RSM erkennt Finanzierung von der NSF Graduate Research Fellowship. MBN erkennt Finanzierung aus einer Lewis-Sigler Fellowship und die Stiftungs Geschenk von Peter Lewis. DB bestätigt, Mittel aus dem NIH (GM046406) des National Institute of General Medical Sciences Center for Quantitative Biology (GM071508). Wir erkennen Christina DeCoste für die Unterstützung bei der Durchflusszytometrie Experimenten.

Figur 2 eine schematische Darstellung des Protokoll-Abschnitte 1-3. 1. Erstellung von ATFs <ol><li> Erstellen Primer für die PCR Amplifikation von DNA-bindenden Domäne von Interesse. Homologie zu der ACT1-Promotor und Hormon-Rezeptor (wie in den 3 und 4 beschrieben) wird durch PCR zugegeben, um eine korrekte Rekombination in dem Stamm yMN15 erleichtern. </li><li> PCR verstärken DBD von Interesse mit einem High-Fidelity-Polymerase. </li><li> Transformieren&gt; 1 ug gereinigte PCR-Produkt in Hefe unter Verwendung der Lithiumacetat-Methode 13. </li><li> Nach der Transformation, Spin-Zellen bei Höchstgeschwindigkeit für 15 Sekunden in Mikro und entfernen Transformationsmischung. </li><li> Resuspendieren in ~ 200 ul sterilem Wasser und Platte auf YPD. </li><li> Am nächsten Tag, Replik Platte von YPD auf 5-FOA-Platten (5-FOA-Platten werden wie in der Cold Spring Harbor Hefe-Handbuch beschrieben ist) 13. </li><li> Lassen Wachstum für 2-4 days und restreak mindestens 5-10 Kolonien auf YPD. Durchführen einer Kolonie-PCR unter Verwendung der Primer in Tabelle 1 und die Sequenz für die Eingliederung zu überprüfen. </li></ol> 2. Erstellung von ATF Plasmid Reporter <ol><li> Bestimmen Sie die Bindungsstelle des ATF (am ehesten von der Literatur kommen). </li><li> Um die gewünschte Bindungsregion Oligos (oder Ultramers, falls erforderlich). Bestellen Sie als Ober-und Unter Stränge mit der richtigen Überhängen für NotI und XbaI, wie in Tabelle 2 dargestellt. </li><li> Verdünnen Oligos äquimolaren Konzentrationen (100 &amp;mgr; M). </li><li> Phosphorylierung mit T4 Polynukleotid-Kinase und dann Glühen in einem Thermocycler. Die Reaktionsbedingungen sind in Tabelle 3. </li><li> Verdau ~ 1-2 &amp;mgr; g pMN8 mit NotI und XbaI-HF für 1 h bei 37 ° C (Reaktionsbedingungen in Tabelle 4). </li><li> Gel reinigt das Rückgrat Band. </li><li> Verdünnen Sie die gereinigten Backbone bis 10 ng / ul. </li><li> Verdünnen Sie die Doppelstrang-, PhosphorylATED Bindungsstelle, um die Stoffmengenkonzentration von Backbone pro ul 5x. </li><li> Verwendung von T4-DNA-Ligase zu ligieren, die Bindungsstellen in den verdauten Rückgrat bei Raumtemperatur für 30 min (Tabelle 5). </li><li> Für die Transformation, fügen die Hälfte der Ligationsreaktion zu 50 ul von Standard-, chemisch kompetente Escherichia coli, wie XL1-Blue oder DH5-Alpha. </li><li> Hitzeschock-Zellen, die für 45 Sekunden in einem 42 ° C Wasserbad und legen Sie dann auf Eis für 2 min. </li><li> In 900 ul SOC-Medium der Transformation Reaktion. </li><li> Wachsen bei 37 ° C für 1 h auf einer Walzentrommel. </li><li> Verbreiten 100-200 Zellen pro ul LB + AMP (100 ug / ml) Platte und Inkubation über Nacht. </li><li> Grow up E. coli in LB + AMP Flüssigkeit und Ernte Plasmid-DNA. Sequence überprüfen neuen Reporter-Plasmid von Kolonien Ligation unter Verwendung des Primers 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li> Trans neuen Reporter-Plasmid in ATF-haltigen Hefe strain von Abschnitt 1 mit Lithium-Acetat-Transformation. </li></ol> 3. Quantifizierung der Wirkung von ATF Induktion über Gene Expression Mit GFP-Reporter Vorbereitung der Proben: <ol><li> Machen Sie 25 mM β-Estradiol-Lager (10 ml Ethanol + 0,0681 g β-Estradiol). Im Kühlschrank. </li><li> Wachsen ATF +-Stamm Reporter haltige über Nacht in 5 ml SC-URA. </li><li> Erhalten neun 250 ml-Schüttelkolben und 25 ml SC-URA zu jedem. </li><li> In 0 nM, 0,1 nM, 1 nM, 10 nM, 100 nM, 1 uM oder 10 uM β-Estradiol. Dies geschieht am einfachsten, indem Sie das 10-fache serielle Verdünnungen der 25 mM β-Estradiol Lager getan. Für eine endgültige Konzentration von 10 uM β-Estradiol, fügen Sie 10 ul der 25 mM β-Estradiol Lager zu 25 ml SC-URA. </li><li> In 125 ul der Übernachtkulturen in Kolben (1:200 Verdünnung). </li><li> Für die restlichen zwei Fläschchen, impfen mit einem konstitutiven GFP Herstellung Strain und ein Stamm fehlt GFP. Diese werden für die Kalibrierung des Durchflusszytometers benötigt. </li><li> Schütteln bei 200 rpm bei 30 ° C für 12-18 Stunden. Hinweis: Die optimale Inkubationszeit wird durch die Identifizierung, wenn GFP-Induktion nicht mehr ändert nach Zugabe von β-Östradiol bestimmt. </li><li> Nehmen Sie 500 ul jeder Kultur und Spin-down in separaten 1,7 ml Mikrozentrifugenröhrchen. </li><li> Saugen SC-URA. </li><li> Einmal in 1 ml PBS + 0,1% Tween-20 waschen und absaugen. </li><li> 1 ml PBS + 0,1% Tween-20 und resuspendieren. </li><li> 1 ml PBS + 0,1% Tween-20 Falcon-Röhrchen. </li><li> Hinzufügen der resuspendierten Zellen auf 5-ml-Röhrchen (Endvolumen = 2 ml) (mit 4 ° C für mehrere Tage gelagert werden.) </li><li> Optional: beschallen Zellen leicht, um etwaige Trennung verklumpte Zellen. Durchflusszytometrie-Analyse: Überblick: Die Fluoreszenz von 10.000-100.000 Zellen wird in der Regel pro Probe analysiert. Die Daten können entweder in FlowJo oder mit benutzerdefinierten Skripten in MATLAB oder verarbeitet werdenR. Achten Sie darauf, um die Spannung des GFP-Kanal-Kalibrierung mit GFP-positiven und negativen Kontrollen. Sobald die FCS-Dateien exportiert werden, ein Skript, wie in Abbildung 6 zusammen mit den Funktions fca_readfcs ( <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> können) verwendet, um das zu verarbeiten Daten. </li><li> Führen Durchflusszytometrie. <ol><li> Verwenden Vorwärtsstreuung (FSC) und Seitenstreuung (SSC), Hefe-Zellen zu identifizieren. </li><li> Die Durchflussrate auf ~ 3.000 Zellen / sec. </li><li> Messen GFP (FITC Kanal). </li><li> Sobald die Daten erhoben werden, zu exportieren. FCS-Dateien </li></ol></li><li> Legen MATLAB. </li><li> Verschieben Sie die. FCS-Dateien fcs_readfcs.m und ein Skript ähnlich dem aus Abbildung 6 in den gleichen Ordner. </li><li> Ändern Sie die aktuelle Arbeitsverzeichnis in den Ordner mit den Daten und Skripte. </li><li> Führen Sie das Skript aus Abbildung 6 (Hinweis: DieLegende wurde manuell eingegeben werden, um zu produzieren, was in Abbildung 7 zu sehen). </li></ol> 4. Quantifizierung der Wirkung von ATF Induktion auf das Zellwachstum <ol><li> Von gefrorenen Aktien, Streifen sowohl (1) ein ATF-haltigen Stamm und (2) ein ATF-Stamm fehlt (wie yMN15) auf separate YPD-Platten. </li><li> Nach 2 Tagen Wachstum inokulieren separaten Kulturröhrchen, enthaltend 5 ml YPD-Flüssig mit jedem Stamm und über Nacht wachsen bei 30 ° C </li><li> Führen Sie 10-fach serielle Verdünnungen einer 0,25 mM β-Estradiol-Stammlösung bis zu 10.000-fach (0,025 uM β-Estradiol) in 100% Ethanol. </li><li> In 40 ul-Nacht-Kulturen zu 10 ml YPD-Flüssigkeit (1-250 Verdünnung). </li><li> Für jeden Stamm, füge 96 &amp;mgr; l der verdünnten Zellen auf 18 Wells einer 96-Well-Platte. </li><li> Hinzufügen von 4 ul β-Östradiol zu den Zellen. Ein wesentlicher Punkt ist, um sicherzustellen, dass jeder auch die gleiche Menge an Gesamt-Ethanol. (Alternativ kann ein mo<html> re konzentrierte Stamm von β-Estradiol verwendet werden und anschließend auf den Punkt verdünnt die Wirkung von Ethanol auf Wachstum ist nicht messbar). </li><li> Führen Sie in dreifacher Ausfertigung. Drei der Vertiefungen für jeden Stamm sollte Ethanol nur steuert. </li><li> Decken Sie die 96-Well-Platte in gasdurchlässige Membran. </li><li> Überwachung Wachstum (OD 600) in Plattenlesegerät. </li><li> Quantifizierung der Wachstumsraten mit einer beliebigen Anzahl von Standardmethoden wie das Finden der maximalen Steigung. Hinweis: Wir haben gute Erfolge mit der Open-Source-Software-Paket Grofit 14, die in der R-Programmierumgebung läuft hatte Es ist erwähnenswert, dass, während die Wachstumsraten von 96-Well-Plattentests berechnet, verglichen mit (25 ml Kulturen)-Fläschchen schütteln. sind nicht unbedingt die gleichen (aufgrund beiden Unterschiede in der Physiologie und in der Instrumentierung), haben wir beobachtet, dass die relativen Wachstumsraten sind ähnlich (obwohl dies nicht immer der Fall sein). </li></ol>tle &quot;&gt; 5. erstellen Inducible Genomic Allele <ol><li> Erhalten pMN10, noncentromeric ein Plasmid mit der ATF-responsive Promotor aus pMN8 zu KanMX (in der entgegengesetzten Orientierung) fusioniert. </li><li> Beschränkung verdauen die Vektor-Rückgrat und Gel-Extrakt, wie in Abschnitt 2. </li><li> Glühen, phosphoryliert und Ligats Oligos, die geeignete Bindungsstellen, wie in Abschnitt 2 beschrieben. </li><li> Sequenz zu überprüfen. Dieses Plasmid wird nun als DNA-Vorlage für die Erstellung der induzierbaren Allel zu dienen. </li><li> Erhalten Sie die Hefestamm die entsprechende ATF von Interesse exprimieren. </li><li> PCR verstärken die KanMX-Promoter Kassette (~ 2 kb) unter Verwendung der Primer aus Tabelle 6. </li><li> Transformieren Sie das PCR-Produkt in die ATF-exprimierenden Stamm unter Verwendung der Lithium-Acetat-Methode. </li><li> Platte auf YPD-und Replika Platte auf YPD + G418 am folgenden Tag. </li><li> Bestätigen geeignete Insertion des Promotors unter Verwendung des Vorwärts-Primers (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) und einen Rückwärtsprimer internen the Gen, dessen Promotor ersetzt wurde. Der Reverse-Primer ist typischerweise entworfen, um zwischen 200-300 bp stromabwärts des ersten ATG 15 sein. Das endgültige PCR-Produkt wird ~ 1,2 kb. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

McIsaac, Noyes und Botstein (mit anderen) sind Teil dieses Systems als Patent Offenlegung eingereicht.

Die hier beschriebenen Hormon-basierte Schalter haben unzählige Anwendungen, von nativen Zellbiologie studieren, um zu testen, ob eine DNA-Bindungsdomäne von Interesse, eine DNA-Sequenz in vivo zielen. Das System hat viele wünschenswerte Eigenschaften, einschließlich einer abgestuften Reaktion auf Induktor, schnelle Action, und strenge Regulierung (dh. Keine messbare Undichtigkeit, siehe Abbildung 7). Es gibt jedoch immer noch Raum für Verbesserung und Erweiterung. Die jüngsten Arbeiten in der synthetischen Biologie hat Multiplex synthetischen Systemen betont und erweitert das Repertoire der gut charakterisierten, programmierbare DNA Teile 16. Independent, bedingter Ausdruck von unterschiedlichen Zielgenen erfordert sowohl mehrere Induktoren und DNA-Bindungsdomänen, die sich überlappenden Spezifität fehlt. Die Verfügbarkeit von Engineered und natürlich vorkommende Rezeptoren bietet eine große Anzahl von Teilen, mit denen neue künstliche Transkriptionsfaktoren zu entwickeln. Der Ausbau derRepertoire von zueinander orthogonalen Schalter wurde stark durch gerichtete Evolution gestützte Ansätze 17,18. Die derzeitigen Bemühungen, den Liganden-Bindungsspezifität von unserer künstlichen Transkriptionsfaktoren umprogrammieren in der Zukunft vorgestellt werden. Bisher wurden die phänotypischen Auswirkungen der Gen-Deletion / Überexpression sind ausführlich in Hefe 19,20 sucht. Es hat sich jedoch nicht einfach ist, die Wirkung der Expression von verschiedenen Phänotypen über einen Bereich von Expressionsniveaus zu studieren. Ein Hauptmerkmal des hier vorgestellten Systems ist die abgestufte Natur (Abbildung 8). Während häufig angenommen, die Beziehung zwischen Genexpression und Phänotypen von Interesse nicht notwendigerweise monoton sein. Künstliche Transkriptionsfaktoren wie Z 3 und Z 4 EV EV wird die Aufgabe der Bestimmung der phänotypischen Reaktion auf Änderungen in der Genexpression einfach machen. Schließlich werden die Protokolle diskutierened in diesem Manuskript sind für technische und Charakterisierung künstliche Transkriptionsfaktoren, die an β-Östradiol reagieren, jedoch eine wichtige Alternative zu chemisch reaktionsDomänen ist die Verwendung von auf Licht reagierenden Domänen (wie die PhyB/Pif3, LOV, und BLUF) deren Aktivitäten sind reversibel, ohne die Kultur Wachstumsmedium 21-23 stören. Lichtsysteme erleichtern räumlich-zeitliche Kontrolle der Genexpression, Protein-Protein-Wechselwirkungen, Ionentransport, und die enzymatische Aktivität, die bereits leistungsfähige 21-26 bewährt haben. Zusammenfassend haben wir Methoden für die schnelle Konstruktion von induzierbarer, künstliche Transkriptionsfaktoren in Hefe dargestellt. Dieses Protokoll stellt eine Vorlage für die Konstruktion in Verbindung mit zugehörigen GFP-Reporter, wie auch Methoden für die Analyse der Daten unter Verwendung von Reporter-Durchflusszytometrie und Testen der Wirkung des ATF-Aktivierung auf Wachstum.

Entwicklung von genetischen Schalter in Hefe ist von großem Interesse, sowohl in der akademischen und industriellen Forschung. Im Idealfall können genetische Schalter verwendet werden, um ein bestimmtes Gen (oder eine Gruppe von Genen) nur aktiviert, wenn der Experimentator wünschen übrig. Eines Gens kodierende Sequenz stromabwärts von einem synthetischen Promotors nicht in Abwesenheit einer induzierenden Moleküls ausgedrückt: auf Induktors zusätzlich das Gen sollte rasch ausgedrückt werden. Es wurde erst kürzlich gezeigt, daß ein solcher Schalter kann in Hefe, wobei in Abwesenheit des Induktors, zeigt der Stamm eine Deletion Phänotyp, jedoch in Gegenwart von Induktor wird die Expression im Verhältnis zu der Ebene der Induktor in allen Zellen aktiviert konstruiert werden, 1,2. Historisch haben bedingten Expressionssysteme in Hefe stark auf nährstoff reaktive DNA-Sequenzen, darunter die MET, FO und GAL-Promotoren (deren Aktivitäten sind empfindlich gegen extrazelluläre Konzentration von Methionin, Phosphat und verlassenGalactose, jeweils). Während Bedingungsausdruck erzielt werden kann, kommt es auf Kosten einer signifikanten pleiotrope Effekte. Hormonrezeptoren, wie dem menschlichen Östrogen-Rezeptoren haben sich als wirksam schaltet in Eukaryonten 3,4 sein. In Abwesenheit des Hormons, kann ein Protein mit einem Hormonrezeptor fusioniert im Cytoplasma, wo sie mit dem Hsp90-Chaperon-Komplex interagiert, sequestriert werden. Bei der Bindung der entsprechenden Liganden der Rezeptor eine Konformationsänderung, wodurch es zu der Hsp90-Chaperon-Komplex freigesetzt werden und enthüllt ein Kernlokalisationssignal. Um die Lokalisation Dynamik einer bestimmten Hormonrezeptor-enthaltendes Protein beobachten wir eine C-terminale Fusion Gal4dbd.ER.VP16 (GEV, einem synthetischen Transkriptionsfaktor, der die Gal4p DNA-Bindungsdomäne, die Ligandenbindungsdomäne des humanen Östrogenrezeptor geschaffen und VP16) mit GFP 2. Kernlokalisierungs wurde innerhalb von 8 min nach der Zugabe von beobachtetensättigenden Mengen der Induktor ß-Östradiol, zu dem Wildtyp-Hefe ist völlig inert. Bis zu diesem Zeitpunkt die Mehrheit der Zellen deutlich sichtbar aktiv Stellen für Transkriptions GEV Zielgene (über Fluoreszenz-in-situ-Hybridisierung untersucht) sowie ausgereifte mRNAs 2,5. GEV Zielgene in Ausdruck&gt; 2-fach innerhalb von 2,5 min 2,6 (gemessen mit Microarrays) erhöht, was zeigt, dass es &lt;2,5 min für die chimären Aktivator in den Zellkern transloziert, binden DNA und aktivieren Transkription. Während mehrere andere Online-Schalter sind in der Hefe, die verschiedene kleine Moleküle oder Medikamente (einschließlich der klassischen Doxycyclin-basierte Switches von Escherichia coli 7,8 und ein Indigo-basierte Schalter 9 von Arabidopsis thaliana), keiner hat die Geschwindigkeit erreicht, nutzen angewandt wurde, Spezifität oder Dichtheit der Regelung durch die Hormon-basierten Switches ausgestellt. Es ist erwähnenswert tHut schnelle off-Schalter sind auch in Hefe entwickelt, und in der Regel durch Fusion eines Gens auf eine Protease oder Ubiquitin-Ligase-Zielsequenz 2,10,11,12 arbeiten. Die Fähigkeit, schnell zu entfernen eines Zielproteins aus der Zelle erleichtert die Untersuchung essentieller Gene sowie Gene, die anfällig für genetische Ausblendung bei 10 gelöscht. Die in diesem Protokoll beschriebenen Verfahren sind für den Aufbau und Charakterisierung von synthetischen on-Schalter in Hefe. Zuerst wird gezeigt, wie schnell erzeugen genomisch integriert Fusionsproteine ​​bestehend aus einer DNA-bindenden Domäne von Interesse, die Ligandenbindungsdomäne des humanen Östrogen-Rezeptor und VP16 (DBD-EV). Nach unserem Protokoll, wird das Fusionsprotein aus einem ACT1 Promotors exprimiert. Wir zeigen dann, wie man einen verwandten Reporter-Plasmid für die ATF erstellen und testen Sie die Funktionalität mit der Durchflusszytometrie. Obwohl wir uns vorstellen, wobei diese Reporter-Plasmide mit neuen ATFs (Abbildung 1) verwendet, so kann be als Reporter für eine native Transkriptionsaktivator als gut. Schließlich Einzelheiten zum Testen der Wirkung der ATF-Aktivierung auf das Zellwachstum in 96-Well-Platten und zum Engineering induzierbaren genomischen Allele sind vorgesehen.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

Synthetische Biologie zielt darauf ab, rational planen und bauen Kunstkreise mit gewünschten Eigenschaften quantitative als auch bieten Werkzeuge, um die Struktur von nativen Regelkreise zu befragen. In beiden Fällen kann die Fähigkeit, die Genexpression in einer schnellen und abstimmbare Mode zu programmieren, ohne Off-Target-Effekte, nützlich sein. Wir haben Hefestämme, die die ACT1 Promotor stromaufwärts einer URA3-Kassette, gefolgt von der Ligandenbindungsdomäne des humanen Östrogen-Rezeptor und VP16 aufgebaut. Durch Transformation dieses Stammes mit einer linearen PCR-Produkt, enthaltend eine DNA-Bindungsdomäne und Auswählen gegen die Anwesenheit von URA3 kann ein konstitutiv exprimiert künstlichen Transkriptionsfaktor (ATF) durch homologe Rekombination erzeugt werden. ATF auf diese Weise konstruiert werden eine einzigartige Zielgens in der Gegenwart eines Induktors aktiviert, wodurch sowohl das Off-Target-Aktivierung und nicht-physiologischen Wachstumsbedingungen mit häufig verwendeten conditi gefunden Beseitigungonal-Gen-Expressionssystemen. Ein einfaches Verfahren für die schnelle Konstruktion von GFP-Reporter-Plasmiden, die spezifisch an ein natives oder künstlichen Transkriptionsfaktors von Interesse reagieren, ist ebenfalls vorgesehen.

<html> Abbildung 5 zeigt die Induktion von GFP durch Z 3 EV, Z 4 EV oder GEV über die Zeit. Beachten Sie die Erhöhung der GFP-Produktion in Reaktion auf die ATF nonyeast enthaltenden DNA-Bindungsdomänen. Wir haben vor kurzem spekuliert, dass dies ergibt sich aus diesen Faktoren Erreichung Single-Gen-Spezifität in das Genom der Hefe ein. GEV Induktion allein führt zur Aktivierung / Repression der Hunderte von Genen, während Z 3 und Z 4 EV EV nur die Expression eines Zielgens aktiviert hinter einem synthetischen Promotor, die geeignete Bindungsstellen (5&#39;-GCGTGGGCG-3 &#39;und 5&#39;-gelegt GCGGCGGAGGAG-3 &#39;, respectively) ein. Abbildung 7 zeigt die strenge Regulierung des Systems (keine Induktor zu keiner nachweisbaren GFP) und dass alle Zellen als Antwort bekommen Induktor induziert, um die Fähigkeit der Z 3 EV an GFP in einer Reihe von induzieren β-Östradiol-Konzentrationen ist in Fig. 8 gezeigt. <html> ent &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figur 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> Fig. 1 ist. Künstliche Transkriptionsfaktoren interagieren mit Hsp90 in Abwesenheit von β-Östradiol. Wenn β-Östradiol bindet an das ATF, Hsp90 distanziert, so dass das ATF in den Zellkern einzudringen und Expression von Plasmid-Reporter. <img alt="Figur 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> Abbildung 2. Schematische Darstellung des Protokolls für Engineering-Stämme, die künstliche Transkriptionsfaktoren und Gebäude / Prüfung verwandten GFP Reporter enthalten. load/51153/51153fig3highres.jpg &quot;src =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; Abbildung 3. Die ACT1pr-URA3-EV-Sequenz in dem Stamm yMN15 an der LEU2-Locus. <img alt="Fig. 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> 4. Entwurf von PCR-Primern für die Amplifikation einer DNA-Bindungsdomäne von Interesse mit zusätzlichen Sequenzhomologie, um ein neues Fusionsprotein zu erzeugen, wenn erfolgreich in yMN15 transformiert. <img alt="Figur 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> 5. GFP-Induktion durch drei ATF-Promotor-Paare in Reaktion auf 1 uM β-Östradiol. &lt;/ P&gt; <img alt="Fig. 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> Abbildung 6. Ein MATLAB-Skript für die Verarbeitung der Durchflusszytometrie Daten. Dieses Skript wurde von angepasst <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="Fig. 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> Abbildung 7. Induktion von GFP durch Z 3 EV in Reaktion auf 0 μ M β-Estradiol und 1 uM β-Estradiol folgenden 18 Stunden der Induktion. Fluoreszenz war auch meavon Zellen ohne GFP, die strenge Regulierung des Z 3 EV-System veranschaulichen, sichergestellt ist. Diese Zahl wurde mit der Code in Abbildung 6 erzeugt. <img alt="Fig. 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> Figur 8. Die Beziehung zwischen Konzentration und Induktor Ausdruck Ausgang mit einem Hill-Koeffizienten von ca. 1 bewertet. (A) Verteilungen der GFP-Expression als Funktion der β-Estradiol-Konzentration. (B) Die mittlere Fluoreszenz der Ausschüttungen aus (A). Die Daten wurden an die Funktion G (D) = g min + (G max, G min) D n / (K + n D n), wobei D die Dosis β-Estradiol, G min und G max sind die minimalen und Höchstwerte GFP, resziehungs, n der Hill-Koeffizient, und K der β-Estradiol-Dosis, die ½ (G max + G min) ergibt. <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176"><tbody><tr><td> Oligonukleotidsequenz </td><td> Name </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD Zukunfts prüfen </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD umge prüfen </td></tr></tbody></table> Tabelle 1. Primer zur Bestätigung korrekten Fusion DBD von Interesse für den Östrogen-Rezeptor. Der Vorwärts-Primer ist homolog der ACT1-Promotor und der Reverse-Primer ist homolog zu den Östrogen-Rezeptor. Typisch für DBDs (~ 300 bp), das PCR-Produkt &lt;1,5 kb. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Oligonukleotidsequenz </td><td> Name </td></tr><tr><td> 5&#39;-ggccgc ... DBD binging Seite ... t-3 &#39; </td><td> Top-Oligo </td></tr><tr><td> 5&#39;-ctaga ... DNA-Bindungsstelle umzukehren ... gc-3 &#39; </td><td> Bottom Oligo </td></tr><tr><td> 5&#39;-gcc gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG t-3 &#39; </td><td> Top-Oligo + 6x Zif268 Bindungsstellen </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> Bottom-Oligo + 6x Zif268 Bindungsstellen </td></tr></tbody></table> Tabelle 2. S truktur von Primern für die Erstellung von dsDNA enthält Bindungsstellen von Interesse. Um die Z 3 EV-responsive Promotor zu erstellen, die Oligonukleotide Oligo Top + 6x Zif268 Bindungsstellen und Bottom-Oligo + 6x Zif268 Binding verwendet.Sequenzen für die Erstellung der korrekten DNA-Überhänge sind in Kleinbuchstaben. Die Zif268 Konsens Bindungsstelle, GCGTGGGCG, wird in der oberen Oligo unterstrichen. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagens </td><td> Menge </td></tr><tr><td> T4 Polynukleotid-Kinase-Puffer </td><td> 5 ul </td></tr><tr><td> T4 Polynukleotid-Kinase (@ 10.000 Einheiten / ml) </td><td> 1 ul </td></tr><tr><td> Top Oligo (100 uM) </td><td> 1,5 ul </td></tr><tr><td> Boden Oligo (100 uM) </td><td> 1,5 ul </td></tr><tr><td> Wasser </td><td> 41 ul </td></tr></tbody></table> Tabelle 3. Phosphorylieren und Glühen Primer in einem Thermocycler mit 50 ul der oben beschriebenen Reaktion. Es gibt zwei Thermocycler Schritte. Schritt 1: 37 ° C 30 min (Phosphorylierung), und Schritt 2: 95 ° C 30 sec (Schritt um 1 ° C alle 30 Sekunden, bis bei 4 ° C; Glühen). <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Reagens </td><td> Menge </td></tr><tr><td> XbaI </td><td> 1 ul </td></tr><tr><td> NotI-HF </td><td> 1 ul </td></tr><tr><td> Plasmid-DNA </td><td> 5 ul (1-2 ug) </td></tr><tr><td> 10x Smart-Cut-Puffer </td><td> 5 ul </td></tr><tr><td> Wasser </td><td> 38 ul </td></tr></tbody></table> Tabelle 4. Restriktionsverdau von Plasmid pMN8 mit XbaI und NotI. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> Reagens </td><td class="xl66" style="width:66pt" width="88"> Menge </td></tr><tr height="43" style="height:32.25pt"><td> T4-Ligase Buffer </td><td> 2 ul </td></tr><tr height="22" style="height:16.5pt"><td> T4 Ligase </td><td> 0,2 ul </td></tr><tr height="43" style="height:32.25pt"><td> Backbone @ 10 ng / ul </td><td> 1 ul </td></tr><tr height="106" style="height:79.5pt"><td> Bindungssequenzen @ 5x Stoffmengenkonzentration / ul </td><td> 1 ul </td></tr><tr height="22" style="height:16.5pt"><td> Wasser </td><td> 15,8 ul </td></tr></tbody></table> Tabelle 5. Ligatbindung Websites in Plasmid-DNA. <table border="0" cellpadding="0" cellspacing="0" width="176"><tbody><tr><td> Grundierung </td><td> Beschreibung </td></tr><tr><td> ~ 40 bp stromaufwärts des ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> Vorwärts-Primer zur Amplifikation KanMX-Promoter </td></tr><tr><td> 5&#39;-reverse Komplement (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> Reverse-primer zur Verstärkung KanMX-Promoter </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> Forward-Primer für die Herstellung GCN4 Promoter Swap. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> Reverse-Primer für die Herstellung GCN4 Promoter Swap. </td></tr></tbody></table> Tabelle 6. PCR verstärken KanMX-Promoter für die Herstellung titratible Allel.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Dieses Protokoll beschreibt ein experimentelles Verfahren für die schnelle Konstruktion von künstliche Transkriptionsfaktoren (ATF) mit zugehörigen GFP-Reporter und Quantifizierung des ATF Fähigkeit GFP-Expression mittels Durchflusszytometrie stimulieren.

Rapid-Synthese und Screening von Chemisch aktivierte Transkriptionsfaktoren mit GFP-basierte Reporter

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K Aufrufe.  Princeton University.  Dieses Protokoll beschreibt ein experimentelles Verfahren für die schnelle Konstruktion von künstliche Transkriptionsfaktoren (ATF) mit zugehörigen GFP-Reporter und Quantifizierung des ATF Fähigkeit GFP-Expression mittels Durchflusszytometrie stimulieren. 

Serie: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

Generation of Human CD40-aktivierten B-Zellen

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Forschung

Biologie

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescence Activated Cell Sorting von Pflanzenprotoplasten

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

High-Throughput-Screening und Biosensorik mit Fluorescent C. elegans Die Stämme

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

Überwachung des Ubiquitin-Proteasom-Aktivität in lebenden Zellen unter Verwendung eines Degron (DGN)-destabilisiert Green Fluorescent Protein (GFP)-basierte Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

Synthese von neunatomige deltaedrischen Zintl-Ionen von Germanium und deren Funktionalisierung mit organischen Gruppen

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

Chromatin Interaction Analysis gepaart mit End-Tag-Sequenzierung (Chia-PET) zur Abbildung von Chromatin-Wechselwirkungen zu verstehen und Transkriptionsregulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

Mit Cokultur zur Erkennung chemisch vermittelte Interspezies-Interaktionen

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Schnelle und effiziente Verwendung von Zebrafisch-Genotypisierung PCR mit Hochauflösende Schmelzanalyse

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Hochdurchsatz-Screening für Chemische Modulatoren der Post-transkriptionell regulierten Genen

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.