Wir sind dankbar, dass Gianni Scimone für hervorragende Unterstützung mit Video machen.

Behandlung von HIV-infizierten Blutproben erfordert einige wichtige Empfehlungen. Alle Proben von Blut muss in robuster auslaufsicheren Behältern transportiert werden. Vorsicht beim Sammeln der Proben eine Kontamination des Containers Außen-und einer begleitenden Unterlagen der Probe zu vermeiden. Alle Personen, die Verarbeitung infiziertes Blut muss Handschuhe tragen. Handschuhe müssen geändert werden und die Hände gewaschen nach Abschluss der Verarbeitung von Proben. Die Verarbeitung von HIV-infizierten Blutprobe muss in einer Klasse II Biohazard Kabinett Haube getan werden. Mechanische Pipettierhilfen verwendet werden sollte. Verwendung von Nadeln oder andere spitze oder scharfe Gegenstände (einschließlich Glas z. B. Pipetten oder Kapillaren) auf Situationen, in denen es keine Alternative zu beschränken. Laboratory Flächen müssen mit einem geeigneten chemischen Desinfektionsmittel nach einem Austritt von Blut dekontaminiert werden und wenn Tätigkeiten abgeschlossen sind. Verunreinigte Materialien müssen vor der Wiederverwendung dekontaminiert werden oder müssen korrekt entsorgt werden über die klinische Abfälle Route. Jeder Vorfall von beruflicher Exposition gegenüber potenziell infektiösem Blut oder Flüssigkeiten (dh diejenigen, erfordert universelle Vorsichtsmaßnahmen) sollte als medizinischer Notfall behandelt werden, da Interventionen zeitnah eingeleitet werden muss, um wirksam zu sein. Das Protokoll benötigt 5 Tage für seine Vollendung. Der Zeitrahmen ist in Abbildung 1 dargestellt sind. Bakterienarten identifiziert werden mit den Methoden in Abbildung 2 beschrieben. 1. Probengewinnung <ol><li> 9 ml Vollblut in EDTA enthaltenden Röhrchen gezogen. </li><li> Die Rohre werden bei 2000 rpm für 10 Minuten bei RT zentrifugiert, um Plasma zu erhalten. </li><li> Plasma wird in einer sterilen 2 ml Eppendorf-Röhrchen gesammelt. </li></ol> 2. DNA-Extraktion aus Plasmaproben <ol><li> Ausreichend desinfizieren Kapuze, Pipetten und Material für das Experiment nötig, um die Sterilität zu gewährleisten. </li><li> Position aller Materialien unter UV-Licht für mindestens 30 Minuten. </li><li> Wischen Sie Handschuhe mit einem Desinfektionsmittel. </li><li> Tränken Sie ein paar Papiertücher in Ethanol und legen Sie sie unter der Haube. Jedes Mal, wenn ein Trinkgeld wird verworfen wischen Sie die Pipette auf die nasse Papiertücher. </li></ol> DNA extrahiert Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA). <ol start="5"><li> 350 ul Plasma in ein steriles 2 ml Eppendorf-Röhrchen gegeben. </li><li> 350 ul gefiltert Reinstwasser als negative Kontrolle verwendet. </li><li> Add 10 l Lysozym (1mg/ml) zu den Proben. </li><li> Inkubieren für 30 Minuten bei 37 ° C. </li><li> Add 500 ul von Lysis Solution und vorsichtig mischen, um die Proben. </li><li> Inkubieren für 7 Minuten bei 65 ° C. </li><li> Add 900 ul Chloroform zu den Proben. </li><li> Vortex kräftig, bis die Proben gleichmäßig viskos sind. </li><li> Geben Sie 200 ul des Niederschlags-Lösung und kräftig vortexen. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei RT zur Trennung der Phasen und bilden die Schnittstelle. </li><li> Übertragen Sie die obere wässrige Phase in ein frisches Reaktionsgefäß mit 1 ml Ethanol 100%. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. </li><li> Add 1 ml Ethanol 70%. </li><li> Centrifuge Proben bei maximaler Geschwindigkeit für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. Die restliche Ethanol sollte mit einem pipettator entfernt werden. </li><li> Das Pellet in 50 ul von Reinstwasser. </li><li> Lesen DNA-Konzentration mit einem Spektralphotometer. </li></ol> 3. 16S rRNA Gene PCR PCR-Amplifikation wird wie zuvor beschrieben 9 durchgeführt. <ol><li> Amplify DNA in einem 100 ul Reaktionsansatz, bestehend aus 10 ul 10x PCR-Puffer, 5 ul 25 mM MgCl2, 5 pl 2 mM insgesamt dNTPs, 1 ul 50 uM Primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 ul 50 uM Primer DG74 (AGGAGGTGATCCAACCGCA), 34 ul H20 und 0,5 ul Taq-Polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA). </li><li> Transfer der PCR-Mischung Filter, um eine mögliche Kontamination durch bakterielle Taq-Polymerase zu vermeiden. </li><li> Centrifuge Filter (Microcon, Millipore, Billerica, MA, USA) für 30 Minuten bei 500 rcf bei 4 ° C. </li><li> Aliquot der PCR-Mix nach der Anzahl der Proben, die verstärkt (positive und negative PCR Kontrollen, Proben und extrahiert Wasser) werden müssen. </li><li> Verwenden Sie die folgenden Thermocycler Bedingungen: 94 ° C für 10 Minuten; 40-mal für je 1 Minute Zeit bei 94 ° C, 55 ° C und 72 ° C und 10 min bei 72 ° C. </li><li> Visualisieren Sie die PCR-Produkt auf einem 2% Agarosegel. Verwenden Sie 100 bp DNA-Leiter. PCR-Produkt beträgt ca. 360 bp (Abbildung 3). </li></ol> 4. PCR Produkt Purification Nur PCR-positiven Proben sollten gereinigt werden. Die Reinigung erfolgt mit Hilfeeines kommerziellen Kits nach den Anweisungen des Herstellers (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). <ol><li> Add 4 Volumen Binding Buffer mit Isopropanol pro 1 Volumen PCR-Produkt. </li><li> Transfer-PCR-Produkt mit Binding Buffer, um eine Spalte. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Wash-Säule mit Waschpuffer mit Ethanol. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 1 Minute bei RT auf die Silica-Membran trocknen und entfernen Sie alle verbleibenden Waschpuffer mit Ethanol. </li><li> Add 10 l Reinstwasser. </li><li> Inkubation für 1 Minute bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 2 Minuten bei RT auf die gereinigte DNA zu sammeln. </li></ol> 5. Cloning Lysogenie Broth (LB) Platte Vorbereitung <ol><li> Lösen Sie 25 g LB-Mix in ca. 800 ml Wasser. </li><li> Bringen Sie das Endvolumen auf 1 L. </li><li> Add 15 gr von Bactoagar. </li><li> Autoklaven für 20 Minuten. </li><li> Nach dem Autoklavieren kräftig Schwenken Sie die Lösung in die Flasche zu mischen geschmolzenem Agar. </li><li> Die Lösung wird auf 50 ° C. </li><li> Add Ampicillin (50 ug / ml) und schwenken, bis sie sich auflöst. </li><li> Platten gießen bis zu einer Tiefe von ca. 3mm. </li><li> Verlassen Sie die Platten bei Raumtemperatur. </li><li> Spread-X-Gal (40mg/ml) und IPTG (100 mM) auf jeder LB-Platte und bei 37 ° C bis zur Verwendung. </li></ol> Kompetente Zellen Transformation Transformation wird unter Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Topo TA Cloning Kit, Invitrogen, Carlsbad CA, USA). <ol><li> Bereiten Sie die Klonierungsreaktion Mix (1-4 ml frisches PCR-Produkt, 1 ul Salz-Lösung, 1 ul der Vektor-und Wasser, wenn nötig). </li><li> Mix Reaktion vorsichtig und inkubieren für 5-10 Minuten bei RT. </li><li> Legen Sie die Reaktion auf Eis. </li><li> Add 2 ul des Klonens Reaktion in ein Fläschchen mit kompetenten Zellen und vorsichtig mischen. </li><li> Inkubieren auf Eis für 30 Minuten. </li><li> Heat-Schock die Zellen für 30 Sekunden bei 42 ° C. </li><li> Sofort überweisen Sie den Schlauch in Eis. </li><li> Add 250 ul Medium. </li><li> Cap der Röhre fest sitzen und schütteln die Röhre horizontal bei 37 ° C für 1 Stunde. </li><li> Verbreiten Sie 50 ul von jeder Transformation auf eine vorgewärmte Platte selektive. </li><li> Inkubieren über Nacht bei 37 ° C. </li></ol> Nach der Inkubation zu entwickeln weiß und blaue Kolonien auf den Platten. Weiße Kolonien sind für PCR-Produkt Einsetzen positive und blaue Kolonien sind für PCR-Produkt Einsetzen negativ. 6. Sequencing Analysis Sequenzierreaktion <ol><li> Eine Mischung wird unter Verwendung dieser Reagenzien: 2,5 ul DNA, 1 ul Primer (5pmol / ul) 1,1 ul BigDye (Applied Biosystem, Foster City, CA, USA). </li><li> Thermal Cycler Bedingungen: 96 ° C für 1 Minute, 25 Mal für 96 ° C für 10 sec, 55 ° C für 15 sec und 60 ° C für 4 min. </li></ol> Säulenreinigung <ol><li> Für jede Reaktion der Vorbereitung, MicroSpin Column (Qiagen,, Mailand, Italien). </li><li> Invert Spalte und Wirbel um Harz zu mischen. </li><li> Snap off Sumpf der Kolonne, lösen Deckel ¼ Drehung, und legen Spalte in einem Reaktionsgefäß. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Transfer-Spalte, um eine saubere Mikrozentrifugenröhrchen. </li><li> Sorgfältig Pipette das gesamte PCR-Sequenzierung Reaktion in der Mitte der Säule. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Gereinigte DNA wird in das Rohr (20 ul von Reinstwasser) eluite. </li></ol> Sequencing Analysis <ol><li> Laden Sie die gereinigte Probe (20 ul) in 96-Multiwellplatte. </li><li> Legen Sie die Platte in den Sequenzer. Automatisierte DNA Sequencer erzeugen ein Vier-Farben-Chromatogramm, das die Ergebnisse der Sequenzierung laufen. </li><li> Geben Sie die Nukleotidsequenz wie eine Abfrage der öffentlichen Sequenz-Datenbanken. Die Suche basiert auf der NCBI-Datenbanken und-Servern ausgeführt, mit Basic Local Alignment Search Tool (BLAST). </li><li> Betrachten Sie nur Bakterien, die mit 98-100% Homologien. </li></ol> 7. Repräsentative Ergebnisse <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Abbildung 1" /> Abbildung 1. Timeline des Verfahrens. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Abbildung 2" /> Abbildung 2. Flussdiagramme des gesamten Identifizierung von Bakterien Verfahren. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Abbildung 3" /> Abbildung 3. 2% Agarosegel zeigt breites Spektrum 16S rRNA-Gen PCR-Produkte. Spur 1 enthält eine 100bp DNA-Leiter, Bahn 2 die PCR positive Kontrolle enthält, zeigt Spur 3 die negative PCR-Kontrolle. Lane 4 zeigt Proben aus einem HIV-positiven Patienten, und Spur 5 enthält Wasser. Spur 6 shows Proben von gesunden Menschen und einem negativen PCR-Reaktion, Spur 7 enthält Wasser. Nur HIV-positiven Patienten zeigt eine positive PCR-Amplifikation. Reinstwasser als negative Kontrolle während der Extraktion verwendet, bedeutet, dass keine Kontamination stattgefunden. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Abbildung 4" /> Abbildung 4. 0,7% Agarosegel zeigt Plasmid mit Miniprep-Verfahren extrahiert. Spur 1 enthält eine 1 Kilobasen DNA-Leiter, enthält Spur 2 die blaue Kontroll-Kolonie, Bahnen 3 bis 12 enthalten weiße Kolonien. Das Plasmid aus dem blauen Kolonie enthält nicht die PCR-Produkt einfügen. Alle 10 weißen Kolonien enthalten Plasmid mit dem richtigen einfügen. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Abbildung 5" /> Abbildung 5. Zeigt ein Beispiel der bakteriellen Sequenzierung im Plasma von einem HIV-positiven Menschen. Unsere Ergebnisse zeigen, dass mikrobielle Translokation in HIV Krankheit eine polimicrobic Flora, die nicht in HIV-negativen Patienten ist zu sehen, was darauf hindeutet erheblichen Ausfall von gut Immunität in die Kontrolle der Bakterien Translokation betrifft.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Hiermit zeigen ein PCR / Sequenzierung Protokoll, um die Translokation von Bakterien im peripheren Blut von HIV-infizierten Personen zu charakterisieren.</p&gt;<p class="jove_content"&gt; Die meisten zuverlässige Ergebnisse werden erzielt, wenn mittels Plasma in EDTA-haltige Röhrchen gesammelt. Nach der Blutentnahme sollte Plasma durch Zentrifugation in 2 / 3 Stunden auseinander liegen, um Hämolyse und DNA-Fragment Abbau zu vermeiden. Die Proben werden zunächst bei -20 ° C für ca. 5 Tage und dann bei -80 ° C g...

<table border="1"><tbody><tr><th> Name des Reagenz </th><th> Firma </th><th> Katalog-Nummer </th><th> Kommentare (optional) </th></tr><tr><td> Easty-DNA Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Chloroform </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Ethanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lysozym </td><td> Fluka </td><td> 62970 </td><td> 10 ug / ml in destilliertem Wasser </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR-Primer </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarose </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA-Leiter </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR Mikro-Kit </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB-Agar, Pulver </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicillin </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / mL in destilliertes Wasser </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/mL in DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100 mM in destilliertes Wasser </td></tr><tr><td> Topo TA Cloning Kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink Schnelle Plasmid Miniprep Kit </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big Farbstoff </td><td> Applied Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 Spin Kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Der gesunde Magen-Darm-Trakt ist physiologisch kolonisierten durch eine Vielzahl von kommensalen Mikroben, die die Entwicklung der humoralen und zellulären mukosalen Immunsystems 1,2 beeinflussen. Microbiota vom Immunsystem über eine starke Schleimhaut-Barriere abgeschirmt. Infektionen und Antibiotika sind dafür bekannt, sowohl die normale Magen-Darm-Schranke und die Zusammensetzung der ansässigen Bakterien, die in möglichst immun Anomalien Ergebnis 3. Mai zu ändern. HIV verursacht einen Bruch in der Magen-Darm-Barriere mit progressiven Versagen der Schleimhaut-Immunität und Leckagen in die systemische Zirkulation von bakteriellen Bioprodukte, wie Lipopolysaccharid und bakterielle DNA-Fragmente, die zu systemischen Immunaktivierung 4-7 beitragen. Mikrobielle Translokation ist in HIV / AIDS-Immunpathogenese und Ansprechen auf die Therapie 4,8 gebracht. Unser Ziel war die Zusammensetzung der Bakterien translozierenden im peripheren Blut von HIV-infizierten Patienten zu charakterisieren. Um zu verfolgen unser Ziel wir eine PCR-Reaktion für die panbacteric 16S ribosomial Gen durch eine Sequenzanalyse gefolgt. Kurz gesagt, ist Vollblut sowohl HIV-infizierten und gesunden Probanden verwendet. Da die gesunden Individuen normalen intestinalen Homöostase derzeit keine Translokation der Mikroflora wird bei diesen Patienten zu erwarten. Nach Vollblutspende durch Venenpunktion und Plasma-Trennung wird die DNA aus dem Plasma extrahiert und verwendet werden, um eine breite Palette PCR-Reaktion für die panbacteric 16S ribosomial Gen 9 Führen. Nach PCR-Produkt Reinigung, Klonierung und Sequenzierung Analysen durchgeführt.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Die Sequenzierung der bakteriellen Mikroflora im peripheren Blut: Unsere Erfahrung mit HIV-infizierten Patienten

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Research

JoVE Journal

Medicine

12.2K Aufrufe.  San Paolo Hospital University of Milan, Italy. Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Serie: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Modeling Hirnblutung in Mice: Injektion von Eigenblut oder bakterielle Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Forschung

Medizin

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

Messen Frailty in HIV-infizierten Personen. Bezeichnung des gebrechlichen Patienten ist der erste Schritt zur Besserung und Umkehr der Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Beurteilung der Gefäßfunktion bei Patienten mit chronischer Nierenerkrankung

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Orthotopen Implantation und der peripheren Immunzellenüberwachung in der II-45 Syngene Rat Mesotheliom Modell

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Digitale Handschriftanalyse von Charakteren bei chinesischen Patienten mit leichter kognitiver Beeinträchtigung

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...

Fertility Preservation in Patients with Severe Ovarian Dysfunction

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, chemo- and radiation-therapies, as well as ovarian surgeries. In unmarried women with severe ovarian dysfunction, fertility preservation is important for future pregnancies. Although oocyte cryopreservation is an established method for fertility preservation, these patients could only preserve a limited number of oocytes even after ovarian hyperstimulation, leading to repeated stimulations to ensure sufficient oocytes to guarantee future pregnancy. To solve this issue, we have recently developed a drug-free in vitro activation (IVA) procedure, which enable us to stimulate early stages of ovarian follicles to develop to the preantral follicle stage. These preantral follicles can respond to the unique protocol of gonadotropin stimulation, resulting in increased number of retrieved oocytes per ovarian stimulation for cryopreservation. The drug-free IVA comprised from the surgical approach and ovarian stimulation. We removed a part of cortex from one or both ovaries from patients under laparoscopic surgery. The ovarian cortical tissues were cut into small cubes to disrupt the Hippo signaling pathway and stimulate the development of early stage follicles. These cubes were grafted orthotropically into remaining ovaries as well as beneath the serosa of both Fallopian tubes. We have already published the surgical procedure of the drug-free IVA and the protocol of subsequent ovarian stimulation, but herein we present the details of laboratory methods required for drug-free IVA.

We present details of laboratory procedures for drug-free in vitro activation (IVA) of ovarian follicles for patients with severe ovarian dysfunction. This method could increase the number of retrievable oocytes per ovarian hyperstimulation and benefit fertility preservation for those patients.

Fruchtbarkeitserhaltung bei Patientinnen mit schwerer Ovarialfunktionsstörung

Ovarian function progressively declines during aging and in some pathophysiological conditions including karyotype abnormality, autoimmune diseases, ...

Evaluation of a Point-of-Care Testing Analyzer for Measuring Peripheral Blood Leukocytes

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At present, most primary medical institutions in China have a poor percentage of adoption of blood-testing technology, and a hematology detection system with a high price to performance ratio and easy operation is urgently needed in primary healthcare centers. This paper introduces the principle and operation procedures of a point-of-care testing (POCT) card-based leukocyte analyzer (evaluated system), which was used to detect WBC indexes such as neutrophils, lymphocytes, and intermediate group cells (including eosinophils, basophils, and monocytes) in whole blood. The results from the evaluated system were compared to those from two commercial automatic hematology analyzers (reference system). The correlation and consistency between the evaluated system and the commercial reference systems were analyzed. The results showed that WBC count and number of granulocytes detected by the evaluated and reference systems showed a strong positive correlation (rs = 0.972 and 0.973, respectively), while the number of lymphocytes showed a relatively low correlation (rs = 0.851). A Bland-Altman plot showed that the major difference between the values detected by the evaluated system and the reference systems is within 95% limits of agreement (LoA), indicating that the two systems are in good agreement. In conclusion, the evaluated system has an excellent correlation, robust consistency, and a reliable comparison with the results of the widely used automatic hematology analyzers. It is ideal for WBC detection in primary medical institutions where a full-automatic five-category hematology analyzer is unavailable, especially during the COVID-19 normalized prevention and control period.

A protocol to measure peripheral blood leukocytes using a POCT card-based leukocyte analyzer is presented here. Same blood samples were tested by two automated hematology analyzers to evaluate the consistency and accuracy of the results. The results showed that the evaluated analyzer had a good correlation with the reference system.

Evaluierung eines Point-of-Care-Testanalysators zur Messung peripherer Blutleukzyten

White blood cell (WBC) is an important indicator of inflammation in the body, and it can help distinguish between bacterial and viral infections. At ...

Cox-Maze IV Procedure Concomitant with Valvular Surgery In Situs Inversus Dextrocardia: A Single-Center Experience in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically easier, faster, becoming the gold standard for the surgical treatment of AF. However, the efficacy and safety of CMP-IV in situs inversus dextrocardia are largely unknown. This paper summarizes the CMP-IV procedure performed concomitantly with valvular surgery in patients with situs inversus dextrocardia at this institution.
From February 2016 to September 2020, three dextrocardia patients with persistent AF and valvular diseases were referred to this institution for valvular and CMP-IV surgery. CMP-IV was performed using either cryoablation with a nitrous oxide (N2O)-based cryoprobe or a bipolar radiofrequency clamp and bipolar radiofrequency pen. Mechanical valve replacement or mitral vavuloplasty was performed in another patient in addition to tricuspid annuloplasty. Transmurality of the ablated atrial tissues was evaluated by electron microscopy. Heart function was assessed by transthoracic echocardiography. Cardiac rhythm was monitored by 24 h Holter at 3, 6, 12, 18, 24, and 48 months follow-up. 
All the AF was successfully eliminated in the ablation procedure without recurrence or other complications during hospitalization. The mean bypass and crossclamp times were similar in all the patients. The postoperative ventilator support time, the duration of stay in the ICU, and postoperative residence time were also not significantly different among the patients. Transmural atrial necrosis was detected in the ablated atrial tissues. Sinus rhythm maintenance was achieved at 3, 6, 12, 18, 24, and 48 months follow-up in all the patients. All valve protheses switched freely; no tricuspid regurgitation was observed. The results of the present study demonstrate that the CMP-IV is safe and effective in eliminating AF in dextrocardia patients concomitant with valvular surgery.

We summarize the Cox-Maze IV procedure concomitant with valvular surgery performed in patients with situs inversus dextrocardia at this institution.

Cox-Maze IV Verfahren Begleitend mit Klappenchirurgie in Situs Inversus Dextrokardie: Eine Single-Center-Erfahrung in China

Atrial fibrillation (AF) is the most common cardiac arrhythmia. The use of ablation technologies made the Cox-Maze IV procedure (CMP-IV) technically ...