichia coli wird meist durch den Host-fly innerhalb von sechs Stunden nach der Infektion (3B) gelöscht werden. Induktion der Immun system kann durch RNA-Isolierung und anschließende qRT-PCR von antibakteriellen Peptid-Transkripte (4A und B) geschätzt werden. Analog, jedoch weniger quantitativ, Fliegen, die GFP unter der Kontrolle des antimikrobiellen Peptids Genpromotoren verwendet werden, um die Induktion des Immunsystems (4C) zu visualisieren. <img alt="Abbildung 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Abbildung 1: Bestimmung Infektionsdosis Fliegen wurden mit 50 nl von Bakteriensuspensionen, die einen Bereich von optischen Dichten (0,0001 bis 0,05) injiziert. Die Fliegen wurden sofort homogenisiert und ausplattiert, um die Zahl der Bakterien durch die Injektion eingeführt zu bestimmen. Initial bakterielle Belastung korreliert stark mit Anfangs-OD injiziert (r 2 = 0,96) <img alt="Figur 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Abbildung 2:. Überleben nach der Injektion mit bakterieller Pathogene Fünf bis sieben Tage alte Männer wurden mit 50 nl entweder bakteriellen Suspension oder sterile Medien eingespritzt und für das Überleben überwacht. (A) Wildtyp-Fliegen wurden mit etwa 5.000 Bakterien aus einer von drei verschiedenen Spezies injiziert. Die Rate des Host Mortalität hängt stark von den für die Infektion verwendeten Bakterienspezies. 50, 500 und 5.000 Bakterien pro fly - (B) Wildtyp-Fliegen wurden mit drei verschiedenen Dosen von Enterococcous faecalis injiziert. Fliegen sterben schneller, wenn mit höheren infektiösen Dosen (C) infiziert Ein Immunsystem Mutanten und ihre Wildtyp-isogenen Steuerleitung wurden mit etwa 500 Burkholderia cepacia injiziert. Eine paarweise Log-Rank-Vergleich zeigt, dass die Wildtyp-fly die Infektion deutlich besser als der Mutante (χ 2 = 59.02, df = 1, p &lt;0,0001) überlebt. Abb. 3: bakterielle Belastung nach der Injektion Fliegen wurden mit etwa (A) 5000 P. injiziert rettgeri (B) 3400 E. coli. Bakterielle Belastung wurde unmittelbar nach der Injektion und bei verschiedenen nachfolgenden Zeitpunkte bestimmt. Jeder Datenpunkt stellt die bakterielle Belastung einer einzigen Fliege. E. coli schnell von Hosts in Frage gestellt, während P. gelöscht rettgeri bleibt für den Rest des Hosts Leben ,. <img alt="Figur 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Abbildung 4: Induktion von Immun Gene Expression nach der Injektion. (A) Die Fliegen wurden mit 50 nl injiziert P. rettgeri oder sterilem PBS entweder in den Bauch oder Brustkorb, oder wurden aus CO links unmanipulated beiseite <sub&gt; 2 Anästhesie. Sechs Stunden nach der Infektion wurden die Fliegen für die RNA-Isolierung und Expression des Diptericin Ein Gen wurde mit qRT-PCR bestimmt gesammelt. (A) Expressionsniveaus werden als das Verhältnis der Diptericin graphisch dargestellt, um ein Transkript rp49 Transkript und skaliert, dass die CO 2 Steuerung als eine Expressionsniveau 1. Die Balken stellen den Mittelwert und Standardfehler von Verhältnissen von jeder Bedingung definiert (n = 4). (B) Die Expressionsniveaus werden als 2 ΔΔCT mit der durchschnittlichen C T-Wert von CO 2 aesthesia Kontrollfliegen als Standard nicht-induzierten Zustand gebraucht grafisch dargestellt. Die Balken stellen den Mittelwert und Standardfehler der ΔΔC T von jedem Zustand (n = 4). Zwar gibt es keinen Unterschied in der Niederschrift Induktion aufgrund der Injektionsstelle, Vergleich der Platten A und B zeigt, wie die ΔΔC T Methode kann potenziell zu überschätzen Induktionsniveaus. (C) Fliegt, die GFP unter der Kontrolle des Promotors Diptericin A wurden mit 50 nl injiziert P. rettgeri (OD = 0,1) und dann abgebildet wird 7 Tage später. Die GFP-Panel zeigt die Expression von GFP in der Bauchfettkörper der infizierten Fliegen, was die Aktivierung des Diptericin Ein Promotor in bakteriell infizierten Fliegen, aber nicht medien injizierten Kontrollen. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gen </td><td> Vorwärts </td><td> Rückwärts </td></tr><tr><td> rp49 (auch genannt rpL32) </td><td> 5&#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5&#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5&#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5&#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5&#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5&#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5&#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5&#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5&#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5&#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5&#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabelle 1: Primer für qRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Systemische bakterielle Infektion und Immunabwehr Phänotypen in<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.4K Aufrufe.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Serie: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Seven Steps to Cells Stellate

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Forschung

Immunologie und Infektion

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of Listeria, which results in systemic infection2. After injection, Listeria quickly disseminates to the spleen and liver due to uptake by CD8&alpha;+ dendritic cells and Kupffer cells3,4. Once phagocytosed, various bacterial proteins enable Listeria to escape the phagosome, survive within the cytosol, and infect neighboring cells5. During the first three days of infection, different innate immune cells (e.g. monocytes, neutrophils, NK cells, dendritic cells) mediate bactericidal mechanisms that minimize Listeria proliferation. CD8+ T cells are subsequently recruited and responsible for the eventual clearance of Listeria from the host, typically within 10 days of infection6.
Successful clearance of Listeria from infected mice depends on the appropriate onset of host immune responses6	. There is a broad range of sensitivities amongst inbred mouse strains7,8. Generally, mice with increased susceptibility to Listeria infection are less able to control bacterial proliferation, demonstrating increased bacterial load and/or delayed clearance compared to resistant mice. Genetic studies, including linkage analyses and knockout mouse strains, have identified various genes for which sequence variation affects host responses to Listeria infection6,8-14. Determination and comparison of infection kinetics between different mouse strains is therefore an important method for identifying host genetic factors that contribute to immune responses against Listeria. Comparison of host responses to different Listeria strains is also an effective way to identify bacterial virulence factors that may serve as potential targets for antibiotic therapy or vaccine design.
We describe here a straightforward method for measuring bacterial load (colony forming units [CFU] per tissue) and preparing single-cell suspensions of the liver and spleen for FACS analysis of immune responses in Listeria-infected mice. This method is particularly useful for initial characterization of Listeria infection in novel mouse strains, as well as comparison of immune responses between different mouse strains infected with Listeria. We use the Listeria monocytogenes EGD strain15 that, when cultured on blood agar, exhibits a characteristic halo zone around each colony due to &beta;-hemolysis1 (Figure 1). Bacterial load and immune responses can be determined at any time-point after infection by culturing tissue homogenate on blood agar plates and preparing tissue cell suspensions for FACS analysis using the protocols described below. We would note that individuals who are immunocompromised or pregnant should not handle Listeria, and the relevant institutional biosafety committee and animal facility management should be consulted before work commences.

Measuring Bacterial Load and Immune Responses in Mice Infected with Listeria monocytogenes

Listeria monocytogenes is a model organism for studying immune responses and genetic susceptibility to intracellular bacteria in mice. This method enables one to measure bacterial load and generate single-cell suspensions of the liver and spleen from mice for FACS analysis to determine changes in immune cells due to Listeria infection.

Mess-bakterielle Belastung und Immunreaktionen in Mäuse Infizierte mit Listeria monocytogenes</em

Listeria monocytogenes (Listeria) is a Gram-positive facultative intracellular pathogen1. Mouse studies typically employ intravenous injection of ...

Introducing Shear Stress in the Study of Bacterial Adhesion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the initial and determining step of the pathogenesis. Although experimentally adhesion is mostly studied in static conditions adhesion actually takes place in the presence of flowing liquid. First encounters between bacteria and their host often occur at the mucosal level, mouth, lung, gut, eye, etc. where mucus flows along the surface of epithelial cells. Later in infection, pathogens occasionally access the blood circulation causing life-threatening illnesses such as septicemia, sepsis and meningitis. A defining feature of these infections is the ability of these pathogens to interact with endothelial cells in presence of circulating blood. The presence of flowing liquid, mucus or blood for instance, determines adhesion because it generates a mechanical force on the pathogen. To characterize the effect of flowing liquid one usually refers to the notion of shear stress, which is the tangential force exerted per unit area by a fluid moving near a stationary wall, expressed in dynes/cm2. Intensities of shear stress vary widely according to the different vessels type, size, organ, location etc. (0-100 dynes/cm2). Circulation in capillaries can reach very low shear stress values and even temporarily stop during periods ranging between a few seconds to several minutes 1. On the other end of the spectrum shear stress in arterioles can reach 100 dynes/cm2 2. The impact of shear stress on different biological processes has been clearly demonstrated as for instance during the interaction of leukocytes with the endothelium 3. To take into account this mechanical parameter in the process of bacterial adhesion we took advantage of an experimental procedure based on the use of a disposable flow chamber 4. Host cells are grown in the flow chamber and fluorescent bacteria are introduced in the flow controlled by a syringe pump. We initially focused our investigations on the bacterial pathogen Neisseria meningitidis, a Gram-negative bacterium responsible for septicemia and meningitis. The procedure described here allowed us to study the impact of shear stress on the ability of the bacteria to: adhere to cells 1, to proliferate on the cell surface 5and to detach to colonize new sites 6 (Figure 1). Complementary technical information can be found in reference 7. Shear stress values presented here were chosen based on our previous experience1 and to represent values found in the literature. The protocol should be applicable to a wide range of pathogens with specific adjustments depending on the objectives of the study.

During the infection process, a key step is the adhesion of pathogens with host cells. In most instances this adhesion step occurs in the presence of mechanical stress generated by flowing liquid. We describe a technique that introduces shear stress as an important parameter in the study of bacterial adhesion.

Introducing Schubspannung in der Studie der bakteriellen Adhäsion

During bacterial infections a sequence of interactions occur between the pathogen and its host. Bacterial adhesion to the host cell surface is often the ...

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Eine Einführung in die parasitischen Wespen<em&gt; Drosophila</em&gt; Und die antiparasitäre Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Flow Cytometric Isolation of Primary Murine Type II Alveolar Epithelial Cells for Functional and Molecular Studies

Throughout the last years, the contribution of alveolar type II epithelial cells (AECII) to various aspects of immune regulation in the lung has been increasingly recognized. AECII have been shown to participate in cytokine production in inflamed airways and to even act as antigen-presenting cells in both infection and T-cell mediated autoimmunity 1-8. Therefore, they are especially interesting also in clinical contexts such as airway hyper-reactivity to foreign and self-antigens as well as infections that directly or indirectly target AECII. However, our understanding of the detailed immunologic functions served by alveolar type II epithelial cells in the healthy lung as well as in inflammation remains fragmentary. Many studies regarding AECII function are performed using mouse or human alveolar epithelial cell lines 9-12. Working with cell lines certainly offers a range of benefits, such as the availability of large numbers of cells for extensive analyses. However, we believe the use of primary murine AECII allows a better understanding of the role of this cell type in complex processes like infection or autoimmune inflammation. Primary murine AECII can be isolated directly from animals suffering from such respiratory conditions, meaning they have been subject to all additional extrinsic factors playing a role in the analyzed setting. As an example, viable AECII can be isolated from mice intranasally infected with influenza A virus, which primarily targets these cells for replication 13. Importantly, through ex vivo infection of AECII isolated from healthy mice, studies of the cellular responses mounted upon infection can be further extended.
Our protocol for the isolation of primary murine AECII is based on enzymatic digestion of the mouse lung followed by labeling of the resulting cell suspension with antibodies specific for CD11c, CD11b, F4/80, CD19, CD45 and CD16/CD32. Granular AECII are then identified as the unlabeled and sideward scatter high (SSChigh) cell population and are separated by fluorescence activated cell sorting 3.
In comparison to alternative methods of isolating primary epithelial cells from mouse lungs, our protocol for flow cytometric isolation of AECII by negative selection yields untouched, highly viable and pure AECII in relatively short time. Additionally, and in contrast to conventional methods of isolation by panning and depletion of lymphocytes via binding of antibody-coupled magnetic beads 14, 15, flow cytometric cell-sorting allows discrimination by means of cell size and granularity. Given that instrumentation for flow cytometric cell sorting is available, the described procedure can be applied at relatively low costs. Next to standard antibodies and enzymes for lung disintegration, no additional reagents such as magnetic beads are required. The isolated cells are suitable for a wide range of functional and molecular studies, which include in vitro culture and T-cell stimulation assays as well as transcriptome, proteome or secretome analyses 3, 4.

We describe the rapid isolation of primary murine type II alveolar epithelial cells (AECII) by flow cytometric negative selection. These AECII show high viability and purity and are suitable for a wide range of functional and molecular studies regarding their role in respiratory conditions such as autoimmune or infectious diseases.

Durchflusszytometrische Isolation of Primary Murine Type II Alveolarepithelzellen für Funktionelle und Molekulare Studien

Throughout  the last years, the contribution of alveolar type II epithelial cells (AECII)  to various aspects of immune regulation in the lung has been ...

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Quantitative Messung der Immunantwort und Sleep in<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence factors, which can subvert and manipulate key host functions. The study of host/pathogen interactions is therefore extremely important to understand bacterial infections and develop alternative strategies to counter infectious diseases. This approach however, requires the development of new high-throughput assays for the unbiased, automated identification and characterization of bacterial virulence determinants. Here, we describe a method for the generation of a GFP-tagged mutant library by transposon mutagenesis and the development of high-content screening approaches for the simultaneous identification of multiple transposon-associated phenotypes. Our working model is the intracellular bacterial pathogen Coxiellaburnetii, the etiological agent of the zoonosis Q fever, which is associated with severe outbreaks with a consequent health and economic burden. The obligate intracellular nature of this pathogen has, until recently, severely hampered the identification of bacterial factors involved in host pathogen interactions, making of Coxiella the ideal model for the implementation of high-throughput/high-content approaches.

Generation and Multi-phenotypic High-content Screening of Coxiella burnetii Transposon Mutants

Coxiella burnetii is an obligate intracellular Gram-negative bacterium responsible for the zoonotic disease Q fever. Here we describe methods for the generation of Coxiella fluorescent transposon mutants as well as the automated identification and analysis of the resulting internalization, replication and cytotoxic phenotypes.

Generation und Multi-phänotypischen High-Content-Screening<em&gt; Coxiella burnetii</em&gt; Transposon-Mutanten

Invasion and colonization of host cells by bacterial pathogens depend on the activity of a large number of prokaryotic proteins, defined as virulence ...

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend themselves against pathogen attack. The contribution of a specific Arabidopsis gene to the overall plant immune response can be specifically and quantitatively assessed by assaying the pathogen growth within the infected tissue. For over three decades, the hemibiotrophic bacterium Pseudomonas syringae pv. maculicola ES4326 (Psm ES4326) has been widely applied as the model pathogen to investigate the molecular mechanisms underlying the Arabidopsis immune response. To deliver pathogens into the leaf tissue, multiple inoculation methods have been established, e.g., syringe infiltration, dip inoculation, spray, vacuum infiltration, and flood inoculation. The following protocol describes an optimized syringe infiltration method to deliver virulent Psm ES4326 into leaves of adult soil-grown Arabidopsis plants and accurately screen for enhanced disease susceptibility (EDS) towards this pathogen. In addition, this protocol can be supplemented with multiple pre-treatments to further dissect specific immune defects within different layers of plant defense, including Salicylic Acid (SA)-Triggered Immunity (STI) and MAMP-Triggered Immunity (MTI).

Bacterial Leaf Infiltration Assay for Fine Characterization of Plant Defense Responses using the Arabidopsis thaliana-Pseudomonas syringae Pathosystem

Quantification of pathogen growth is a powerful tool to characterize various Arabidopsis thaliana (hereafter: Arabidopsis) immune responses. The method described here presents an optimized syringe infiltration assay to quantify the Pseudomonas syringae pv. maculicola ES4326 growth in adult Arabidopsis leaves.

Bakterielle Blatt Infiltration Assay für Bildende Charakterisierung pflanzlicher Abwehrreaktionen mit Hilfe der<em&gt; Arabidopsis thaliana-Pseudomonas syringae</em&gt; Pathosystem

In the absence of specialized mobile immune cells, plants utilize their localized programmed cell death and Systemic Acquired Resistance to defend ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extraktion von Hemocytes aus Drosophila Melanogaster Larven für mikrobielle Infektionen und Analyse

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Gründung der Virusinfektion und Analyse von Host-Virus-Wechselwirkung in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...