We greatly appreciate the valuable advice provided by Prof. J.P. van Pijkeren (University of Wisconsin-Madison), whose guidance on working with L. reuteri ATCC PTA 6475 provided a foundation for the methods described here.

1. Preparing L. reuteri DSM20016 electrocompetent cells
NOTE: This is based on a protocol by Berthier et al.17, with centrifugation speeds informed by Rattanachaikunsopon et al.18.
<ol>
	<li>In a 50 mL centrifuge tube, inoculate L. reuteri from glycerol stock into 6 mL of deMan Rogosa Sharpe (MRS) broth. Incubate aerobically overnight at 37 &#176;C in a static incubator.</li>
	<li>The next morning, inoculate 4 mL of the overnight culture into 200 mL of MRS broth (1:50 dilution).</li>
	<li>Allow to grow aerobically in a static 37 &#176;C incubator until the 600 nm optical density value (OD600) reaches 0.5-0.85; this should take roughly 2-3 h.</li>
	<li>As soon as an adequate OD600 value is reached, decant the media into 50 mL centrifuge tubes and place on ice while balancing the tubes.</li>
	<li>Centrifuge for 5 min at 5,000 x g in a pre-chilled, 4 &#176;C centrifuge.</li>
	<li>Discard the supernatant, resuspend each pellet in 50 mL of pre-chilled (0 &#176;C to 4 &#176;C) ddH2O, and centrifuge again with the same settings as the previous step. Keep the cells on ice as much as possible.</li>
	<li>Repeat step 1.6.</li>
	<li>Resuspend each pellet in 25 mL of ddH2O: 0.5 M sucrose, 10% glycerol. Centrifuge at 5,000 x g at 4 &#176;C for 10 min. Discard the supernatant and put the cells back on ice.</li>
	<li>Resuspend all the pellets in the same 2 mL of ddH2O: 0.5 M sucrose, 10% glycerol.</li>
	<li>Aliquot into 50 &#181;L to 100 &#181;L portions in pre-chilled microcentrifuge tubes; store at -80 &#176;C for later use.</li>
</ol>
2. Electroporation of L. reuteri 
NOTE: Avoid pipetting as much as possible in the following steps. Inclusion of a control electroporation, with no plasmid added, is advised to ensure the antibiotic selection is adequate.
<ol>
	<li>Take an entire electrocompetent L. reuteri aliquot and thaw it on ice.</li>
	<li>Gently mix 5 &#181;L to 10 &#181;L of plasmid (final plasmid concentration &#62;6 nM) into the thawed aliquot, avoiding pipetting as much as possible.</li>
	<li>Transfer to an ice-chilled, 1 mm gap electroporation cuvette.</li>
	<li>Electroporate at 1.25 kV, 400 &#8486;, and 25 &#181;F.</li>
	<li>Add 1 mL of room temperature (RT) MRS broth and mix by inverting the cuvette once or twice.</li>
	<li>Place the cuvettes into a static incubator at 37 &#176;C for 2.5-3 h to allow for recovery.</li>
	<li>Plate the entire amount onto multiple MRS agar plates with appropriate selection.</li>
	<li>Place the plates inside a completely airtight container with a small lit candle (&#34;tealight&#34;) and an anaerobic atmosphere-generating sachet.</li>
	<li>Grow at 37 &#176;C for 2-3 days or until visible colonies are present.</li>
</ol>
3. Measurement of the acid-resistant fluorescent reporter protein mCherry2
<ol>
	<li>Pick any colonies required for measurement and inoculate into a 96-well storage microplate with 1.5 mL of filter sterilized (non-autoclaved) MRS broth per well and an appropriate selection antibiotic.</li>
	<li>Incubate aerobically for 24 h overnight at 37 &#176;C without shaking. 
	NOTE: This storage microplate should be kept for use in section 4 (colony PCR).</li>
	<li>L. reuteri will precipitate out of the media when in the stationary phase; resuspend the overnight culture via pipetting.</li>
	<li>Transfer 200 &#181;L into a flat, clear-bottom, 96-well plate, transfer the plate to a plate reader, and measure the OD and fluorescence of mCherry2 (excitation [Ex]: 589 nm; emission [Em]: 610 nm) or other relevant reporters.</li>
</ol>
4. Confirmation of plasmid uptake via colony PCR
<ol>
	<li>From the 96-well storage microplate from section 3, transfer 5 &#181;L to a PCR tube. 
	NOTE: If &#62;5 min have passed, it may be necessary to resuspend the L. reuteri a second time.</li>
	<li>In a portable benchtop microcentrifuge, spin down until the pellet can be seen (roughly 2 min at 2,000 x g), discard the supernatant, and resuspend the pellet in 20 &#181;L of 20 mM NaOH.</li>
	<li>Boil at 95 &#176;C for 5 min, vortex, and repeat the boil a second time.</li>
	<li>Immediately chill the samples; try to keep the samples on ice as much as possible in the following steps to lower the likelihood of template degradation and PCR inhibition.</li>
	<li>Spin down in a portable benchtop microcentrifuge at 2,000 x g for 2 min until the cell debris is pelleted, then take 1 &#181;L of the supernatant and dilute into 99 &#181;L of ice-cold DNase- and RNase-free ddH2O (100x dilution).</li>
	<li>Use the 100x dilution as the template DNA in a standard PCR reaction using plasmid-specific primers. Include a positive control with a plasmid derived from the E. coli mini-prep.</li>
	<li>Return the samples on ice and add an appropriate loading dye at a 1x concentration.</li>
	<li>Run in 1% agarose gel in TAE buffer (tris-acetate-ethylenediaminetetraacetic acid [EDTA]) at 110 V for 30 min. Image if necessary.</li>
</ol>
5. Mini-prep protocol for L. reuteri , followed by PCR to confirm plasmid presence
NOTE: Protocol intended for use with the mini-prep kit listed in the Table of Materials.
<ol>
	<li>Inoculate L. reuteri into 10 mL of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 &#176;C in a static incubator.</li>
	<li>Centrifuge at 5,000 x g for 10 min in a pre-chilled 4 &#176;C centrifuge.</li>
	<li>Wash the pellet in 2 mL of standard P1 buffer (included with the kit)&#160;in order to negate acidity that may interfere with later steps, centrifuge with the same setting as previously described, and discard the supernatant.</li>
	<li>Resuspend the pellet in 250 &#181;L of modified P1 buffer containing 10 mg/mL lysozyme and 100 U/mL mutanolysin in order to lyse bacterial cells. Incubate for 1-2 h at 37 &#176;C.</li>
	<li>Add 250 &#181;L of buffer P2, mix by inverting four to six times, and incubate at RT for no longer than 5 min.</li>
	<li>Add 350 &#181;L of buffer N3 (included with the kit) and immediately invert four to six times gently to mix.</li>
	<li>Centrifuge at 10,000 x g for 10 min.</li>
	<li>Transfer as much supernatant as possible to a spin column and centrifuge at 10,000 x g for 60 s. Discard the flow through.</li>
	<li>Wash the spin column with 500 &#181;L of buffer PB (included with the kit) and centrifuge at 10,000 x g for 60 s. Discard the flow through.</li>
	<li>Wash the spin column with 750 &#181;L of buffer PE (included with the kit), and centrifuge at 10,000 x g for 60 s. Discard the flow through and centrifuge for 60 s to remove any residual buffer.</li>
	<li>Place the spin column in a 1.5 mL microcentrifuge tube. Apply 20-30 &#181;L of DNAse- and RNAse-free ddH2O to the filter of the spin column and leave for 1-2 min, before centrifuging at 10,000 x g for 60 s.</li>
	<li>Perform a standard PCR reaction using plasmid-specific primers (pTRKH3_pTUSeq_F: CACCCGTTCTCGGAGCA, pTRKH3_pTUSeq_R: CTACGAGTTGCATGATAAAGAAGACA), with eluate providing the template DNA. Include a positive control with a plasmid derived from the E. coli mini-prep. 
	NOTE: The PCR settings used in this study are: 98 &#176;C for 5 min, (98 &#176;C for 30 s, 55 &#176;C for 30 s, 72 &#176;C for 45 s) 30 cycles, 72 &#176;C for 2 min, 4 &#176;C hold. The parameters are highly dependent on the polymerase used, fragment length, and exact primers used by any person utilizing this protocol.</li>
</ol>

Measurement of Reporter Proteins in &lt;em&gt;Limosilactobacillus reuteri&lt;/em&gt; DSM20016

<ol>
	<li>Makarova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+of+the+lactic+acid+bacteria.">Comparative genomics of the lactic acid bacteria.</a> Proceedings of the National Academy of Sciences. 103 (42), 15611-15616 (2006).</li><li>Zheng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+taxonomic+note+on+the+genus+Lactobacillus:+Description+of+23+novel+genera,+emended+description+of+the+genus+Lactobacillus+beijerinck+1901,+and+union+of+Lactobacillaceae+and+Leuconostocaceae.">A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae.</a> International Journal of Systematic and Evolutionary Microbiology. 70 (4), 2782-2858 (2020).</li><li>Adams, M. R., Marteau, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+safety+of+lactic+acid+bacteria+from+food.">On the safety of lactic acid bacteria from food.</a> International Journal of Food Microbiology. 27 (2-3), 263-264 (1995).</li><li>Urba&#324;ska, M., Gieruszczak-Bia&#322;ek, D., Szajewska, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+review+with+meta-analysis:+Lactobacillus+reuteri+DSM+17938+for+diarrhoeal+diseases+in+children.">Systematic review with meta-analysis: Lactobacillus reuteri DSM 17938 for diarrhoeal diseases in children.</a> Alimentary Pharmacology and Therapeutics. 43 (10), 1025-1034 (2016).</li><li>Jansson, P. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+treatment+using+a+mix+of+three+Lactobacillus+strains+for+lumbar+spine+bone+loss+in+postmenopausal+women:+a+randomised,+double-blind,+placebo-controlled,+multicentre+trial.">Probiotic treatment using a mix of three Lactobacillus strains for lumbar spine bone loss in postmenopausal women: a randomised, double-blind, placebo-controlled, multicentre trial.</a> The Lancet Rheumatology. 1 (3), e154-e162 (2019).</li><li>Yang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+non-viable+Lactobacillus+reuteri+combining+with+14-day+standard+triple+therapy+on+Helicobacterpylori+eradication:+A+randomized+double-blind+placebo-controlled+trial.">Effects of non-viable Lactobacillus reuteri combining with 14-day standard triple therapy on Helicobacterpylori eradication: A randomized double-blind placebo-controlled trial.</a> Helicobacter. 26 (6), 12856 (2021).</li><li>Nikawa, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lactobacillus+reuteri+in+bovine+milk+fermented+decreases+the+oral+carriage+of+mutans+streptococci.">Lactobacillus reuteri in bovine milk fermented decreases the oral carriage of mutans streptococci.</a> International Journal of Food Microbiology. 95 (2), 219-223 (2004).</li><li>Reuter, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Lactobacillus+and+Bifidobacterium+microflora+of+the+human+intestine:+Composition+and+succession.">The Lactobacillus and Bifidobacterium microflora of the human intestine: Composition and succession.</a> Current Issues in Intestinal Microbiology. 2 (2), 43-53 (2001).</li><li>Aukrust, T. W., Brurberg, M. B., Nes, I. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+by+electroporation.">Transformation of Lactobacillus by electroporation.</a> Methods in Molecular Biology. 47, 201-208 (1995).</li><li>Lubkowicz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+probiotic+Lactobacillus+reuteri+as+a+biosensor+for+Staphylococcus+aureus+derived+AIP-I+detection.">Reprogramming probiotic Lactobacillus reuteri as a biosensor for Staphylococcus aureus derived AIP-I detection.</a> ACS Synthetic Biology. 7 (5), 1229-1237 (2018).</li><li>Walter, J., Britton, R. A., Roos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-microbial+symbiosis+in+the+vertebrate+gastrointestinal+tract+and+the+Lactobacillus+reuteri+paradigm.">Host-microbial symbiosis in the vertebrate gastrointestinal tract and the Lactobacillus reuteri paradigm.</a> Proceedings of the National Academy of Sciences. 108, 4645-4652 (2011).</li><li>Ahmad, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+bimodal+molecular+weight+levan+by+a+Lactobacillus+reuteri+isolate+from+fish+gut.">Production of bimodal molecular weight levan by a Lactobacillus reuteri isolate from fish gut.</a> Folia Microbiologica. 67 (1), 21-31 (2022).</li><li>MacKenzie, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-specific+diversity+of+mucus-binding+proteins+in+the+adhesion+and+aggregation+properties+of+Lactobacillus+reuteri.">Strain-specific diversity of mucus-binding proteins in the adhesion and aggregation properties of Lactobacillus reuteri.</a> Microbiology. 156 (11), 3368-3378 (2010).</li><li>Oh, J. H., van Pijkeren, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9-assisted+recombineering+in+Lactobacillus+reuteri.">CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri.</a> Nucleic Acids Research. 42 (17), 131 (2014).</li><li>Song, X., Huang, H., Xiong, Z., Ai, L., Yang, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9D10A+nickase-assisted+genome+editing+in+Lactobacillus+casei.">CRISPR-Cas9D10A nickase-assisted genome editing in Lactobacillus casei.</a> Applied and Environmental Microbiology. 83 (22), e01259 (2017).</li><li>Goh, Y. J., Barrangoua, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Portable+CRISPR-Cas9N+system+for+flexible+genome+engineering+in+Lactobacillus+acidophilus,+Lactobacillus+gasseri,+and+Lactobacillus+paracasei.">Portable CRISPR-Cas9N system for flexible genome engineering in Lactobacillus acidophilus, Lactobacillus gasseri, and Lactobacillus paracasei.</a> Applied and Environmental Microbiology. 87 (6), e02669 (2021).</li><li>Berthier, F., Zagorec, M., Champomier-Verg, M., Ehrlich, S. D., Morel-Devillel, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transformation+of+Lactobacillus+sake+by+electroporation.">Efficient transformation of Lactobacillus sake by electroporation.</a> Microbiology. 142 (5), 1273-1279 (1996).</li><li>Rattanachaikunsopon, P., Phumkhachorn, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glass+bead+transformation+method+for+gram-positive+bacteria.">Glass bead transformation method for gram-positive bacteria.</a> Brazilian Journal of Microbiology. 40 (4), 923 (2009).</li><li>Pfl&#252;gl, S., Marx, H., Mattanovich, D., Sauer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+Lactobacillus+diolivorans.">Genetic engineering of Lactobacillus diolivorans.</a> FEMS Microbiology Letters. 344 (2), 152-158 (2013).</li><li>Spath, K., Heinl, S., Grabherr, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+cloning+in+Lactobacillus+plantarum:+Electroporation+with+non-methylated+plasmid+DNA+enhances+transformation+efficiency+and+makes+shuttle+vectors+obsolete.">Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete.</a> Microbial Cell Factories. 11, 141 (2012).</li><li>Ortiz-Velez, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+alterations+associated+with+improved+transformation+efficiency+in+Lactobacillus+reuteri.">Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri.</a> Microbial Cell Factories. 17 (1), 138 (2018).</li><li>O'Sullivan, D. J., Klaenhammer, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mini-prep+isolation+of+high-quality+plasmid+DNA+from+Lactococcus+and+Lactobacillus+spp.">Rapid mini-prep isolation of high-quality plasmid DNA from Lactococcus and Lactobacillus spp.</a> Applied and Environmental Microbiology. 59 (8), 2730-2733 (1993).</li><li>Lizier, M., Sarra, P. G., Cauda, R., Lucchini, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+expression+vectors+in+Lactobacillus+reuteri+strains.">Comparison of expression vectors in Lactobacillus reuteri strains.</a> FEMS Microbiology Letters. 308 (1), 8-15 (2010).</li><li>Roberts, R. J., Vincze, T., Posfai, J., Macelis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=REBASE-a+database+for+DNA+restriction+and+modification:+Enzymes,+genes+and+genomes.">REBASE-a database for DNA restriction and modification: Enzymes, genes and genomes.</a> Nucleic Acids Research. 43, D298-D299 (2015).</li><li>Ahrne, S., Molin, G., Axelsson, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+Lactobacillus+reuteri+with+electroporation:+Studies+on+the+erythromycin+resistance+plasmid+pLUL631.">Transformation of Lactobacillus reuteri with electroporation: Studies on the erythromycin resistance plasmid pLUL631.</a> Current Microbiology. 24, 199-205 (1992).</li></ol>

No conflicts of interest exist.

The most critical step for the transformation of L. reuteri DSM20016 is the generation of anaerobic growth conditions after transformations are plated; colonies gained in aerobic conditions are only very occasional and generally fail to grow when inoculated in MRS broth. Plating the entire recovery volume should also be practiced to maximize the probability of colony growth. Even with these two critical steps, transformation efficiency is still a limitation on experimentation, as expected colonies can number as ...

The genus Lactobacillus were historically classified as gram-positive, rod-shaped, non-spore-forming, either facultative anaerobes or microaerophiles that break sugars down to primarily produce lactic acid1. These loose criteria led to Lactobacillus being, phenotypically and genotypically, an extremely diverse genus. This broad categorization resulted in the genus being reclassified, introducing 23 novel genera in 20202.
The old, broader genus included major commensal and probiotic species generally regarded as safe (GRAS) for consumption3. The Lactobacillaceae family maintains a public perception of being &#39;good bacteria&#39; due to many reported health benefits bestowed via the consumption of various strains4,5,6,7. The ease with which they can navigate the gastrointestinal tract8 and their public acceptance combine to position Lactobacillaceae strains as strong candidates as chassis organisms for ingestible medicinal, therapeutic, or diagnostic applications.
The wide range of characteristics present within the Lactobacillaceae family has led to a situation in which there is no de facto model-organism strain; research groups have tended to select species with the properties most relevant to their particular aims. (For example, dairy fermentation labs could choose L. lactis; studies of vegetable fermentation might select L. plantarum; research on probiotics might focus on L. acidophilus; and so on.)
This same wide range of characteristics across species has led to an accumulation of protocols and procedures that may work well for one subset of the Lactobacillaceae family, but require optimization to work efficiently (or perhaps to function at all) in others9. This need for optimization between family members and even within members of the same species can frustrate the efforts of unfamiliar researchers. Protocols published in the methods sections of papers can also include their own modifications10, leading to fragmented, decentralized protocol collections.
L. reuteri is considered a widely vertebrate commensal, found consistently in mammalian, avian11 and fish12 gastrointestinal (GI) tracts. L. reuteri sub-strains are often genetically specialized, via mucus adhesion protein adaptation, to more permanently colonize specific native hosts8,11,13. GI tract Limosilactobacillus species can be isolated in hosts outside their native host, but tend more toward a transient nature8.
Due to human-host specialization, L. reuteri DSM20016 positions itself very well as a chassis for diagnostic or therapeutic applications at any point in the human GI tract, and the strain DSM20016 could provide a longer-lasting window of effect for interventions when compared to more transitory strains.
In this paper, we outline a series of protocols with demonstrated effectiveness in Limosilactobacillus reuteri (strain designation: F275; other collection numbers: DSM20016, ATCC23272, CIP109823), along with centralized information on the strain from other sources to aid in molecular and systems biology applications. Procedures laid out herein should enable a researcher with no prior experience to culture L. reuteri, create electrocompetent stocks, select transformed colonies, confirm transformation via colony polymerase chain reaction (PCR), and measure designed system response via fluorescent reporter proteins.
We note that related protocols have covered CRISPR-Cas9 assisted ssDNA genome recombineering in L. reuteri (strain: ATCC-PTA-6475)14, and CRSIPR-Cas9 nickase-assisted genome editing in multiple non-L. reuteri, Lactobacillaceae family stains15,16; these do not, however, address the L. reuteri DSM20016 strain that is our focus here.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1 kb Plus DNA Ladder</td>
			<td>NEB</td>
			<td>N3200L</td>
			<td></td>
		</tr>
		<tr>
			<td>1mL Spectrophotometer cuvettes</td>
			<td>Thomas Scientific</td>
			<td>1145J12</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose&#160;</td>
			<td>BioShop</td>
			<td>AGR001</td>
			<td></td>
		</tr>
		<tr>
			<td>Allegra X-15R (refrigerated centrifuge)</td>
			<td>Beckman Allegra&#160;</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>AnaeroGen 2.5 L Sachet</td>
			<td>Thermo Scientific</td>
			<td>OXAN0025A</td>
			<td></td>
		</tr>
		<tr>
			<td>BTX, ECM 399 electroporation system</td>
			<td>VWR</td>
			<td>58017-984</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge tubes (50 mL)</td>
			<td>FroggaBio</td>
			<td>TB50-500</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA gel x6 loading dye</td>
			<td>NEB</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>Electroporation cuvette</td>
			<td>Fisherbrand</td>
			<td>FB101</td>
			<td></td>
		</tr>
		<tr>
			<td>Erythromycin</td>
			<td>Millipore Sigma</td>
			<td>E5389-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel electroporation bath/dock</td>
			<td>VWR</td>
			<td>76314-748</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>BioShop</td>
			<td>GLY001</td>
			<td></td>
		</tr>
		<tr>
			<td>Limosilactobacillus reuteri</td>
			<td>Leibniz Institute DSMZ</td>
			<td>DSM20016</td>
			<td>Strain designation F275</td>
		</tr>
		<tr>
			<td>Lysozyme</td>
			<td>BioShop</td>
			<td>LYS702.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes (1.7 mL)</td>
			<td>FroggaBio</td>
			<td>LMCT1.7B</td>
			<td></td>
		</tr>
		<tr>
			<td>Miniprep kit (Qiagen)</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>slpGFP replaced with constitutive, codon optimised, mCherry2 reporter protein&#160;</td>
		</tr>
		<tr>
			<td>MRS Broth (Dehydrated)</td>
			<td>Thermo Scientific</td>
			<td>CM0359B</td>
			<td></td>
		</tr>
		<tr>
			<td>Mutanolysin</td>
			<td>Millipore Sigma</td>
			<td>M9901-5KU</td>
			<td></td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Millipore Sigma</td>
			<td>1064691000</td>
			<td></td>
		</tr>
		<tr>
			<td>P100 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000047</td>
			<td></td>
		</tr>
		<tr>
			<td>P1000 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000063</td>
			<td></td>
		</tr>
		<tr>
			<td>P2.5 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000012</td>
			<td></td>
		</tr>
		<tr>
			<td>P20 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000039</td>
			<td></td>
		</tr>
		<tr>
			<td>P200 Pipette</td>
			<td>Eppendorf</td>
			<td>3123000055</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR tubes</td>
			<td>FroggaBio</td>
			<td>STF-A120S</td>
			<td></td>
		</tr>
		<tr>
			<td>Personal benchtop microcentrifuge</td>
			<td>Genlantis</td>
			<td>E200100</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td></td>
		</tr>
		<tr>
			<td>PTC-150 Thermal Cycler</td>
			<td>MJ Research</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>pTRKH3_slpGFP (modified)</td>
			<td>Addgene</td>
			<td>27168</td>
			<td></td>
		</tr>
		<tr>
			<td>SPECTRONIC 200 Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>840-281700</td>
			<td></td>
		</tr>
		<tr>
			<td>Storage microplate</td>
			<td>Fisher Scientific</td>
			<td>14-222-225</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>BioShop</td>
			<td>SUC507</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE Buffer 50x</td>
			<td>Thermo Scientific</td>
			<td>B49</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>VWR</td>
			<td>58816-121</td>
			<td>No longer in production</td>
		</tr>
		<tr>
			<td>VWR 1500E incubator</td>
			<td>VWR</td>
			<td>N/A</td>
			<td>No longer in production</td>
		</tr>
	</tbody>
</table>

methods for electroporation and transformation confirmation in limosilactobacillus reuteri dsm20016

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for use as a chassis for synthetic biological endeavors within the gastrointestinal tract. The wide phenotypic and genotypic variation observed within the genus led to a recent reclassification and the introduction of 23 novel genera.
Due to the breadth of variations within the old genera, protocols demonstrated in one member may not work as advertised with other members. A lack of centralized information on how exactly to manipulate specific strains has led to a range of ad hoc approaches, often adapted from other bacterial families. This can complicate matters for researchers starting in the field, who may not know which information does or does not apply to their chosen strain.
In this paper, we aim to centralize a set of protocols with demonstrated success, specifically in&#160;the Limosilactobacillus reuteri strain designation F275 (other collection numbers: DSM20016, ATCC23272, CIP109823), along with troubleshooting advice and common issues one may encounter. These protocols should enable a researcher with little to no experience working with L. reuteri DSM20016 to transform a plasmid, confirm transformation, and measure system feedback in a plate reader via a reporter protein.

Author Spotlight: Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016  

Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016

L.Reuteri, and specifically the strain, DSM20016 is a robust, natural human gut commensal, with great promise for therapeutic delivery and disease detection throughout the gastrointestinal tract. This work will help position DSM20016 as a synthetic biology chassis for those kinds of applications. Lactobacillales have no specific model organism.Preferred species do exist, but they're usually chosen with a bias towards particular research aims. The variation within the bacterial family has led to fragmented protocols, some with iterations of modifications going back through publications. It is very difficult for people starting out to filter exactly what is and is not useful.One paper for the transformation of DSM20016 does exist, but it's not modern. Modern protocols for other Lactobacillales family members exist, but they are not DSM20016. Here we strive to provide an easy to use, centralized, modernized, complete set of protocols for DSM20016 electroporation.This protocol set offers substantial modernization over previous DSM20016 exploration protocol, and elucidates some hanging threads, as well as emphasizing parts that were previously less clear. The protocol set is also complete, and specifically for DSM20016, a strain for which other non-DSM20016 protocols are not totally compatible. One of our main goals is using microbes as inexpensive sensors and delivery systems.We're working with intestinal disease experts to use DSM20016 to sense the conditions in the gastrointestinal tract and deliver therapeutics as required.

Transformation efficiencies 
L. reuteri does not require a dcm-/dam- non-methylated plasmid, as observed for other Lactobacillaceae19,20 (see Figure 1). Electroporation of L. reuteri DSM20016 with 10 &#181;L of the 8.5 kb plasmid pTRKH3_mCherry2 (pAM&#946;1 theta origin of replication) should give transformation efficiencies of roughly 80 colony forming units (CFU...

Watch this Scientific Journal Video about Methods for Electroporation and Transformation Confirmation in Limosilactobacillus reuteri DSM20016 at JoVE.com

Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved.

Lactobacillus were an incredibly large, diverse genus of bacteria comprising 261 species, several of which were commensal strains with the potential for ...

methods-for-electroporation-transformation-confirmation

Research

JoVE Journal

Bioengineering

Preparing Limosilactobacillus reuteri DSM20016 Electrocompetent Cells for Electroporation

Preparing Limosilactobacillus reuteri DSM20016 Electrocompetent Cells for Electroporation  

To begin, inoculate Limosilactobacillus reuteri DSM20016 from glycerol stock into six milliliters of De Man, Rogosa, Sharpe, or MRS broth, in a 50 milliliter tube. Incubate the culture aerobically overnight at 37 degrees Celsius in a static incubator. The next day, inoculate four milliliters of the overnight culture into 200 milliliters of MRS broth.Allow the culture to grow aerobically in a static 37 degrees Celsius incubator until the optical density at 600 nanometers reaches 0.5 to 0.85. Next, decant the culture into 50 milliliter centrifuge tubes and place them on ice while balancing the tubes. Centrifuge the culture in a pre chilled centrifuge and discard the supernatant.Before resuspending the pellet in 50 milliliters of prechilled double distilled water, repeat the centrifugation two times. After the last centrifugation, resuspend the pellet in 25 milliliters of double distilled water, 0.5 molar sucrose, and 10%glycerol. Centrifuge the cell suspension, discard the supernatant, and resuspend the pellet in two milliliters of double distilled water, 0.5 molar sucrose, and 10%glycerol on ice.Aliquot the suspension into 50 to 100 microliter portions in prechilled microcentrifuge tubes and store the tubes at minus 80 degrees Celsius for later use. Next, for electroporation, thaw an aliquot of electrocompetent cells on ice. Mix five to 10 microliters of the plasmid into the thawed aliquot avoiding pipetting as much as possible.Transfer the mixture to an ice chilled one milliliter gap electroporation cuvette and electroporate at 1.25 kilovolts, 400 ohms, and 25 microfarads. After electroporation, add one milliliter of MRS broth and mix by inverting the cuvette once or twice. Place the cuvettes into a static 37 degree Celsius incubator for 2.5 to three hours for recovery.Next, plate the entire suspension onto multiple MRS auger plates with appropriate selection. Place the plates inside an airtight container with a small lit candle in an anaerobic atmosphere generating sachet. Grow at 37 degrees Celsius for two to three days or until visible colonies appear.Electroporation of L.reuteri with constitutive mCherry2 producing pTRKH3 plasmid gives transformation efficiencies of roughly five to eight colonies per 200 microliters plated regardless of the plasmid methylation condition. Transformation with pNZ123 carrying no exogenous constitutive reporter protein yielded transformation efficiencies of three times 10 to the four CFU per microgram of DNA.

Measurement of the Acid-Resistant Fluorescent Reporter Protein mCherry2

Pick any colony from the MRS agar plate containing electroporated L.reuteri cells and inoculate into a 96 well microplate containing filter sterilized MRS broth per well and an appropriate selection antibiotic. Incubate aerobically for 24 hours at 37 degrees Celsius without shaking. The next day, L.reuteri will precipitate out of the media in the stationary phase.Resuspend the culture by pipetting. Add 200 microliters of culture into a flat, clear, bottom 96 well plate. Transfer the plate to a plate reader and measure the optical density and fluorescence of M cherry two and other relevant reporters.Colony morphology noticeably changes in the presence of oxygen. Under low oxygen conditions colonies appear white, opaque, smooth and round. Under partial or leaky conditions, colonies appear undulate, and umbanet.Whereas under atmospheric oxygen levels colonies always appear low bait, round and dry. In wild Type L.rueteri, growth and reporter protein expression vary between colonies making accurate deductions difficult. Plasmid curing, and re-transformation can result in more stable expression but it is an uncommon and unique occurrence reliant on more stable mutant phenotypes spontaneously occurring.

Confirmation of Plasmid Uptake via Colony PCR

Transfer five microliters of electroporated overnight growth L rotary culture from a 96 well plate to a PCR tube. Spin down the cells and discard the supernatant before resuspending the pellet in 20 microliters of 20 millimolar sodium hydroxide. Boil the samples at 95 degrees Celsius for five minutes.Vortex, and repeat the boiling once before placing the samples on ice. Spin down the cells then take one microliter of the supra natant and dilute into 99 microliters of ice cold DNAs and RNAs free double distilled water. Use the 100 times dilution as the template DNA in a standard PCR reaction, using plasmid specific primers and include a positive control with a plasmid derived from the E coli mini prep.After PCR, place the samples on ice and add an appropriate loading dye at one X concentration. Run the samples in 1%Agorase gell in TAE buffer at 110 volts for 30 minutes. Colony PCR of transformed L Rotary varying the preparation temperature resulted in differing rates of PCR success.Samples prepared on ice showed a higher percentage of success rate than that prepared at room temperature or prepared at room temperature, and then incubated at 37 degrees Celsius for 30 minutes before PCR.

Mini-Prep Protocol for Limosilactobacillus reuteri and Confirmation of Plasmid Presence by PCR

Mini-Prep Protocol for Limosilactobacillus reuteri and Confirmation of Plasmid Presence by PCR  

Inoculate L.reuteri into 10 milliliters of MRS broth containing an appropriate antibiotic and incubate overnight aerobically at 37 degrees Celsius. The next day, centrifuge the culture in a pre-chilled centrifuge Discard the supernatant and wash the pellet in two milliliters of standard P1 buffer Centrifuge again and discard the supernatant before resuspending the pellet in 250 microliters of modified P1 buffer. Incubate for one to two hours at 37 degrees Celsius.Next, add 250 microliters of buffer P2 and mix by inverting four to six times. After five minutes, add 350 microliters of buffer N3 and mix by inverting the tube. Centrifuge at 10, 000 G for 10 minutes and transfer as much supernatant as possible to a spin column.Centrifuge again for 60 seconds and discard the flow-through. Wash the spin column with 500 microliters of buffer PB and centrifuge, discarding the flow-through. Wash the spin column with 750 microliters of buffer PE and centrifuge at 10, 000 G for 60 seconds.Discard the flow-through and centrifuge again for 60 seconds to remove any residual buffer. Place the spin column in a 1.5-milliliter microcentrifuge tube. Add 20 to 30 microliters of Dnase-and RNase-free double-distilled water to the spin column filter and leave for one to two minutes before centrifuging at 10, 000 G for 60 seconds.Perform a standard PCR reaction using plasmid-specific primers with eluate providing the template DNA, including a positive control with a plasmid-derived from the E.coli mini-prep. Running the mini-prep eluate through an agarose gel results in a smear, rather than observable bands. However, subsequent PCR using the eluate as a DNA template produces expected band sizes.

1.8K Views.  University of Toronto Mississauga.  Here, we present protocols for working with Limosilactobacillus reuteri DSM20016, detailing growth, plasmid transformation, colony PCR, fluorescent reporter protein measurement, and limited plasmid mini-prep, as well as common issues and troubleshooting. These protocols allow the measurement of reporter proteins in DSM20016, or confirmation via colony PCR if no reporter is involved. 

Measurement of Reporter Proteins in Limosilactobacillus reuteri DSM20016

Summary