Name: systemic bacterial infection and immune defense phenotypes in drosophila melanogaster
Uploaded: 2015-05-13T13:00:00.000+00:00
Duration: 10 min 12 s
Description: Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

La procedura qui descritta produce infezione qualità rigoroso e alto di Drosophila melanogaster. Gli esempi illustrati concentrati principalmente sulla infezione da Providencia rettgeri ed E. coli, ma il protocollo è altamente adattabile e può essere applicato alle infezioni con diversi batteri su una gamma di condizioni di allevamento host e manutenzione. I dettagli di un approccio sperimentale ottimale dipenderà batterio utilizzato per l&#39;infezione, il genotipo dell&#39;ospite, e le condizioni sperimentali generali. E &#39;fortemente raccomandato di test pilota eventuali nuove condizioni sperimentali prima di avviare i progetti più ambiziosi. Un buon punto di partenza è quello di testare tre dosi di infezione in un range di 100 volte. Altamente patogeni virulenti sono spesso meglio introdotti a dosi infettive molto bassi, dell&#39;ordine di 10 - 100 cellule batteriche per mosca. Gli agenti patogeni più moderati possono essere iniettati in dosi più elevate di circa 1.000 batteri per fly, e non gli agenti patogeni possono essere iniettati in dosi fino a 10.000 batteri per volare. Spesso è istruttivo definire le cinetiche di infezioni nuovi tracciando carico patogeno, la mortalità host e l&#39;attività del sistema immunitario su una serie temporale longitudinale. Poiché la misura del carico patogeno e l&#39;espressione genica ospitante sono prove distruttive, è necessario per infettare le mosche distinti fin dall&#39;inizio dell&#39;esperimento per ogni punto di tempo che deve essere misurato. Al momento di decidere se utilizzare puntura di spillo o iniezione a base microcapillare-, è importante notare che ci sono vantaggi e limitazioni di ogni approccio. Iniezione capillare presenta un volume di liquido nella mosca, che sia modestamente aumenta la pressione turgore e introduce sali o altre molecole che sono sospesi o disciolti nel veicolo. Iniezione capillare richiede anche l&#39;accesso ad un impianto di iniezione o l&#39;acquisto delle attrezzature necessarie. Pinprick Septic non richiede attrezzature speciali e introducesupporti trascurabili nel volo, ed è in genere più efficace per infettare un gran numero di mosche. Tuttavia, le infezioni puntura di spillo non consentono il controllo preciso dosaggio infezione che può essere raggiunto con iniezione capillare. Il presente protocollo focalizzata su un apparato di iniezione che regola meccanicamente volume di iniezione, ma ci sono anche sistemi di iniezione a base di impulsi discreti di aria pressurizzata. 20,21 Questi sono in genere più costosi dei apparecchiatura descritta qui e richiedono la calibrazione dell&#39;impulso aria per ciascun aghi per garantire volumi di iniezione coerenti. Vi è un ampio dibattito, ma pochissimi dati su come le mosche diventano sistemica infettati con i batteri in natura. Alcuni ricercatori ipotizzano che la maggior parte delle infezioni naturali si verificano quando Drosophila ingerire batteri patogeni e batteri sono successivamente in grado di sfuggire l&#39;intestino per stabilire una infezione sistemica. Tuttavia, ci sono molto few batteri noti per essere in grado di attraversare l&#39;intestino di D. melanogaster, e quelli che hanno questa capacità sono altamente letale per le mosche 22,23. Una teoria alternativa è che vola regolarmente subire lesioni cuticolari attraverso fuga dai tentativi di predazione falliti o attacco di acari ectoparassiti. Questa ipotesi è supportata dalla raccolta frequente di selvaggio D. melanogaster recanti macchie melanizzazione che sono indicativi delle ferite guarite (osservazioni non pubblicate). Gli acari sono stati indicati per la trasmissione di infezioni batteriche in Drosophila 24 e le ferite lasciate da acari possono essere secondariamente infettato da batteri nelle api 25. Tuttavia, la frequenza naturale di infezione acari-driven o altrimenti opportunistica di D. melanogaster attraverso violazioni cuticola non è noto. Il protocollo qui descritto consente l&#39;introduzione di batteri direttamente nella emolinfa attraverso l&#39;iniezione quantitativa che bypassa le barriere epiteliali o Immu comportamentalicomunitario. Metodi per alimentare i batteri patogeni a D. melanogaster sono stati descritti in Vodovar et al. 22 e Nehme et al. 23. Molti batteri entomopatogeni rappresentano poco o nessun rischio per la salute umana, consentendo ai ricercatori di lavorare con loro in modo confortevole. Inoltre, molto pochi i batteri hanno la capacità di infettare Drosophila in contatto senza intervento sperimentale, per cui il rischio di diffusione &quot;epidemica&quot; di infezione batterica attraverso un laboratorio di via superfici contaminate o fuggiti mosche è generalmente molto basso. Tuttavia, è opportuno garantire che adeguate misure di contenimento sono in atto per evitare che le mosche infette di fuggire e per riconquistare qualsiasi mosche sfuggito. Il laboratorio deve essere attrezzato ad un livello di sicurezza biologica commisurata a quella dei patogeni in uso, e migliori pratiche standard in microbiologia deve essere impiegato. Il infecti sperimentaleil metodo qui descritto permette di infezioni di Drosophila melanogaster, con qualsiasi dosaggio di qualsiasi batterio arbitrario. Una volta che l&#39;infezione è stata stabilita, è semplice per misurare la cinetica di proliferazione batterica o di liquidazione, per monitorare la mortalità di accoglienza, e di saggiare l&#39;induzione del sistema immunitario dell&#39;ospite. Mosche infetti possono essere facilmente sottoposti ad altri test fenotipici, compresi i test di funzioni fisiologiche che possono modellare o essere modellati dal infezione. Le procedure descritte sono poco costosi, richiedono relativamente poco attrezzature specializzate, e sono facilmente apprese, che li rende suscettibili per l&#39;utilizzo in diversi progetti attraverso una larghezza di laboratori di ricerca e di insegnamento.

La mosca della frutta Drosophila melanogaster è uno degli organismi modello premier per lo studio della funzione e l&#39;evoluzione di difesa immunitaria. Drosophila sono poco costosi e facili da dietro, sono altamente suscettibili di manipolazione sperimentale, e sono supportato da una vasta comunità scientifica che si è sviluppato un ampio serie di strumenti di ricerca. Molti aspetti dell&#39;immunità innata sono conservate tra insetti e mammiferi, tra cui trasduzione del segnale mediata da recettori Toll-like e NF-kB fattori di trascrizione della famiglia, di segnalazione JAK / STAT, e le risposte via di JNK. 1,2 La funzione di questi geni e vie can essere interrogato in D. melanogaster con mutazioni o RNAi abbattimenti che le attività di aumentare o diminuire pathway. 3 - 6 Inoltre, Drosophila può essere usato per studiare le conseguenze fisiologiche della infezione e la malattia, anche nel contesto della teoria evoluzionistica storia di vita 7.- 9 Tutti questi studi, tuttavia, dipendono dalla capacità di infettare in modo affidabile le mosche sperimentali in condizioni di trattamento definite. La procedura qui descritta presenta un quadro metodologico per la consegna di infezioni batteriche resistenti e ripetibili di Drosophila melanogaster e successivamente misurare infezione gravità e quantificare la risposta immunitaria. Drosophila può essere naturalmente e sperimentalmente infettato da una grande varietà di parassiti e patogeni, tra cui batteri, funghi, virus, nematodi e vespe parassitoidi. Il protocollo attuale è focalizzata sulla fornitura di un&#39;infezione batterica sistemica. Molti batteri differenti possono essere utilizzati per infettare le mosche, e la scelta dello sperimentatore dovrebbero essere basati sulle precise questioni scientifiche essere chiesto. Ad esempio, isolati clinici umani possono essere impiegati per studiare i meccanismi di virulenza batterica 10, o ecologicamente pertinenti isolati possono essere preferite lad per lo studio evolutivo. 11 Alcuni batteri sono patogeni competenti di D. melanogaster, proliferando su infezioni e che causa la malattia di accoglienza o la morte. Altri batteri sono effettivamente gestiti dal sistema immunitario ospite e cancellati entro pochi giorni. In questa dimostrazione, Providencia rettgeri sarà utilizzato come un agente patogeno proliferativa che può causare la mortalità ospitante e persiste in hosts sopravvissuti. Escherichia coli viene utilizzata come non patogeno che viene eliminato dal sistema immunitario dell&#39;ospite. Infezione sarà stabilito dalla introduzione di batteri direttamente nella cavità del corpo della mosca. Questo approccio bypassa barriere epiteliali e comportamenti protettivi, consentendo indagini di infezione sistemica indipendentemente dal modo naturale della trasmissione. Ci sono due metodi principali per stabilire sperimentalmente infezione sistemica. Nel primo, un nanoinjector e capillare di vetro tirato aghi sono usati per iniettare un numero preciso dibatteri nel volo. Questo metodo ha il vantaggio di consentire una vasta gamma dinamica di dosi infettive e di essere quantitativamente altamente ripetibili. Il secondo approccio è quello di fornire l&#39;infezione con una puntura di spillo settico. Questo approccio ha il vantaggio di essere rapida e non richiede attrezzature speciali. Una volta che le infezioni sono stabiliti, diventa possibile misurare il carico sistemico patogeno, la mortalità host e l&#39;attività inducibile sistema immunitario. Naturalmente, qualsiasi numero di fenotipi supplementari potrebbe concepibilmente essere misurata in infetto D. melanogaster, anche post-infezione fecondità 12, la capacità di apprendimento 13, stato metabolico 14, o per qualsiasi altra caratteristica che si possa immaginare.

<table><tbody><tr><td>Incubator</td><td>Powers Scientific, Inc</td><td>DROS52SD</td><td></td></tr><tr><td>Paintbrush</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Flypads</td><td>FlyStuff</td><td>59-114</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt;</td><td>Airgas</td><td>CD FG50</td><td></td></tr><tr><td>Drosophila rearing mix&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>6 oz Square Bottom Bottles, polypropylene</td><td>Genesee Scientific</td><td>32-130</td><td></td></tr><tr><td>Nosterile Extra Large Cotton Balls</td><td>Fisher brand</td><td>22-456-882</td><td></td></tr><tr><td>Microscope</td><td>Olympus Corporation</td><td>SZ51</td><td></td></tr><tr><td>Drosophila Vials polystyrene</td><td>VWR international</td><td>89092-720</td><td></td></tr><tr><td>Nosterile Large Cotton Balls</td><td>Fisher brand</td><td>22-456-883</td><td></td></tr><tr><td>2 L flask</td><td>VWR international</td><td>89000-370</td><td></td></tr><tr><td>Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm;</td><td>VWR international</td><td>25384-302</td><td></td></tr><tr><td>LB Agar, Miller</td><td>Difco</td><td>244520</td><td></td></tr><tr><td>Innoculing Loop</td><td>VWR international</td><td>80094-488</td><td></td></tr><tr><td>Rainin Clasic Pipettes in various sizes&lt;br/&gt; 0.1 &amp;micro;l to 2 &amp;micro;l,&lt;br/&gt; 2 &amp;micro;l to 20 &amp;micro;l,&lt;br/&gt; 20 &amp;micro;l to 200 &amp;micro;l,&lt;br/&gt; 100 &amp;micro;l to 1,000 &amp;micro;l</td><td>Rainin</td><td>PR-2&lt;br/&gt; PR-20&lt;br/&gt; PR-200&lt;br/&gt; PR-1000</td><td></td></tr><tr><td>Micropipette tips (assorted sizes)</td><td>VWR international</td><td>30128-376&lt;br/&gt; 53503-810&lt;br/&gt; 16466-008</td><td></td></tr><tr><td>Luria Broth Base, Miller</td><td>Difco</td><td>241420</td><td></td></tr><tr><td>Disposable Culture Tubes Borosilicate Glass</td><td>VWR international</td><td>47729-576</td><td></td></tr><tr><td>S-500 Orbital Shaker</td><td>VWR international</td><td>14005-830</td><td></td></tr><tr><td>Centrifuge</td><td>VWR international</td><td>37001-300</td><td></td></tr><tr><td>PBS pH 7.4 10X</td><td>Invitrogen</td><td>70011044</td><td></td></tr><tr><td>SmartSpec 3000 Spectrophotometer</td><td>Bio-Rad</td><td>170-2501</td><td></td></tr><tr><td>Semimicrovolume Cuvettes</td><td>Bio-Rad</td><td>223-9955</td><td></td></tr><tr><td>Vertical Capillary Puller</td><td>Kopf Needle Pipette Puller</td><td></td><td></td></tr><tr><td>3.5&#039;&#039; Replacement glass Capillaries for Nanojet II</td><td>Drummond Sientific Company</td><td>3-000-203-G/X</td><td></td></tr><tr><td>Nanoject II</td><td>Drummond Sientific Company</td><td>3-000-204</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11255-20</td><td></td></tr><tr><td>10 ml Syringe</td><td>BD</td><td>309604</td><td></td></tr><tr><td>Mineral Oil, White, light</td><td>Macron Fine Chemicals</td><td>6358-10</td><td></td></tr><tr><td>Minutein pins</td><td>Fine Science Tools</td><td>26002-10</td><td></td></tr><tr><td>1.5 ml&amp;nbsp; Microcentrifuge tubes; Seal Rite</td><td>USA Scientific Inc.</td><td>1615-5500</td><td></td></tr><tr><td>Motorized Pestle; Talboys Laboratory Stirrer</td><td>Troemner</td><td>103</td><td></td></tr><tr><td>Talboys High Throughput Homogenizer</td><td>OPS Diagnostics</td><td>930145</td><td></td></tr><tr><td>5/32&#039;&#039; Grinding Balls</td><td>OPS Diagnostics</td><td>GBSS 156-5000-01</td><td></td></tr><tr><td>Vortex Genie</td><td>Scientific indurstries inc.</td><td>G560</td><td></td></tr><tr><td>Multichannel Pipettor (10 &amp;mu;l - 300 &amp;mu;l)</td><td>Sartorius</td><td>730360</td><td></td></tr><tr><td>WASP2 Whitley Automated Spiral Plater</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>ProtoCOL automated colony counter / plate counter/ plate reader&amp;nbsp;</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-026</td><td></td></tr><tr><td>qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td><td>Bio-Rad</td><td>TLS0801</td><td></td></tr><tr><td>qPCR caps; Optical Flat 8-Cap Strips</td><td>Bio-Rad</td><td>TCS0803</td><td></td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>m610a</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Promega</td><td>m170b</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1240</td><td></td></tr><tr><td>Oligo-dT</td><td>IDT</td><td></td><td></td></tr><tr><td>&amp;nbsp;SsoAdvanced SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5260</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>Bio-Rad</td><td>185-5200</td><td></td></tr><tr><td>RNasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2115</td><td></td></tr></tbody></table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

La mosca della frutta Drosophila melanogaster è uno degli organismi modello premier per lo studio della funzione e l&#39;evoluzione di difesa immunitaria. Molti aspetti dell&#39;immunità innata sono conservate tra insetti e mammiferi, e dato che Drosophila può essere facilmente manipolato geneticamente e sperimentalmente, sono potenti per studiare la funzione del sistema immunitario e le conseguenze fisiologiche della malattia. La procedura permette dimostrato qui infezione di mosche dall&#39;introduzione di batteri direttamente nella cavità del corpo, bypassando barriere epiteliali e forme più passivi di difesa e consentendo attenzione alla infezione sistemica. Il procedimento comprende i protocolli per i tassi di mortalità misurazione ospitante, carico patogeno sistemica, e il grado di induzione del sistema immunitario dell&#39;ospite. Questa procedura infezione è poco costoso, robusto e quantitativamente ripetibile, e può essere usato in studi di genetica funzionale, storia di vita evolutiva e fisiologia.

Questa sezione illustra i risultati ottenibili dopo l&#39;infezione batterica di Drosophila melanogaster. La Figura 1 mostra quella dose infezione varia con la densità ottica della sospensione batterica utilizzato per l&#39;iniezione, e che la dose erogata può essere attendibilmente stimato omogeneizzazione e placcatura vola immediatamente dopo l&#39;iniezione . Come illustrato in figura 2, diversi agenti patogeni possono causare diversi livelli di mortalità host (figura 2A) e mortalità ospitante può essere dose-dipendente (Figura 2B). È importante sottolineare che questo protocollo consente diversi tipi di infezioni da raggiungere: Providencia rettgeri può causare un&#39;infezione cronica, subletale che persiste per 20 giorni o più (Figura 3A). Tuttavia, altri batteri come Escerichia coli saranno per lo più cancellati dalla mosca ospitante entro sei ore dopo l&#39;infezione (Figura 3B). Induzione di sys immunitarioTEM può essere stimata attraverso l&#39;isolamento di RNA e la successiva qRT-PCR dei trascritti peptidi antibatterici (Figura 4A e B). Analogamente ma meno quantitativamente, mosche esprimendo GFP sotto il controllo del peptide antimicrobico promotori genici può essere utilizzato per visualizzare l&#39;induzione del sistema immunitario (Figura 4C). <img alt="Figura 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Figura 1: Determinazione Infectious Dose mosche sono stati iniettati con 50 nl di sospensioni batteriche che coprono una gamma di densità ottiche (,0001-,05). Le mosche erano immediatamente omogeneizzati e piastrate per determinare il numero di batteri introdotto dalla iniezione. Carica batterica iniziale è strettamente correlato con OD iniziale iniettato (r 2 = 0,96) <img alt="Figura 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Figura 2:. La sopravvivenza dopo iniezione con batteri patogeni cinque a sette maschi vecchi giorni sono stati iniettati con 50 nl di una sospensione di batteri o supporti sterili e monitorato per la sopravvivenza. (A) mosche wild type sono stati iniettati con circa 5.000 batteri di una delle tre specie diverse. Il tasso di mortalità di accoglienza dipende in larga misura dalla specie batterica usati per l&#39;infezione. (B) mosche wild type sono stati iniettati con tre diverse dosi di Enterococcous faecalis - 50, 500 e 5.000 batteri per volare. Le mosche muoiono più rapidamente quando infettati con dosi superiori infettive (C) Un mutante del sistema immunitario e la sua wild-type linea di controllo isogenico sono stati iniettati con circa 500 Burkholderia cepacia. Un confronto Log-Rank coppie dimostra che la wild-type fly sopravvive l&#39;infezione significativamente migliore rispetto al mutante (χ 2 = 59,02, df = 1, p &lt;0,0001). Figura 3:. Carica batterica dopo iniezione mosche sono state iniettate con circa il (A) 5000 P. rettgeri (B) 3.400 E. coli. Carica batterica è stata determinata immediatamente dopo l&#39;iniezione e in vari punti temporali successivi. Ciascun punto di dati rappresenta la carica batterica di una mosca. E. coli è rapidamente eliminato da host sfidato mentre P. rettgeri persiste per il resto della vita dell&#39;ospite ,. <img alt="Figura 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Figura 4: Induzione immunitario genica dopo l&#39;iniezione. (A) Le mosche sono stati iniettati con 50 nl di P. rettgeri o PBS sterile sia nel torace, o sono stati lasciati non manipolata a parte CO <sub&gt; 2 anestesia. Sei ore dopo l&#39;infezione, le mosche sono stati raccolti per l&#39;isolamento di RNA e espressione del Diptericin Un gene è stato determinato utilizzando qRT-PCR. (A) I livelli di espressione sono rappresentati graficamente come rapporto tra Diptericin Una trascrizione di rp49 trascrizione e scalato in modo tale che il controllo CO 2 è definito come aventi un livello di espressione di 1. Le barre rappresentano la media e l&#39;errore standard di rapporti da ciascuna condizione (n = 4). Livelli (B) di espressione vengono rappresentati graficamente come ΔΔCT 2 con il valore medio C T da CO 2 aesthesia linea di controllo utilizzati come condizione uninduced standard. Le barre rappresentano l&#39;errore medio e standard ΔΔC T da ciascuna condizione (n = 4). Mentre non vi è alcuna differenza di induzione trascrizione causa al sito di iniezione, il confronto di pannelli A e B mostra come il metodo ΔΔC T può potenzialmente sovrastimare i livelli di induzione. (C) Vola esprimono GFP sotto il controllo del Diptericin Un promotore sono stati iniettati con 50 nl di P. rettgeri (OD = 0,1) e poi ripreso sette giorni più tardi. Il pannello GFP mostra l&#39;espressione di GFP nel corpo grasso addominale di mosche infette, indicando l&#39;attivazione della Diptericin Un promotore in linea con infezione da batteri, ma non controlli multimediali a iniezione. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gene </td><td> Avanti </td><td> Reverse </td></tr><tr><td> rp49 (chiamato anche rpL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> Diptericin A </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensin </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> Attacin A </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabella 1: Primer per qRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Sistemica infezione batterica e immunitario Difesa fenotipi in<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K Views.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Video: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

An Introduction to vespe parassite di<em&gt; Drosophila</em&gt; E la risposta immunitaria antiparassitari

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Ricerca

Immunologia e infezioni

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

Allevamento la mosca della frutta<em&gt; Drosophila melanogaster</em&gt; Sotto axeniche e Gnotobiotic Condizioni

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Biologia dello sviluppo

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Misurazione quantitativa della risposta immunitaria e nel sonno<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Estrazione di emociti da larve di Drosophila melanogaster per infezione microbica e l'analisi

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Istituzione dell'infezione virale e analisi dell'interazione ospite-Virus in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

Valutare la risposta immunitaria cellulare del moscerino della frutta, Drosophila melanogaster, utilizzando un test di fagocitosi In Vivo

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

Drosophila melanogaster Protocollo di iniezione della larva

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

Infezione batterica orale e spargimento in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biologia

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

Valutare la capacità fagocitica specifica per età degli emociti di Drosophila melanogaster adulto utilizzando un in vivo Phagocitosis

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Infecting Flies with Bacterial Suspension Using a Nanoinjector

Source: Khalil, S. et al., <a href="https://app.jove.com/v/52613">Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.</a>&#160;J. Vis. Exp.&#160; (2015)
This video demonstrates the nano-injection of bacterial suspension into the fly body cavity, resulting in bacterial multiplication and infection. The fly&#39;s immune response clears some bacteria, while others escape immune clearance and survive within the host causing an infection.

Infettare le mosche con una sospensione batterica utilizzando un nanoiniettore

Source: Khalil, S. et al., Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.&#160;J. Vis. Exp.&#160; (2015)
This ...

Sistemica infezione batterica e immunitario Difesa fenotipi in

Riepilogo

Esplora Altri Video

Capitoli in questo video

An Introduction to vespe parassite di

Allevamento la mosca della frutta

Misurazione quantitativa della risposta immunitaria e nel sonno