Die Autoren sind von der Corus, MedSys Zelleintritt, Kette und Resina Projekte finanziert.

Das Protokoll ist in Abb. zusammengefasst. 4. Ein. Entnahme von Blutproben <ol><li> Sammeln Sie mindestens 3 ml Blut in EDTA-Röhrchen in der klinischen Seite. </li><li> Die Proben können bis zu einer Woche lagern bei 4 ° C. </li><li> Senden Sie die EDTA-Blutproben so bald wie möglich an das Labor auf dem normalen Postweg. </li></ol> 2. Isolierung von HIV-RNA und / oder DNA <ol><li> Erhalten virale RNA und / oder DNA von 1000 ul Vollblut, Serum oder Plasma, mit dem MagNA Pure Compact Nucleic Acid Isolation I Kit I und die MagNA Pure Compact System. </li><li> Eluieren die gewonnenen RNA oder DNA in 50 ul TE-Puffer. Alternativ können andere Nukleinsäuren Reinigungsverfahren verwendet werden. </li></ol> 3. Amplifikation des env-Bereich Verstärken des env-Bereich (2 und 4) entweder von Plasma-RNA oder proviraler DNA. Ein 1245 bp langes Produkt, das den Großteil des Env-Proteins (nt 6556-7811 according bis HXB2) erzeugt wird. <ol><li> RNA-Proben: RT-PCR-Reaktion <ol><li> Virale RNA stellt eine sehr komplexe Sekundärstruktur (Abb. 4), die die RT-Reaktion zu behindern kann. Um dieses Problem zu vermeiden, inkubieren 10 ul RNA bei 65 ° C für 10 Minuten (bereits in der PCR-Röhrchen und in der PCR-Maschine) und dann die Temperatur auf 50 ° C. </li><li> Fügen Sie 40 ul des PCR Master Mix einschließlich der Primer Env-F und Env-R. Master Mix für die RT-PCR In-House-System: <table border="1"><tbody><tr><td></td><td> Volumen / Reaktion (ul) </td><td> Endkonzentration </td></tr><tr><td> RNase-free H 2 O </td><td> 14,4 </td><td></td></tr><tr><td> 5x Puffer (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM) </td> &lt;td&gt; 2 </td><td> 400 uM von jedem dNTP </td></tr><tr><td> Enzym-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> RNase-Inhibitor (RNasin) </td><td> 1 </td><td> 5 Einheiten / Reaktion </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586 nach HXB2) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Führen die RT-Reaktion bei 50 ° C für 30 Minuten. </li><li> Ausführen des ersten PCR wie folgt: <table border="1"><tbody><tr><td> 95 ° C, 15min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 Sek. 50 ° C, 30 Sek. 72 ° C, 2 min </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 Sek. 56 ° C, 30 Sek. 72 ° C, 2 min </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> DNA-Proben: PCR-Reaktion Für proviralen DNA-Proben wird kein anfänglichen RT-Reaktion benötigt wird, und die PCR-Reaktion kann direkt starten. <ol><li> Fügen Sie 40 ul PCR Master Mix bis 10 ul provial DNA. Master Mix für die PCR-In-House-System: <table border="1"><tbody><tr><td></td><td> Volumen / Reaktion (ul) </td><td> Endkonzentration </td></tr><tr><td> RNase-free H 2 O </td><td> 15,4 </td><td></td></tr><tr><td> 5x Buffer (HotStarTaq DNA Polymerase) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM) </td><td> 2 </td><td> 400 uM von jedem dNTP </td></tr><tr><td> Enzym-Mix (HotStarTaq DNA Polymerase) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Führen Sie die PCR-Bedingungen wie zuvor für RNA-Proben (Schritt 3.1.4) beschrieben. </li></ol></li></ol> 4. Amplifikation der V3-Region: nested PCR <ol><li> Für die verschachtelte PCR, verwenden 5 ul aus der ersten PCR-Reaktion (ohne vorherige Analyse in Agarosegel) als Matrize und fügen 95 ul PCR Master Mix. Master Mix für Nested-In-House PCR <table border="1"><tbody><tr><td></td><td> Volumen / Reaktion (ul) </td><td> Endkonzentration </td></tr><tr><td> H 2 O </td><td> 61,9 </td><td></td></tr><tr><td> 10x PCR Buffer </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM) </td><td> 2 </td><td> 200 uM von jedem dNTP </td></tr><tr><td> Primer Env-2F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-2R (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> HotStarTaq DNA Polymerase </td><td> 0,5 </td><td> 2,5 Einheiten / Reaktion </td></tr></tbody></table> Env-2F: 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(nt 7712 ← 7742) </li><li> Führen Sie die PCR wie folgt: <table border="0"><tbody><tr><td> 93 ° C, 15min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 Sek. 50 ° C, 30 Sek. 72 ° C, 90 Sek. </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 Sek. 56 ° C, 30 Sek. 72 ° C, 90 Sek. </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Analysieren des PCR-Produkts auf einem 1% Agarosegel (Abb. 4). Das erwartete Produkt ist 902 bp langen. </li><li> Aufreinigung der Sequenzierungsproben. <ol><li> Reinige das PCR-Produkt mit dem Qiagen PCR-Purification-Kit, mit dem Protokoll, Lösungen und Mikro-Spalten, die vom Lieferanten zur Verfügung gestellt. Eluieren in 30-100 ul PE-Puffer, je nach Bandenintensität. </li><li> Alternativ können die Proben unter Verwendung von Exonuklease werdenI und Fast AP (Thermo alkalische Phosphatase). Zu diesem Zweck fügen Sie 6 ul Exo-AP Mix bis 15 ul PCR-Produkt und inkubieren 15 Minuten bei 37 ° C. <table border="1"><tbody><tr><td> 580 ul H 2 O </td></tr><tr><td> 66 ul schnelle AP </td></tr><tr><td> 13,4 ul Exo I </td></tr></tbody></table></li></ol></li></ol> 5. Sequenzreaktion des V3 Amplikon <ol><li> Die Sequenz besteht aus einer Reaktion PCR-Reaktion unter Verwendung nur eines der folgenden Primer: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980) Env-5: 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) Erste Wahl Primer sind: Env-2, Env-6 oder Env-7, Env-11 </li><li> Verwenden Sie 1 ul aus dem gereinigten V3 Amplikon als Vorlage und fügen 9 ul PCR Master-Mix. Sequenzierung Master Mix: <table border="1"><tbody><tr><td> 4 ul-Sequenz Mix (HIV-Genotypisierung Kit) </td></tr><tr><td> 4 ul H 2 O </td></tr><tr><td> 1 ul Primer (100 pmol / ul) </td></tr></tbody></table></li><li> Führen Sie die Reihenfolge Reaktion wie folgt: <table border="0"><tbody><tr><td> 96 ° C, 10 Sek. </td><td></td></tr><tr><td> 50 ° C, 10 Sek. </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 Sek. </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. Aufreinigung der Sequenzierungsproben Entschlacken Sequenzen using Sephadex G-50 superfine. <ol><li> Füllen Sie die entsprechende Anzahl von Brunnen in der Spalte &quot;loader&quot; mit Sephadex G-50 superfine. Übertragen der Sephadex zur Filterplatte MAHVN4510 durch Umdrehen. </li><li> Fügen Sie 300 ul Milli-Q H 2 O in jede Vertiefung in der Filterplatte und inkubieren Sie es für mindestens 3 Stunden bei 2-8 ° C. </li><li> Zentrifuge die Platten für 5 min bei 910Xg und 4-15 ° C. Entsorgen Sie die Durchströmung. </li><li> Fügen Sie 10 ul H 2 O zu der Sequenz Produkt und dann Pipette der Sequenz auf dem gequollenen Sephadex Platte. </li><li> Um das gereinigte Produkt erhalten, zentrifugieren die Platte für 5 min. bei 910Xg und 4-15 ° C und der Durchfluss gesammelt. </li></ol> 7. Sequenzierung der gereinigten Proben auf dem Sequenzer ABI Prism 3130 XL <ol><li> Vor jedem Lauf, ändern Sie die Puffer und prüfen Sie die Lautstärke des Polymers (POP7). Wenn nötig, ersetzen Sie die alte Polymer Kolben durch einen neuen ersetzen. </li><li> Verwenden Sie die gespeicherten Lauf Bedingungen, einschließlich einer Injektion von 18 Sekunden. </li><li> In dieser Maschine erfolgt die Sammlung der Signaldaten einen Lauf mit 16-Sequenz Proben etwa 60 min (36 cm Kapillare) oder 150 min (50 cm Kapillare). </li></ol> 8. Sequence Editing <ol><li> Verwenden Sie das Programm Lasergene (DNA-Star) zum Ausrichten und bearbeiten Sie die Sequenzen (Abb. 5). Anderen Sequenz Bearbeitungsprogramme können verwendet werden. Verwenden Sie ein &quot;V3-Consensus B&quot; und das env Konsensussequenz als Referenzen. </li><li> Lasergene schafft eine Konsensussequenz der analysierten Probe mit allen Rohdaten und speichern es als FASTA Datei. Die FASTA-Datei ist eine Textdatei, die einen Header mit dem Namen der Probe und der Nukleotidsequenz enthält. </li></ol> 9. Sequenzierung Dateninterpretation und Tropismus Vorhersage <ol><li> Sequenzierung Interpretation der Daten wird durch die web-basierte Interpretation System durchgeführt geno2pheno [Korezeptor] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Für den Tropismus Vorhersage, können verschiedene FPR-Einstellungen gewählt werden. Die Standardeinstellung ist nach den deutsch-österreichischen Therapierichtlinien. Für FPR ≥ 20%, wird das Virus als R5 klassifiziert, wenn FPR ≥ 20% und X4 für FPR &lt;12,5%. </li><li> Laden Sie die FASTA-Datei in dem Server. Dieser Server übersetzt die Nukleotidsequenz in Aminosäuren, fluchtet sie mit der V3-Consensus-Sequenz B und ergibt ein Subtyp Klassifizierung. Darüber hinaus erzeugt er eine Vorhersage des Korezeptor Nutzung (Abb. 4), ausgedrückt als falsch positiv Rate (FPR). </li></ol> 10. Repräsentative Ergebnisse Die geno2pheno [Korezeptor] Ausgabe zeigt eine abgestufte Interpretation des Tropismus. Je nach der Wahrscheinlichkeit des Korezeptor Nutzung variiert die Auslegung Text-und Hintergrundfarbe von grün (&lt;20% FPR), was auf eine sichere Verwaltung für MVC, zu gelb, was auf eine mögliche, mit geringem Risiko und schließlich auf rot. Rot ist die Farbe deutenING nicht MVC verschreiben. Darüber hinaus erzeugt der Server eine pdf Bericht gedruckt werden können, gefüllt mit Patienten und Sample-Daten, und an den Arzt. Beispiele für geno2pheno [Korezeptor] Ausgang sind in Abb. 6. <img alt="Abbildung 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Abbildung. Ein. Schematische Replikation von HIV. Das Virion muss den zellulären CD4-Rezeptor binden und so die CCR5 oder CXCR4 als Korezeptor entweder. Die Korezeptor CCR5 mit CCR5-Antagonisten wie Maraviroc (MVC, Celsentri, Selzentry) blockiert werden. Nach dem Verschmelzen der viralen und zellulären Membranen wird das Virus-Nucleocapsid im Zytoplasma freigesetzt. Das Nukleokapsid zerlegt und die virale RNA-Komplex freigesetzt wird in das Zytoplasma. Die virale reverse Transkriptase (RT) der genomischen RNA transkribiert in provirale DNA, die dann in den Zellkern transportiert wird, und integriert in das Genom des Wirts durch die HIV-Integrase. Zellulären RNA-Polymerasen transcribe viralen Genom-und Boten-RNAs aus dem Provirus Genom. Die viralen Proteine ​​werden im Cytoplasma hergestellt und transportiert, um der Zelloberfläche. Die Viruspartikel Knospe als unreifen, nicht-infektiösen Virionen aus den Zellen. Die HIV-Protease spaltet die Proteine ​​produzieren, um infektiöse Partikel. Hemmung der einen der Schritte führt zu einer Unterbrechung des Replikationszyklus. Die antiretrovirale Medikamente und die Replikation Schritt, dass sie verhindern, sind rot markiert. Die viralen RNA und Provirus-DNA (Material für Tropismus oder Widerstand Analyse verwendet) sind grün markiert. <img alt="Abbildung 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> Abbildung 2. HIV Provirus Genom. Die HIV-Partikel mit unterschiedlichen strukturellen Proteinen und beherbergt verschiedene Enzyme und Proteine ​​sowohl von viralen und zellulären Ursprungs gebaut. Die Abbildung zeigens die Position der Gene innerhalb des viralen Genoms. Die Oberflächenproteine ​​gp120 und gp41 darstellen Spikes auf der Oberfläche des Virions und den Kontakt zum menschlichen Zelle, um die Membranfusion durchzuführen. Im unteren Teil der Figur sind die PCR-Amplifikationsprodukte und die Primer im Protokoll gezeigt. <img alt="Abbildung 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Abbildung 3. Anteil der Patienten mit einer niedrigen Viruslast (VL)-Messungen für Drogen-Resistenz oder Tropismus Bestimmung am Institut für Virologie, Universität Köln (Deutschland) analysiert. <img alt="Abbildung 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> Abbildung 4. Insgesamt Schema des Experiments .. Bitte <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">klicken Sie hier,</a> um eine größere Version dieser Figur sehen. <img alt="Abbildung 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> Abbildung 5. Sequenz Bearbeitung mit Lasergene. Die V3 Amplikon mit mindestens einem Vorwärts-und einem Rückwärts-Primer sequenziert wird. Lasergene alignés die &quot;. Abi&quot; Dateien aus dem Sequenzer mit dem Referenz-Sequenzen &quot;V3-Consensus B&quot; erhalten und env. Lasergene schafft eine Konsensus-Sequenz mit allen Zeilen zur Verfügung. Die Referenz-Sequenzen können markiert (und werden dann in grau dargestellt) werden, damit sie nicht zu der Probe Konsensussequenz nicht beitragen. <img alt="Abbildung 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Abbildung 6. Tropismus Vorhersage Berichte des geno2pheno generiert [Korezeptor] tool.The Berichte werden als PDF-Dateien, die gespeichert und fertig im Computer generiert. Zusätzliche Daten wie uns Name des Patienten, das Datum der Blutentnahme, etc., können manuell aufgenommen werden mittels eines pdf writer Programm. Besondere Bemerkungen können ebenfalls hinzugefügt werden. These Daten sind ausschließlich auf dem Computer des Benutzers und nicht auf der geno2pheno [Korezeptor] server. Bitte <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">klicken Sie hier,</a> um eine größere Version dieser Figur sehen.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

Dieses Video Artikel wird von ViiV Healthcare und GlaxoSmithKline gesponsert.

Die V3-Sequenz erlaubt eine zuverlässige virale Tropismus Vorhersage, wie in klinischen Studien 3-9 gezeigt. In der Tat ist genotypischen Bestimmung in der geltenden europäischen und deutsch-österreichischen Richtlinien 10 vorgesehen. Verglichen mit phänotypischen Testung, wird nicht nur die Zeit, die kürzer Umsatz (entspricht Resistenztestung), sondern auch die Kosten. Darüber hinaus ist ein großer Vorteil der genotypischen Tests, dass die Ergebnisse als FPR werden benotet und kann daher auf die Bedürfnisse der Patienten angepasst werden. Trofile Ergebnisse, auf der anderen Seite, sind einfach R5 oder X4 Berichten und den Zugang zu den Rohdaten wird nicht gegeben. Derzeit deuten die europäischen Richtlinien eine FPR Cut-off von 20% 10, während die österreichisch-deutschen Richtlinien zur Anpassung der FPR cut-off speziell für jeden Patienten die Bedürfnisse 11 zu ermöglichen. In dieser Linie für Patienten mit einem breiten Spektrum von antiretroviralen Medikamenten Möglichkeiten, höhere FPR cut-offs (&gt; 20%) sind empfbeendet. Umgekehrt bei stark vorbehandelten Patienten mit begrenzten therapeutischen Optionen unteren FPR cut-offs (&gt; 5%) verwendet werden. Diese Art der Therapie Führung ist derzeit laufenden durch den Widerstand testet den NRTIs, NNRTIs, PIs und INIs, wo teilweise wirksamen Arzneimitteln in der Behandlung von Patienten mit eingeschränkter therapeutischer Optionen enthalten sein können. Darüber hinaus mit der wachsenden Zahl von genotypisch-gestützte Therapie Veränderungen, die klinisch relevanten FPR cut-offs werden ständig von einer Jury aus Bioinformatiker, Virologen und Mediziner eingestellt. Ein weiterer wichtiger Vorteil der genotypischen Tropismus Tests ist die Möglichkeit zur Analyse klinischer Proben mit sehr geringen oder gar Viruslast (VL). In diesen Fällen, wenn Plasma RNA nicht amplifizierbare kann der Provirus-DNA sequenziert werden und für zuverlässige Vorhersagen 9,12. Zu beachten ist, ist die Zahl der Patienten mit niedrigen oder nicht nachweisbaren Viruslast stark in den letzten Jahren zugenommen. Bis heute hat die Trofile Assay erlaubt nur die Analyse von Proben von Patienten mit VL &lt;1000 Kopien / ml. Allerdings haben Voruntersuchungen gezeigt, dass Provirus-DNA kann auch sein adecuate durch Trofile 13 getestet werden.

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td><td> Kommentare </td></tr><tr><td> MagNA Pure Compact Nucleic Acid Isolation Kit I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> MagNA Pure Compact System </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 Thermocycler </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Master Mix Kit </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Exonuklease I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> FastAP Thermosensitive Alkaline Phosphatase </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> BigDye Terminator v3.1 Cycle Sequencing Kit </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI Prism 3130 XL Kapillarsequenzer </td><td> Applied Biosystems </td><td> 3130xl </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) ist der erste lizenzierte antiretrovirale Medikament aus der Klasse der Korezeptor-Antagonisten. Es bindet an den Host Korezeptor CCR5, das von der Mehrzahl der HIV-Stämme verwendet, um die humanen Immunzellen (Abb. 1) zu infizieren. Andere HIV-Isolate eine andere Korezeptor, die CXCR4. Welcher Rezeptor verwendet wird, wird in dem Virus vom Env-Protein (Fig. 2) bestimmt. Abhängig von der Korezeptor verwendet, werden die Viren als R5 oder X4, bzw. klassifiziert. MVC bindet an den CCR5-Rezeptor Hemmung der Eintrag von R5 Viren in die Zielzelle. Im Verlauf der Erkrankung kann X4-Viren entstehen und wachsen die R5-Viren. Bestimmung der Korezeptor Nutzung (auch als Tropismus) ist daher zwingend vor der Verabreichung von MVC, wie EMA und FDA gefordert. Die Studien für MVC Effizienz MOTIVATE MERIT und 1029 wurden mit dem Trofile Assay von Monogram, San Francisco, USA durchgeführt Dies ist ein qualitativ hochwertiges Assay basierend auf sophisorgfältigster Bearbeitung rekombinanten Tests. Die Akzeptanz für diesen Test für die tägliche Routine ist eher gering außerhalb der USA, da die europäischen Ärzten eher mit dezentralen Experten Labors, die auch gleichzeitige Resistenztestung meidet. Diese Laboratorien haben mehrere Qualitätssicherung Auswertungen, die letzte in 2011 1 präsentiert unterzogen. Seit einigen Jahren haben wir Tropismus Bestimmungen basierend auf Sequenzanalyse von der HIV env-V3-Genregion (V3) 2 durchgeführt. Diese Region trägt genügend Informationen, um eine zuverlässige Prognose durchführen. Die genotypische Bestimmung der Korezeptor Nutzung stellt Vorteile wie: kürzere Umschlagszeit (entspricht Resistenztestung), niedrigere Kosten, die Möglichkeit, die Ergebnisse an die Bedürfnisse der Patienten anzupassen und die Möglichkeit der Analyse von klinischen Proben mit sehr geringer oder gar nicht nachweisbare Viruslast (VL ), zumal die Zahl der Proben mit VL analysiert &lt;1000 Kopien / uletwa in den letzten Jahren erhöht (Abb. 3). Die wichtigsten Schritte für Tropismus-Tests (Abb. 4) zeigt in diesem Video: Ein. Sammeln einer Blutprobe 2. Isolierung der HIV-RNA aus dem Plasma und / oder HIV proviralen DNA aus mononukleären Blutzellen 3. Amplifikation des env-Bereich 4. Amplifikation der V3-Region 5. Sequenzreaktion des V3 Amplikon 6. Aufreinigung der Sequenzierungsproben 7. Sequenzierung der gereinigten Proben 8. Sequence Editing 9. Sequenzierung Dateninterpretation und Tropismus Vorhersage

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Die Vorhersage des Korezeptor Nutzung von HIV-1 ist für die Verwaltung einer neuen Klasse von antiretroviralen Medikamenten, dh Korezeptor-Antagonisten erforderlich. Es kann durch Sequenzanalyse die durchgeführt werden<em&gt; Env</em&gt; Gens und anschließende Interpretation durch eine Internet-basierte Interpretation Systems (geno2pheno<sub&gt; [Korezeptor]</sub&gt;).

Vorhersage von HIV-1 Korezeptor Usage (Tropismus) durch Sequenzanalyse mit einem Genotypische Ansatz

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K Aufrufe.  University of Cologne.  Español 

Serie: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

Bewertung von immunologisch relevanten dynamischen tertiären strukturellen Merkmale der HIV-1 V3-Loop Crown R2 Sequence durch Ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Forschung

Immunologie und Infektion

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Spezielle Kennzeichnung von HIV-1 positiven Zellen mit Hilfe eines Rev-abhängigen Lentivirale Vector mit dem Ausdruck des Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Genotypische Inference von HIV-1 Tropismus mit Populations-basierte Sequenzierung von V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Aufbau des HIV-1 Capsid Assemblies durch Kryo-Elektronenmikroskopie und Iterative Helical Real-Raum Wiederaufbau

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

In vitro Uncoating von HIV-1-Kerne

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

Beurteilung der Innate Sensing von HIV-1-infizierten CD4<sup&gt; +</sup&gt; T-Zellen durch Plasmazytoide Dendritische Zellen unter Verwendung eines<em&gt; Ex-vivo-</em&gt; Co-Kultursystem.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Konformationsänderungen Auswertung der HIV-1-Trimeric Hüllglycoproteine ​​mit eine Handy-basierte ELISA-Test

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolierung der Exosomen aus dem Plasma von HIV-1-positiven Individuen

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Messung von<em&gt; In Vitro</em&gt; Integration Aktivität von HIV-1 Preintegration Komplexe

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.