Name: systemic bacterial infection and immune defense phenotypes in drosophila melanogaster
Uploaded: 2015-05-13T13:00:00.000+00:00
Duration: 10 min 12 s
Description: Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

Das hier beschriebene Verfahren ergibt strenge und hohe Qualität Infektion von Drosophila melanogaster. Die dargestellten Beispiele in erster Linie auf eine Infektion mit Providencia rettgeri und E. konzentriert coli, aber das Protokoll ist sehr anpassungsfähig und kann zu Infektionen mit verschiedenen Bakterien über einen Bereich von Wirts Aufzucht und Wartungsbedingungen angewendet werden. Die Einzelheiten einer optimalen Versuchsansatz wird auf dem Bakterium zur Infektion verwendet, dem Genotyp des Wirts, und der allgemeinen experimentellen Bedingungen abhängen. Es wird dringend Pilotversuch keine neuen Versuchsbedingungen vor Einleitung ehrgeiziger Projekte empfohlen. Ein guter Ausgangspunkt ist es, drei Infektion Dosen über einen 100-fachen Bereich zu testen. Hoch virulenten Erreger sind oft am besten bei sehr niedrigen infektiösen Dosen eingebracht, in der Größenordnung von 10 bis 100 Bakterienzellen pro fly. Moderater Erreger können bei höheren Dosen von etwa 1.000 Bakterien pro fl injiziert werdeny, und nicht-Pathogene in Dosen bis zu 10.000 Bakterien pro Fliege injiziert werden. Es ist oft hilfreich, die besonderen Kinetik neuartiger Infektionen durch Verfolgen Keimmenge sorgt Mortalität und Aktivität des Immunsystems über einen Längenzeitreihe zu definieren. Weil Messung Keimmenge und Wirts Genexpression sind destruktiv Assays ist es notwendig, verschiedene entfernt zu Beginn des Experiments für jeden Zeitpunkt, der zu messen ist, zu infizieren. Bei der Entscheidung über Nadelstich oder Mikrokapillare-basierte Einspritz verwenden, ist es wichtig zu beachten, gibt es Vorteile und Grenzen zu jedem Ansatz. Kapillarinjektion führt ein Flüssigkeitsvolumen in die Fliege, die beide geringfügig erhöht Turgor und führt Salze oder andere Moleküle, die suspendiert sind, oder in dem Träger gelöst. Kapillarinjektion erfordert auch den Zugang zu einer Einspritzeinrichtung oder Kauf der erforderlichen Ausrüstung. Septic Nadelstich erfordert keine spezielle Ausrüstung und stelltvernachlässigbar Medien in die Fliege und ist typischerweise effizienter zu infizieren eine große Anzahl von Fliegen. Allerdings haben pinprick Infektionen erlauben die genaue Kontrolle über die Infektionsdosis, die mit Kapillarinjektion erreicht werden kann. Das vorliegende Protokoll das sich auf einer Einspritzvorrichtung, die mechanisch reguliert Injektionsvolumen, es gibt aber auch Einspritzsysteme Basis diskreter Impulse von Druckluft. 20,21 Dies sind in der Regel teurer ist als die Vorrichtung, die hier gekennzeichnet und erfordern eine Kalibrierung des Luftimpulses zu jedem Nadel, um eine konsistente Injektionsvolumina zu gewährleisten. Es gibt beträchtliche Debatte aber nur sehr wenig Daten darüber, wie Fliegen werden systemisch infizierten mit Bakterien in der Wildnis. Einige Forscher postulieren, daß die Mehrzahl der natürlichen Infektionen auftritt, wenn Drosophila einnehmen pathogene Bakterien und die Bakterien werden anschließend in der Lage, den Darm zu entkommen, um eine systemische Infektion zu etablieren. Es gibt jedoch sehr few Bakterien bekannt, dass in der Lage, den Darm von D. überqueren melanogaster, und diejenigen, die diese Fähigkeit zu tun sind sehr tödlich Fliegen 22,23. Eine alternative Theorie ist, dass regelmäßig fliegt aufrecht kutikulären Verletzungen durch Flucht aus dem gescheiterten Raubversuchen oder Angriffen durch ektoparasitären Milben. Diese Hypothese wird durch die häufige Sammlung von Wild D. unterstützt melanogaster Lager Melanisierung sichtbare Flecken weisen auf geheilten Wunden (unveröffentlichte Beobachtungen) sind. Milben wurde gezeigt, dass bakterielle Infektionen in Drosophila 24 übertragen und Wunden durch Milben links sekundär durch Bakterien bei der Honigbiene 25 infiziert werden. Die Häufigkeit in der Natur von milben angetrieben oder anderweitig opportunistische Infektion von D. melanogaster durch Kutikula Verletzungen ist nicht bekannt. Das hier beschriebene Protokoll ermöglicht Einführung der Bakterien direkt in die Hämolymphe durch quantitative Injektion, die keine Epithelbarrieren oder Verhaltens immu umgehtschaft. Verfahren zum Zuführen von pathogenen Bakterien zu D. melanogaster in Vodovar et al. 22 und Nehme et al. 23 beschrieben worden. Viele entomopathogenen Bakterien darstellen wenig oder gar keine Gefährdung der menschlichen Gesundheit, so dass die Forscher mit ihnen bequem arbeiten. Außerdem haben nur sehr wenige Bakterien die Fähigkeit, auf Drosophila Kontakt ohne experimentelle Intervention zu infizieren, so das Risiko einer &quot;Epidemie&quot; Ausbreitung der bakteriellen Infektion durch eine Labor über kontaminierte Flächen oder entkam Fliegen ist in der Regel sehr gering. Dennoch ist es ratsam, um sicherzustellen, dass angemessene Eindämmungsmaßnahmen vorhanden sind, um infizierte Fliegen Flucht zu verhindern und für die Rückeroberung jede entgangen Fliegen. Das Labor sollte in einem biologischen Sicherheitsniveau im Einklang mit, dass der Erreger verwendet ausgestattet werden, und Standard-Best Practices in der Mikrobiologie sollte eingesetzt werden. Die experimentelle infectihier beschriebene Verfahren ermöglicht Infektionen von Drosophila melanogaster mit jeder Dosis von jedem beliebigen Bakterium. Tretener Infektion festgestellt wurde, ist es einfach, die Kinetik der bakterielle Proliferation oder Luft mißt, die Wirts-Sterblichkeit zu verfolgen und die Induktion von dem Immunsystem des Wirts zu testen. Infizierten Fliegen können leicht auf andere phänotypischen Assays, einschließlich Tests der physiologischen Funktionen, die Form oder durch die Infektion förmigen, zu unterziehen. Die beschriebenen Verfahren sind kostengünstig, erfordern relativ wenig spezialisierte Ausrüstung, und sind leicht zu erlernen, so dass sie zugänglich für die Verwendung in verschiedenen Projekten in einer Breite von Forschung und Lehre Labors.

Die Fruchtfliege Drosophila melanogaster ist einer der führenden Modellorganismen zur Untersuchung der Funktion und Evolution der Immunabwehr. Drosophila sind billig und leicht nach hinten, sind sehr offen für experimentelle Manipulation und werden von einer umfangreichen wissenschaftlichen Gemeinschaft, die ein breites entwickelt hat, gesichert Reihe von Forschungswerkzeuge. Viele Aspekte der angeborenen Immunität zwischen Insekten und Säugetieren 1,2 konserviert, einschließlich Signaltransduktion von Toll-like Rezeptoren und NF-kB-Familie Transkriptionsfaktoren, JAK / STAT-Signalisierung und JNK-Weg vermittelten Reaktionen. Die Funktion dieser Gene und Signalwege können in D. abgefragt werden melanogaster mit Mutationen oder RNAi Niederschläge, Zunahme oder Abnahme Weg Aktivitäten. 3 - 6 Zusätzlich Drosophila kann verwendet werden, um die physiologischen Folgen der Infektion und Krankheit zu untersuchen, auch im Rahmen der Evolutionstheorie Lebensgeschichte werden 7.- 9. Allen diesen Untersuchungen ist jedoch abhängig von der Fähigkeit, zuverlässig zu infizieren Versuchslinie unter definierten Behandlungsbedingungen. Das hier beschriebene Verfahren stellt einen methodischen Rahmen für die Bereitstellung von robusten und wiederholbare bakterielle Infektionen zu Drosophila melanogaster und anschließend Messen Infektion Schwere und die Quantifizierung der Immunantwort des Wirts. Drosophila können natürlich und experimentell durch eine große Vielzahl von Parasiten und Krankheitserreger, wie Bakterien, Pilze, Viren, Nematoden und Parasitenwespen infiziert werden. Das aktuelle Protokoll wird auf die Bereitstellung von systemischen bakteriellen Infektion konzentriert. Viele verschiedene Bakterien verwendet werden, um Fliegen zu infizieren, und die Wahl des Experimentators sollte über die genauen wissenschaftlichen Fragen auf der Grundlage aufgefordert werden. Zum Beispiel können menschliche klinische Isolate verwendet, um bakterielle Virulenzmechanismen 10 zu untersuchen, oder ökologisch relevanten Isolate liebsten mit seind für evolutionäre Studie. 11 Einige Bakterien sind Krankheitserreger der zuständigen D. melanogaster, wuchernden bei Infektion und verursacht Host Krankheit oder Tod. Andere Bakterien werden effektiv durch das Immunsystem des Wirts verwaltet und innerhalb von wenigen Tagen vollständig. In dieser Demonstration werden Providencia rettgeri als proliferative Krankheitserreger, der Host Sterblichkeit verursachen und bleibt in lebenden Hosts. Escherichia coli wird als nicht-pathogen, die vom Immunsystem des Wirtes freigegeben wird, verwendet werden, verwendet werden. Infektion wird durch die Einführung von Bakterien direkt in die Körperhöhle des Fliegen hergestellt werden. Dieser Ansatz umgeht Epithelbarrieren und Schutzverhalten, so dass Untersuchung der systemischen Infektion unabhängig von der natürlichen Form der Übertragung. Es gibt grundsätzlich zwei Methoden zur Festlegung experimentell systemische Infektion. In der ersten, eine nanoinjector und zog Glaskapillare Nadeln verwendet werden, um eine genaue Anzahl von injizierenBakterien in der Fliege. Dieses Verfahren hat den Vorteil, dass sie einen großen dynamischen Bereich der Infektionsdosis und der quantitativ höchst reproduzierbar. Der zweite Ansatz ist, um eine Infektion mit einem septischen Nadelstich zu liefern. Dieser Ansatz hat den Vorteil, dass eine schnelle und keine spezielle Ausrüstung erforderlich ist. Sobald die Infektion festgestellt werden, wird es möglich, die systemische Belastung Erreger, Wirt Mortalität und induzierbare Aktivität des Immunsystems zu messen. Natürlich könnte eine beliebige Anzahl von zusätzlichen Phänotypen denkbar in infizierten D. mess melanogaster, auch nach der Infektion Fruchtbarkeit 12, Lernfähigkeit 13, 14 Stoffwechsellage oder praktisch jede andere Eigenschaft, die man sich vorstellen kann.

<table><tbody><tr><td>Incubator</td><td>Powers Scientific, Inc</td><td>DROS52SD</td><td></td></tr><tr><td>Paintbrush</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Flypads</td><td>FlyStuff</td><td>59-114</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt;</td><td>Airgas</td><td>CD FG50</td><td></td></tr><tr><td>Drosophila rearing mix&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>6 oz Square Bottom Bottles, polypropylene</td><td>Genesee Scientific</td><td>32-130</td><td></td></tr><tr><td>Nosterile Extra Large Cotton Balls</td><td>Fisher brand</td><td>22-456-882</td><td></td></tr><tr><td>Microscope</td><td>Olympus Corporation</td><td>SZ51</td><td></td></tr><tr><td>Drosophila Vials polystyrene</td><td>VWR international</td><td>89092-720</td><td></td></tr><tr><td>Nosterile Large Cotton Balls</td><td>Fisher brand</td><td>22-456-883</td><td></td></tr><tr><td>2 L flask</td><td>VWR international</td><td>89000-370</td><td></td></tr><tr><td>Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm;</td><td>VWR international</td><td>25384-302</td><td></td></tr><tr><td>LB Agar, Miller</td><td>Difco</td><td>244520</td><td></td></tr><tr><td>Innoculing Loop</td><td>VWR international</td><td>80094-488</td><td></td></tr><tr><td>Rainin Clasic Pipettes in various sizes&lt;br/&gt; 0.1 &amp;micro;l to 2 &amp;micro;l,&lt;br/&gt; 2 &amp;micro;l to 20 &amp;micro;l,&lt;br/&gt; 20 &amp;micro;l to 200 &amp;micro;l,&lt;br/&gt; 100 &amp;micro;l to 1,000 &amp;micro;l</td><td>Rainin</td><td>PR-2&lt;br/&gt; PR-20&lt;br/&gt; PR-200&lt;br/&gt; PR-1000</td><td></td></tr><tr><td>Micropipette tips (assorted sizes)</td><td>VWR international</td><td>30128-376&lt;br/&gt; 53503-810&lt;br/&gt; 16466-008</td><td></td></tr><tr><td>Luria Broth Base, Miller</td><td>Difco</td><td>241420</td><td></td></tr><tr><td>Disposable Culture Tubes Borosilicate Glass</td><td>VWR international</td><td>47729-576</td><td></td></tr><tr><td>S-500 Orbital Shaker</td><td>VWR international</td><td>14005-830</td><td></td></tr><tr><td>Centrifuge</td><td>VWR international</td><td>37001-300</td><td></td></tr><tr><td>PBS pH 7.4 10X</td><td>Invitrogen</td><td>70011044</td><td></td></tr><tr><td>SmartSpec 3000 Spectrophotometer</td><td>Bio-Rad</td><td>170-2501</td><td></td></tr><tr><td>Semimicrovolume Cuvettes</td><td>Bio-Rad</td><td>223-9955</td><td></td></tr><tr><td>Vertical Capillary Puller</td><td>Kopf Needle Pipette Puller</td><td></td><td></td></tr><tr><td>3.5&#039;&#039; Replacement glass Capillaries for Nanojet II</td><td>Drummond Sientific Company</td><td>3-000-203-G/X</td><td></td></tr><tr><td>Nanoject II</td><td>Drummond Sientific Company</td><td>3-000-204</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11255-20</td><td></td></tr><tr><td>10 ml Syringe</td><td>BD</td><td>309604</td><td></td></tr><tr><td>Mineral Oil, White, light</td><td>Macron Fine Chemicals</td><td>6358-10</td><td></td></tr><tr><td>Minutein pins</td><td>Fine Science Tools</td><td>26002-10</td><td></td></tr><tr><td>1.5 ml&amp;nbsp; Microcentrifuge tubes; Seal Rite</td><td>USA Scientific Inc.</td><td>1615-5500</td><td></td></tr><tr><td>Motorized Pestle; Talboys Laboratory Stirrer</td><td>Troemner</td><td>103</td><td></td></tr><tr><td>Talboys High Throughput Homogenizer</td><td>OPS Diagnostics</td><td>930145</td><td></td></tr><tr><td>5/32&#039;&#039; Grinding Balls</td><td>OPS Diagnostics</td><td>GBSS 156-5000-01</td><td></td></tr><tr><td>Vortex Genie</td><td>Scientific indurstries inc.</td><td>G560</td><td></td></tr><tr><td>Multichannel Pipettor (10 &amp;mu;l - 300 &amp;mu;l)</td><td>Sartorius</td><td>730360</td><td></td></tr><tr><td>WASP2 Whitley Automated Spiral Plater</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>ProtoCOL automated colony counter / plate counter/ plate reader&amp;nbsp;</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-026</td><td></td></tr><tr><td>qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td><td>Bio-Rad</td><td>TLS0801</td><td></td></tr><tr><td>qPCR caps; Optical Flat 8-Cap Strips</td><td>Bio-Rad</td><td>TCS0803</td><td></td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>m610a</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Promega</td><td>m170b</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1240</td><td></td></tr><tr><td>Oligo-dT</td><td>IDT</td><td></td><td></td></tr><tr><td>&amp;nbsp;SsoAdvanced SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5260</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>Bio-Rad</td><td>185-5200</td><td></td></tr><tr><td>RNasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2115</td><td></td></tr></tbody></table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

Die Fruchtfliege Drosophila melanogaster ist einer der führenden Modellorganismen zur Untersuchung der Funktion und Evolution der Immunabwehr. Viele Aspekte der angeborenen Immunität zwischen Insekten und Säugetieren konserviert, und da Drosophila leicht genetisch und experimentell manipuliert werden, stark für die Untersuchung der Funktion des Immunsystems und die physiologischen Folgen der Krankheit sind. Das hier gezeigte Verfahren ermöglicht Infektion von Fliegen durch die Einführung von Bakterien direkt in die Körperhöhle, unter Umgehung Epithelbarrieren und passive Formen der Verteidigung und damit Fokussierung auf systemische Infektion. Das Verfahren umfasst Protokolle für die Messrate der Wirts Mortalität, systemische Keimmenge und der Grad der Induktion von dem Immunsystem des Wirts. Diese Infektion Verfahren ist preiswert, robust und quantitativ reproduzierbar und kann in Studien der funktionellen Genetik, evolutionäre Lebensgeschichte und Physiologie verwendet werden.

Dieser Teil zeigt Ergebnisse, die nach der bakteriellen Infektion von Drosophila melanogaster, erhalten werden kann. Figur 1 zeigt, dass die Infektionsdosis variiert mit der optischen Dichte der bakteriellen Suspension zur Injektion verwendet werden, und dass das gelieferte zuverlässig durch Homogenisieren und Plattieren abschätzen Dosis fliegt unmittelbar nach der Injektion . Wie in Figur 2 dargestellt ist, kann verschiedene Erreger verschiedenen Ebenen der Host Mortalität (2A) und Host-Sterblichkeit führen kann dosisabhängig (2B) ist. Wichtig ist, ermöglicht dieses Protokoll für verschiedene Typen von Infektionen erreicht werden: Providencia rettgeri kann eine chronische subletaler Infektion, für 20 Tage oder länger (3A) besteht verursachen. Aber auch andere Bakterien wie Escerichia coli wird meist durch den Host-fly innerhalb von sechs Stunden nach der Infektion (3B) gelöscht werden. Induktion der Immun system kann durch RNA-Isolierung und anschließende qRT-PCR von antibakteriellen Peptid-Transkripte (4A und B) geschätzt werden. Analog, jedoch weniger quantitativ, Fliegen, die GFP unter der Kontrolle des antimikrobiellen Peptids Genpromotoren verwendet werden, um die Induktion des Immunsystems (4C) zu visualisieren. <img alt="Abbildung 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Abbildung 1: Bestimmung Infektionsdosis Fliegen wurden mit 50 nl von Bakteriensuspensionen, die einen Bereich von optischen Dichten (0,0001 bis 0,05) injiziert. Die Fliegen wurden sofort homogenisiert und ausplattiert, um die Zahl der Bakterien durch die Injektion eingeführt zu bestimmen. Initial bakterielle Belastung korreliert stark mit Anfangs-OD injiziert (r 2 = 0,96) <img alt="Figur 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Abbildung 2:. Überleben nach der Injektion mit bakterieller Pathogene Fünf bis sieben Tage alte Männer wurden mit 50 nl entweder bakteriellen Suspension oder sterile Medien eingespritzt und für das Überleben überwacht. (A) Wildtyp-Fliegen wurden mit etwa 5.000 Bakterien aus einer von drei verschiedenen Spezies injiziert. Die Rate des Host Mortalität hängt stark von den für die Infektion verwendeten Bakterienspezies. 50, 500 und 5.000 Bakterien pro fly - (B) Wildtyp-Fliegen wurden mit drei verschiedenen Dosen von Enterococcous faecalis injiziert. Fliegen sterben schneller, wenn mit höheren infektiösen Dosen (C) infiziert Ein Immunsystem Mutanten und ihre Wildtyp-isogenen Steuerleitung wurden mit etwa 500 Burkholderia cepacia injiziert. Eine paarweise Log-Rank-Vergleich zeigt, dass die Wildtyp-fly die Infektion deutlich besser als der Mutante (χ 2 = 59.02, df = 1, p &lt;0,0001) überlebt. Abb. 3: bakterielle Belastung nach der Injektion Fliegen wurden mit etwa (A) 5000 P. injiziert rettgeri (B) 3400 E. coli. Bakterielle Belastung wurde unmittelbar nach der Injektion und bei verschiedenen nachfolgenden Zeitpunkte bestimmt. Jeder Datenpunkt stellt die bakterielle Belastung einer einzigen Fliege. E. coli schnell von Hosts in Frage gestellt, während P. gelöscht rettgeri bleibt für den Rest des Hosts Leben ,. <img alt="Figur 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Abbildung 4: Induktion von Immun Gene Expression nach der Injektion. (A) Die Fliegen wurden mit 50 nl injiziert P. rettgeri oder sterilem PBS entweder in den Bauch oder Brustkorb, oder wurden aus CO links unmanipulated beiseite <sub&gt; 2 Anästhesie. Sechs Stunden nach der Infektion wurden die Fliegen für die RNA-Isolierung und Expression des Diptericin Ein Gen wurde mit qRT-PCR bestimmt gesammelt. (A) Expressionsniveaus werden als das Verhältnis der Diptericin graphisch dargestellt, um ein Transkript rp49 Transkript und skaliert, dass die CO 2 Steuerung als eine Expressionsniveau 1. Die Balken stellen den Mittelwert und Standardfehler von Verhältnissen von jeder Bedingung definiert (n = 4). (B) Die Expressionsniveaus werden als 2 ΔΔCT mit der durchschnittlichen C T-Wert von CO 2 aesthesia Kontrollfliegen als Standard nicht-induzierten Zustand gebraucht grafisch dargestellt. Die Balken stellen den Mittelwert und Standardfehler der ΔΔC T von jedem Zustand (n = 4). Zwar gibt es keinen Unterschied in der Niederschrift Induktion aufgrund der Injektionsstelle, Vergleich der Platten A und B zeigt, wie die ΔΔC T Methode kann potenziell zu überschätzen Induktionsniveaus. (C) Fliegt, die GFP unter der Kontrolle des Promotors Diptericin A wurden mit 50 nl injiziert P. rettgeri (OD = 0,1) und dann abgebildet wird 7 Tage später. Die GFP-Panel zeigt die Expression von GFP in der Bauchfettkörper der infizierten Fliegen, was die Aktivierung des Diptericin Ein Promotor in bakteriell infizierten Fliegen, aber nicht medien injizierten Kontrollen. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gen </td><td> Vorwärts </td><td> Rückwärts </td></tr><tr><td> rp49 (auch genannt rpL32) </td><td> 5&#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5&#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5&#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5&#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5&#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5&#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5&#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5&#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5&#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5&#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5&#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabelle 1: Primer für qRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Systemische bakterielle Infektion und Immunabwehr Phänotypen in<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K Aufrufe.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Serie: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Eine Einführung in die parasitischen Wespen<em&gt; Drosophila</em&gt; Und die antiparasitäre Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Forschung

Immunologie und Infektion

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

Aufzucht der Fruit Fly<em&gt; Drosophila melanogaster</em&gt; Unter Axenic und gnotobiotische Bedingungen

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Entwicklungsbiologie

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Quantitative Messung der Immunantwort und Sleep in<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extraktion von Hemocytes aus Drosophila Melanogaster Larven für mikrobielle Infektionen und Analyse

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Gründung der Virusinfektion und Analyse von Host-Virus-Wechselwirkung in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

Beurteilung der zellulären Immunantwort der Fruchtfliege Drosophila Melanogaster, mit einem In-Vivo-Phagozytose-Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

Drosophila melanogaster Larven-Injektionsprotokoll

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

Mündliche bakterielle Infektion und Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biologie

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

Beurteilung der altersspezifischen phagozytischen Fähigkeit von adulten Drosophila melanogaster Hämozyten mit einem In Vivo Phagozytose-Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Infecting Flies with Bacterial Suspension Using a Nanoinjector

Source: Khalil, S. et al., <a href="https://app.jove.com/v/52613">Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.</a>&#160;J. Vis. Exp.&#160; (2015)
This video demonstrates the nano-injection of bacterial suspension into the fly body cavity, resulting in bacterial multiplication and infection. The fly&#39;s immune response clears some bacteria, while others escape immune clearance and survive within the host causing an infection.

Infizieren von Fliegen mit Bakteriensuspension unter Verwendung eines Nanoinjektors

Source: Khalil, S. et al., Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.&#160;J. Vis. Exp.&#160; (2015)
This ...

Systemische bakterielle Infektion und Immunabwehr Phänotypen in

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Eine Einführung in die parasitischen Wespen

Aufzucht der Fruit Fly

Quantitative Messung der Immunantwort und Sleep in