Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP-abhängigen Nucleosome Remodeling Assays Zur Messung ATP-abhängige Nukleosom-Remodeling-Aktivitäten, immun INO80 oder INO80 Subkomplexe mit ATP und einem mononucleosomal Substrat, welches eine einzelne Nukleosomen an einem Ende eines 216-bp-, 32 P-markierten DNA-Fragment enthält, angeordnet inkubiert. Die Reaktionsprodukte werden dann einer Elektrophorese in nativen Polyacrylamid-Gelen unterzogen. <ol><li> Die 32 P-markierten, &quot;601&quot;-DNA-Fragment zu erzeugen, zu verstärken, aus pGEM-3Z-601 4 a 216 bp DNA-Fragment, enthaltend eine endständige 601 Nukleosomen Positionierungssequenz unter Verwendung der Oligonukleotide 5&#39;-und 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG AATACTCAAGCTTGGATGCCTGCAG als Vorwärts und Rückwärtsprimer. <ol><li> Einrichten einer 100 ul PCR-Reaktion, wie in Tabelle 1 beschrieben. </li><li> Die PCR-Reaktionen durchzuführen in einem Thermocycler mit folgendem Programm: 1 min bei 96 ° C, followed von 45 sec bei 94 ° C, 30 sec bei 57 ° C, 60 sec bei 72 ° C für 30 Zyklen; endend mit 7 min bei 72 ° C aufweist. </li><li> Nach der PCR-Reaktion abgeschlossen ist, entfernen Sie die eingebauten Nukleotiden, indem die Reaktionsprodukte durch Nuclease-Free-Spin-Säulen zweimal. </li><li> Versuch 5 ul des gereinigten PCR-Produkts in einem 1,2% Agarose-Gel, um zu bestätigen, dass die PCR-Reaktion erzeugt das gewünschte ~ 216 bp-DNA-Fragment. </li><li> Verdünnen 5 ul des gereinigten PCR-Produkt 20-fach, und messen Sie die DNA-Konzentration mit einem UV-Spektrophotometer. Der Durchschnittsertrag ist ~ 40 ng / ul. </li><li> Messung der Radioaktivität von 1 ul des gereinigten PCR-Produkts in einem Szintillationszähler. Schätzen Sie die Markierungseffizienz durch die Berechnung der cpm / ng. Eine erfolgreiche Markierungsreaktion wird erwartet, ~ 15.000 cpm / ng von 601 DNA-Fragment erhalten. </li></ol></li><li> HeLa-Zellen übertragen Nukleosomen auf der markierten DNA-601 über eine serielle Verdünnungsmethode 5. <ol><li> Mix 2 pmol32 P-markierten 601-DNA-Fragment mit 6 ug von Hela Nukleosomen (hergestellt wie beschrieben 5) in 50 ul eines Puffers, enthaltend 1,0 M NaCl, 10 mM Tris-HCl, pH 8,0, 1 mM EDTA, 0,1 mM PMSF und 1 mM DTT und Inkubation bei 30 ° C für 30 min. </li><li> Sequentiell verdünnt das Gemisch auf 0,8 M, 0,6 M und 0,4 M NaCl durch Verdünnen mit 12,5 ul, 20,8 ul, und 41,6 ul jeweils 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 mM PMSF, und 1 mM DTT, mit einer 30-minütigen Inkubation bei 30 ° C nach jeder Verdünnung. </li><li> Weiteren Verdünnung der Mischung auf 0,2 M und 0,1 M NaCl durch Zugabe von 125 ul und 250 ul des gleichen Puffers, enthaltend 0,1% Nonidet P-40, 20% Glycerin und 200 ug / ml BSA, mit einem 30-minütigen Inkubation bei 30 ° C zwischen den beiden letzten Verdünnungen. Speichern die mononucleosome Substrat bei 4 ° C für bis zu 3 Monate. </li></ol></li><li> Führen ATP-abhängige Nukleosom Schiebe Reaktionen in einem Gesamtvolumen von 10 ul. Das REAction Komponenten sind in Tabelle 2 aufgeführt. Da die optimale NaCl-Konzentration für INO80 Nukleosom Remodeling-Aktivität ~ 50 mM NaCl (unveröffentlichte Ergebnisse), passen die Gesamtkonzentration von NaCl in jedem Reaktions bis 50 mM, unter Berücksichtigung der Menge von NaCl in geschlossenen Zubereitungen von Nukleosomen und Enzym. <ol><li> Vor Beginn der Tests, um die Einrichtung, Guss nativen Polyacrylamid-Gele (18 x 16 cm). Um eine einzelne Gel mit 5% Acrylamid vorzubereiten (Acrylamid: Bisacrylamid 37,5: 1), 0,5 x TBE (45 mM Tris Borat, 1 mM EDTA), 0,01% Ammoniumpersulfat (APS) und 0,001% N, N, N&#39;, N&#39;-Tetramethylethylendiamin (TEMED), mischen Sie die in Tabelle 3 aufgeführten Zutaten. Lassen Sie das Gel für mindestens 2 Stunden bei Raumtemperatur polymerisieren. </li><li> In der Zwischenzeit für jede Reaktion durchgeführt werden, verbinden sich in ein vorgekühltes 1,5 ml siliconisierten Mikrozentrifugenröhrchen ~ 20 nM INO80 oder INO80 Unterkomplex (hergestellt wie beschrieben 3) mit einer Menge von EB100 Puffer ( <strOng&gt; Tabelle 4) ausreichend ist, um ein Volumen von 4,75 ul zu ergeben. Sofort wieder einfrieren alle verbleibenden INO80 haltigen Fraktionen in Pulver Trockeneis oder flüssigem Stickstoff. </li><li> Einrichten einer Master-Cocktail mit dem Rest der Bestandteile, Skalieren um einen Faktor von &quot;X&quot; (X = Gesamtzahl der Reaktionen +3). Die Menge jedes Bestandteils für eine 10 ul-Reaktion benötigt wird, aufgelistet in Tabelle 5; das Rezept sollte entsprechend der Anzahl von Reaktionen durchgeführt werden skaliert werden. Gut mischen, indem Sie den Schlauch oder durch Auf-und Abpipettieren mit einer Pipetman und drehen Sie das Rohr für ein paar Sekunden in einer Tischmikrozentrifuge. </li><li> Verzichten 5,25 ul des Master-Cocktail zu jedem der Reaktionsgefäße in Schritt 1.3.2. Gut mischen durch Pipettieren von oben und unten. Starten Sie die Reaktionen, die durch ein auf 30 ° C Wärmeblock oder Wasserbad Übertragung Reaktionsröhrchen und Inkubation für 2 Stunden. </li><li> Unterdessen bereiten die &quot;Beseitigung Mix&quot; Cocktail enthält Konkurrenz-DNAund Nukleosomen, Skalieren um einen Faktor von X (X = Gesamtzahl der Reaktionen + 4). Die Menge jeder Zutat benötigt, um 1,5 ul Entfernen Mischung für einen einzigen Reaktion vorzubereiten ist in Tabelle 6; das Rezept sollte abhängig von der Anzahl von Assays durchgeführt werden skaliert werden. </li><li> Beenden Reaktionen durch Zugabe von 1,5 ul der Mischung zu entfernen. Gut mischen, Spin-down, und Inkubation bei 30 ° C für weitere 30 min. </li><li> Inzwischen Vorlauf die native Polyacrylamid-Gel in einer vertikalen Elektrophorese-Einheit bei 100 V für 30 min bei 4 ° C mit 0,5 x TBE als Laufpuffer mit einem magnetischen Rührstab in der unteren Kammer zu konstanten Pufferkreislauf aufrecht zu erhalten. </li><li> , Um die Probe zu laden, fügen 2,5 ul Ladefarbstoff enthält 3x TBE, 30% Glycerin, 0,25% Bromphenolblau, 0,25% Xylencyanol FF. Gut mischen, kurz drehen die Proben, und laden Sie auf das Gel mit Lade Tipps. </li><li> Die Elektrophorese bei 200 V für 4,5 h bei 4 ° C mit Puffer Zirkulation.</li><li> Um das Signal zu erfassen, zu übertragen, um das Gel zu einem Stapel aus zwei Blättern Filterpapier. Wickeln Sie das Filterpapier mit dem Gel auf mit klaren Plastikverpackung, und dann setzen Sie es zu einem Speicherleuchtschirm bei 4 ° C für die gewünschte Zeit. </li><li> Scannen Sie den Bildschirm mit einem Isotop Imaging-Scanner-System und mit einer geeigneten Software die Daten analysieren. </li></ol></li></ol> 2. Mononucleosome Bindungstests Um die Bindungsaffinität eines gegebenen INO80 komplex Mononukleosomen Assay, führen einem elektrophoretischen Mobility Shift Assay (EMSA) unter Verwendung der in Schritt 1.2 generiert mononucleosomal Substrat. <ol><li> Bis die Reaktion eingestellt Mischungen für Bindungsassays für Nukleosomen Umbau Assays beschrieben, aber lassen Sie die ATP und Entfernen Mix aus den Reaktionen; Inkubieren bei 30 ° C für 30 min. </li><li> Fügen 2,5 ul Beladungsfarbstoff zu jeder Reaktionsmischung und gelten für eine native Polyacrylamidgel, enthaltend 3,5% Acrylamid (Acrylamid: Bis 37,5: 1), 1% Glycerin, 0,5 × TBE, 0,01% APS und 0,001% TEMED. </li><li> Mit 0.5x TBE als Laufpuffer, führen Sie das Gel bei 200 V für 2,5 h bei 4 ° C mit Pufferkreislauf und setzen auf ein Speicherleuchtschirm. </li></ol> 3. DNA und Nukleosomen-abhängige ATPase-Assays Führen ATPase-Assays in 5 ul Reaktionsmischungen, enthaltend 20 mM Tris-HCl (pH 7,5), 60 mM NaCl, 6,6 mM MgCl 2, 0,8 mM EDTA, 0,015% Nonidet P-40, 2,5% Glycerin, 0,1 mg / ml BSA, 1 mM DTT, 0,1 mM PMSF, 2 mM ATP, 2 uCi [α- 32 P] ATP (3000 Ci / mmol). Für jedes komplexe INO80 oder die Menge des Komplexes zu prüfen INO80 bis drei Parallelreaktionen, eine mit EB100 Puffer, um DNA-oder Nukleosomen-unabhängige ATPase, ein Set bestehend messen geschlossen zirkuläre Plasmid-DNA (5000 bp, ~ 30 nM) zu messen, werden DNA- abhängige ATPase und eine mit Hela Oligonukleosomen (~ 185 nm), um Nukleosomen-abhängige ATPase messen. Richten Sie alle Reaktionen auf Eis. <ol&gt; <li> Für jede Reaktion kombinieren 10-50 nm der immun INO80 oder INO80 Subkomplexe mit einer Menge von EB100 Puffer ausreichend ist, um ein Volumen von 2,2 ul in vorgekühlte 1,5 ml geschmiert Mikrozentrifugenröhrchen geben. Sofort wieder einfrieren keine INO80 haltigen Fraktionen in Pulver Trockeneis oder flüssigem Stickstoff. </li><li> Richten Sie ein Master-Cocktail. Die Menge jedes Bestandteils für eine Reaktion benötigt, ist in Tabelle 7 aufgeführt. Maßstab das Rezept durch Skalieren um einen Faktor von 3 (X + 2) + 1, wobei X = Anzahl der INO80 Zubereitungen getestet werden. </li><li> Zur Vorbereitung &#39;Unter Cocktails &quot;, die Puffer nur, DNA oder Nukleosomen, verzichten 2,5 (X + 2) ul des Master-Cocktail in drei getrennten Röhren. Fügen 0,3 (X + 2) ul entweder EB100, geschlossene zirkuläre Plasmid-DNA (1,5 ug / ul) oder Hela Oligonukleosomen (1,5 ug / ul) und gut mischen. </li><li> Verzichten 2,8 ul der entsprechenden Sub-Cocktail auf die enzymhaltige Reaktionsgefäße bis in str gesetztEP 3.1. Sanft auf und ab pipettieren zu mischen; Einführung zu vermeiden Blasen. </li><li> Reaktionen beginnen, übertragen Sie die Reaktionsgefäße auf 30 ° C Wärmeblock. </li><li> Nach 5, 15, 30, und 60 min Inkubation, vor Ort 0,5 ul jeder Reaktionsgemisch auf ein Polyethylenimin Cellulose Dünnschicht-Chromatographie (DC) Platte (20 x 10 cm) in einer geraden Linie, die mindestens 1,5 cm von der Unterkante . Reaktionsgefäße sofort an die 30 ° C Wärmeblock so mehrere Zeitpunkte können aus einem einzigen Rohr genommen werden zurückkehren. Nach dem Spotten, trocknen die DC-Platten mit einem Föhn. </li><li> Übertragen Sie die DC-Platten auf einer Glaskammer, die genug 0,375 M Kaliumphosphat (pH 3,5), damit die unteren 0,5 cm von der DC-Platte in die Lösung eingetaucht werden. </li><li> Decken Sie die Kammer und zu entwickeln, bis die vor der Flüssigphase an die Spitze der DC-Platten erreicht. Sofort trocknen die Platten gründlich mit einem Föhn. </li><li> Setzen die getrockneten DC-Platten zu einem Storage Phosphor Screen bei RT.Scannen Sie den Bildschirm mit einem Isotop Imaging-Scanner-System und bestimmen die Menge an radioaktivem ATP und ADP-Substrat Produkt. </li><li> Um die Menge des ATP hydrolysiert berechnen, multiplizieren Sie die ATP% durch die Menge des vorhandenen ATP in der Startreaktionsmischung hydrolysiert nach der folgenden Formel: pmol ATP hydrolysiert = 10 pmol ATP in Ausgangsreaktions x [ADP / (ATP + ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

Um sicherzustellen, dass Nukleosomen Umbau-und ATPase-Aktivitäten, die wir in Tests zu beobachten, hängt von der katalytischen Aktivität des INO80 Komplexe und nicht auf kontaminierende Umbau-und / oder ATPase-Enzyme, die wir routinemßig Assay Nukleosom Umbau-und ATPase-Aktivität der katalytisch inaktiven Versionen INO80 Komplexe, gereinigt parallel mit Wildtyp-INO80 mit dem gleichen Verfahren. Eine negative Kontrollreaktion fehlt ATP sollte auch bei der Untersuchung von Nukleosomen Umbau Aktivität, um das Vorhand...

SNF2 Familie Chromatin-Remodeling Komplexe umfassen eine zentrale SNF2-ATPase-Untereinheit wie 1,2. Einige SNF2 artigen ATPasen Funktion als einzelne Untereinheit Enzyme, andere Funktion als die katalytische Untereinheit von größeren Multi-Untereinheiten-Komplexen. Aufklärung der molekularen Mechanismen, durch die jede der Untereinheiten von Chromatin-Remodeling-Komplexe beitragen, ihre Tätigkeit erfordert die Fähigkeit, biochemische Assays, die die Umbauprozess auszuführen sezieren. ATP-abhängige Nukleosom-Remodeling vom menschlichen INO80 Komplex und andere Chromatin-Remodeling-Enzyme können nach einem mehrstufigen Prozess, der mit der Bindung des Enzyms an Nukleosomen Umbau beginnt in Betracht gezogen werden, gefolgt von der Aktivierung der DNA-und / oder Nukleosom-abhängige ATPase, Translokation des Enzyms auf Umbau nukleosomalen DNA und eventuelle Neupositionierung der Nukleosomen 1,2. Das Verständnis der molekularen Details der ATP-abhängigen Chromatin-Remodeling-Prozess requires Dissektion der Umbau Reaktion in seine einzelnen Schritte des Wortes der Beiträge der einzelnen Untereinheiten des Chromatin-Remodeling-Komplexes, um jeden Schritt der Reaktion. Solche Analysen erfordern die Fähigkeit zur Analyse Nukleosomen Umbau-und andere Aktivitäten mit definierten molekularen Substrate in vitro. In einem früheren JOVE Protokoll beschrieben wir Verfahren verwendet werden, um INO80 Chromatin-Remodeling-Komplexe und Subkomplexe mit definierten Untereinheit 3 Kompositionen zu erzeugen. Hier präsentieren wir drei biochemischen Assays, die quantitative Analyse der Nukleosomen-Bindung, DNA und Nukleosomen-ATPase aktiviert, und Nukleosomen Umbau Aktivitäten mit solchen Komplexen assoziiert zu ermöglichen.

<table border="0" cellpadding="0" cellspacing="0" width="839">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Name of Reagent/Material</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;">Catalog Number</td>
			<td style="width:123px;">Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Protease Inhibitor Cocktail</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">P8340</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10x PCR reaction buffer&#160;</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Roche Taq DNA Polymerase</td>
			<td style="width:212px;">Roche Applied Science&#160;</td>
			<td style="width:147px;">11435094001</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NucAway Nuclease-free Spin Columns&#160;</td>
			<td>Ambion</td>
			<td style="width:147px;">Cat. # AM10070</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ultrapure ATP&#160;</td>
			<td>USB/Affymetrix</td>
			<td style="width:147px;">77241 25 UM</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">bovine serum albumin&#160;</td>
			<td style="width:212px;">Sigma</td>
			<td style="width:147px;">A9418&#160;</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">N,N,N&#180;,N&#180;-tetramethylethylenediamine (TEMED)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17919</td>
			<td style="width:123px;">Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">40% Acrylamide/Bis 37.5:1</td>
			<td style="width:212px;">Amresco</td>
			<td style="width:147px;">0254-500ML</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sonicated salmon sperm DNAs&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">27-4565-01</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10% ammonium persulfate (APS)</td>
			<td style="width:212px;">Thermo Scientific</td>
			<td style="width:147px;">17874</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">benzonase&#160;</td>
			<td>Novagen</td>
			<td style="width:147px;">Cat. No. 70664</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">[&#945;-32P] ATP (3000 Ci/mmol)</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU003H250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">dCTP, [&#945;-32P]- 6000Ci/mmol</td>
			<td style="width:212px;">PerkinElmer</td>
			<td style="width:147px;">BLU013Z250UC</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;"></td>
			<td style="width:212px;"></td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Equipment</td>
			<td style="width:212px;">Company</td>
			<td style="width:147px;"></td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PCR thermal cycler PTC 200</td>
			<td>MJ Research</td>
			<td style="width:147px;">PTC 200</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Hoefer vertical electrophoresis unit</td>
			<td style="width:212px;">Hoefer</td>
			<td style="width:147px;">SE600X-15-1.5</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">lubricated 1.5ml microcentrifuge tubes&#160;</td>
			<td style="width:212px;">Costar</td>
			<td style="width:147px;">3207</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Storage Phosphor Screen&#160;</td>
			<td>Molecular Dynamics</td>
			<td style="width:147px;">63-0034-79</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3MM filter paper</td>
			<td>Whatman&#160;</td>
			<td style="width:147px;">28458-005</td>
			<td style="width:123px;">VWR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Typhoon PhosphorImager&#160;</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">8600</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ImageQuant software</td>
			<td>GE Healthcare</td>
			<td style="width:147px;">ver2003.02</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">TLC Glass Plates, PEI-Cellulose F</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">5725-7</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:359px;">Immobilon-FL Transfer Membrane 7 x 8.4</td>
			<td style="width:212px;">Millipore</td>
			<td style="width:147px;">IPFL07810</td>
			<td style="width:123px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:359px;">General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td>
			<td style="width:212px;">Biodex</td>
			<td style="width:147px;">Model 14C</td>
			<td style="width:123px;"></td>
		</tr>
	</tbody>
</table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

Die Zahlen zeigen repräsentative Ergebnisse von biochemischen Tests zur INO80 Aktivitäten charakterisieren, einschließlich Nukleosomen Schiebe (Abbildung 1) und Bindung (Abbildung 2)-Assays und DNA-oder Nukleosomen-abhängige ATPase-Assays (Abbildung 3). Die in Figur 1 gezeigte Experiment vergleicht die Fähigkeit von intakten Komplexen durch INO80 FLAG-Ies2 oder FLAG-INO80E gereinigt und INO80 Subkomplexe durch entweder ...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Biochemischen Assays zur Analyse von Aktivitäten von ATP-abhängigen Chromatin-Remodeling-Enzyme

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Research

JoVE Journal

Biology

14.7K Aufrufe.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Serie: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

A Chromatin Assay for Human Brain Tissue

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental factors that might result in epigenetic alterations of gene expression and other molecular pathology. Traditionally, however, expression studies in postmortem brain were confined to quantification of mRNA or protein. The limitations encountered in postmortem brain research   such as variabilities in autolysis time and tissue integrities   are also likely to impact any studies of higher order chromatin structures. However, the nucleosomal organization of genomic DNA   including DNA:core histone binding - appears to be largely preserved in representative samples provided by various brain banks. Therefore, it is possible to study the methylation pattern and other covalent modifications of the core histones at defined genomic loci in postmortem brain. Here, we present a simplified native chromatin immunoprecipitation (NChIP) protocol for frozen (never-fixed) human brain specimens. Starting with micrococcal nuclease digestion of brain homogenates, NChIP followed by qPCR can be completed within three days. The methodology presented here should be useful to elucidate epigenetic mechanisms of gene expression in normal and diseased human brain.

Until recently, expression studies on human brain were limited to quantification of RNA or protein. With the chromatin immunoprecipitation techniques described in this paper, it will be possible to map histone methylation and other epigenetic regulators of gene expression in postmortem brain.

A Chromatin-Assay für Human Brain Tissue

Chronic neuropsychiatric illnesses such as schizophrenia, bipolar disease and autism are thought to result from a combination of genetic and environmental ...

Forschung

Biologie

Zebrafish Brain Ventricle Injection

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved cavities within the brain that are filled with cerebrospinal fluid.  In zebrafish, after neural tube formation, the neuroepithelium undergoes a series of constrictions and folds while it fills with fluid resulting in brain ventricle formation.  In order to understand the process of ventricle formation, and the neuroepithelial shape changes that occur at the same time, we needed a way to visualize the ventricle space in comparison to the brain tissue.  However, the nature of transparent zebrafish embryos makes it difficult to differentiate the tissue from the ventricle space.  Therefore, we developed a brain ventricle injection technique where the ventricle space is filled with a fluorescent dye and imaged by brightfield and fluorescent microscopy.  The brightfield and the fluorescent images are then processed and superimposed in Photoshop.  This technique allows for visualization of the ventricle space with the fluorescent dye, in comparison to the shape of the neuroepithelium in the brightfield image.  Brain ventricle injection in zebrafish can be employed from 18 hours post fertilization through early larval stages.  We have used this technique extensively in our studies of brain ventricle formation and morphogenesis as well as in characterizing brain morphogenesis mutants (1-3).

After neural tube formation, the neuroepithelium constricts and folds while the tube fills with embryonic cerebrospinal fluid (eCSF) to form the embryonic brain ventricles. We developed this ventricle injection technique to better visualize the fluid filled space in contrast to the neuroepithelial shape in a live embryo.

Zebrafisch Gehirn Ventrikel Injection

Proper brain ventricle formation during embryonic brain development is required for normal brain function.  Brain ventricles are the highly conserved ...

Photobleaching Assays (FRAP &amp; FLIP) to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with good spatial and temporal resolution. Here we describe how to perform FRAP and FLIP assays of chromatin proteins, including H1 and HP1, in mouse embryonic stem (ES) cells. In a FRAP experiment, cells are transfected, either transiently or stably, with a protein of interest fused with the green fluorescent protein (GFP) or derivatives thereof (YFP, CFP, Cherry, etc.). In the transfected, fluorescing cells, an intense focused laser beam bleaches a relatively small region of interest (ROI). The laser wavelength is selected according to the fluorescent protein used for fusion. The laser light irreversibly bleaches the fluorescent signal of molecules in the ROI and, immediately following bleaching, the recovery of the fluorescent signal in the bleached area - mediated by the replacement of the bleached molecules with the unbleached molecules - is monitored using time lapse imaging. The generated fluorescence recovery curves provide information on the protein's mobility. If the fluorescent molecules are immobile, no fluorescence recovery will be observed. In a complementary approach, Fluorescence Loss in Photobleaching (FLIP), the laser beam bleaches the same spot repeatedly and the signal intensity is measured elsewhere in the fluorescing cell. FLIP experiments therefore measure signal decay rather than fluorescence recovery and are useful to determine protein mobility as well as protein shuttling between cellular compartments. Transient binding is a common property of chromatin-associated proteins. Although the major fraction of each chromatin protein is bound to chromatin at any given moment at steady state, the binding is transient and most chromatin proteins have a high turnover on chromatin, with a residence time in the order of seconds. These properties are crucial for generating high plasticity in genome expression1. Photobleaching experiments are therefore particularly useful to determine chromatin plasticity using GFP-fusion versions of chromatin structural proteins, especially in ES cells, where the dynamic exchange of chromatin proteins (including heterochromatin protein 1 (HP1), linker histone H1 and core histones) is higher than in differentiated cells2,3.

Photobleaching Assays FRAP &amp; FLIP to Measure Chromatin Protein Dynamics in Living Embryonic Stem Cells

We describe photobleaching methods including Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) to monitor chromatin protein dynamics in embryonic stem (ES) cells. Chromatin protein dynamics, which is considered to be one of the means to study chromatin plasticity, is enhanced in pluripotent cells.

Photobleaching Assays (FRAP &amp; FLIP) zu Chromatin Protein Dynamics in Living embryonalen Stammzellen Measure

Fluorescence Recovery After Photobleaching (FRAP) and Fluorescence Loss In Photobleaching (FLIP) enable the study of protein dynamics in living cells with ...

Quantitative Comparison of cis-Regulatory Element (CRE) Activities in Transgenic Drosophila melanogaster

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE possesses an arrangement of binding sites for several transcription factor proteins that confer a regulatory logic specifying when, where, and at what level the regulated gene(s) is expressed. The full set of CREs within an animal genome encodes the organism&prime;s program for development1, and empirical as well as theoretical studies indicate that mutations in CREs played a prominent role in morphological evolution2-4. Moreover, human genome wide association studies indicate that genetic variation in CREs contribute substantially to phenotypic variation5,6. Thus, understanding regulatory logic and how mutations affect such logic is a central goal of genetics. 
Reporter transgenes provide a powerful method to study the in vivo function of CREs. Here a known or suspected CRE sequence is coupled to heterologous promoter and coding sequences for a reporter gene encoding an easily observable protein product. When a reporter transgene is inserted into a host organism, the CRE&prime;s activity becomes visible in the form of the encoded reporter protein. P-element mediated transgenesis in the fruit fly species Drosophila (D.) melanogaster7 has been used for decades to introduce reporter transgenes into this model organism, though the genomic placement of transgenes is random. Hence, reporter gene activity is strongly influenced by the local chromatin and gene environment, limiting CRE comparisons to being qualitative. In recent years, the phiC31 based integration system was adapted for use in D. melanogaster to insert transgenes into specific genome landing sites8-10. This capability has made the quantitative measurement of gene and, relevant here, CRE activity11-13 feasible. The production of transgenic fruit flies can be outsourced, including phiC31-based integration, eliminating the need to purchase expensive equipment and/or have proficiency at specialized transgene injection protocols. 
Here, we present a general protocol to quantitatively evaluate a CRE&prime;s activity, and show how this approach can be used to measure the effects of an introduced mutation on a CRE&prime;s activity and to compare the activities of orthologous CREs. Although the examples given are for a CRE active during fruit fly metamorphosis, the approach can be applied to other developmental stages, fruit fly species, or model organisms. Ultimately, a more widespread use of this approach to study CREs should advance an understanding of regulatory logic and how logic can vary and evolve.

Quantitative Comparison of cis-Regulatory Element CRE Activities in Transgenic Drosophila melanogaster

Phenotypic variation for traits can result from mutations in cis-regulatory element (CRE) sequences that control gene expression patterns. Methods derived for use in Drosophila melanogaster can quantitatively compare the levels of spatial and temporal patterns of gene expression mediated by modified or naturally occurring CRE variants.

Quantitativen Vergleich der Cis-Regulatory Element (CRE) Aktivitäten in transgenen Drosophila melanogaster</em

Gene expression patterns are specified by cis-regulatory element (CRE) sequences, which are also called enhancers or cis-regulatory modules. A typical CRE ...

Blood Collection for Biochemical Analysis in Adult Zebrafish

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of molecular events and therapeutic strategies as well as for evaluating the physiological mechanisms of some pathologies1. 
There are relatively few publications related to adult zebrafish physiology of organs and systems2, which may lead researchers to infer that the basic techniques needed to allow the exploration of zebrafish systems are lacking3. Hematologic biochemical values of zebrafish were first reported in 2003 by Murtha and colleagues4 who employed a blood collection technique first described by Jagadeeswaran and colleagues in 1999. Briefly, blood was collected via a micropipette tip through a lateral incision, approximately 0.3 cm in length, in the region of the dorsal aorta5. Because of the minute dimensions involved, this is a high-precision technique requiring a highly skilled practitioner. The same technique was used by the same group in another publication in that same year6. In 2010, Eames and colleagues assessed whole blood glucose levels in zebrafish7. They gained access to the blood by performing decapitations with scissors and then inserting a heparinized microcapillary collection tube into the pectoral articulation. They mention difficulties with hemolysis that were solved with an appropriate storage temperature based on the work Kilpatrick et al.8. When attempting to use Jagadeeswaran's technique in our laboratory, we found that it was difficult to make the incision in precisely the right place as not to allow a significant amount of blood to be lost before collection could be started. 
Recently, Gupta et al.9 described how to dissect adult zebrafish organs, Kinkle et al.10 described how to perform intraperitoneal injections, and Pugach et al.11 described how to perform retro-orbital injections. However, more work is needed to more fully explore basic techniques for research in zebrafish.
The small size of zebrafish presents challenges for researchers using it as an experimental model. Furthermore, given this smallness of scale, it is important that simple techniques are developed to enable researchers to explore the advantages of the zebrafish model.

This paper presents a technique for collection of blood from the dorsal aorta of Zebrafish. It also provides instructions for obtaining serum for use in biochemical analyses, such as tests for determining cholesterol and triglyceride levels.

Blutentnahme für Biochemische Untersuchungen an adulten Zebrafisch

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of ...

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

The nematode C. elegans has emerged as an important model for the study of conserved genetic pathways regulating fat metabolism as it relates to human obesity and its associated pathologies. Several previous methodologies developed for the visualization of C. elegans triglyceride-rich fat stores have proven to be erroneous, highlighting cellular compartments other than lipid droplets. Other methods require specialized equipment, are time-consuming, or yield inconsistent results. We introduce a rapid, reproducible, fixative-based Nile red staining method for the accurate and rapid detection of neutral lipid droplets in C. elegans. A short fixation step in 40% isopropanol makes animals completely permeable to Nile red, which is then used to stain animals. Spectral properties of this lipophilic dye allow it to strongly and selectively fluoresce in the yellow-green spectrum only when in a lipid-rich environment, but not in more polar environments. Thus, lipid droplets can be visualized on a fluorescent microscope equipped with simple GFP imaging capability after only a brief Nile red staining step in isopropanol. The speed, affordability, and reproducibility of this protocol make it ideally suited for high throughput screens. We also demonstrate a paired method for the biochemical determination of triglycerides and phospholipids using gas chromatography mass-spectrometry. This more rigorous protocol should be used as confirmation of results obtained from the Nile red microscopic lipid determination. We anticipate that these techniques will become new standards in the field of C. elegans metabolic research.

Biochemical and High Throughput Microscopic Assessment of Fat Mass in Caenorhabditis Elegans

We present robust biochemical and microscopic methods for studying Caenorhabditis elegans lipid stores. A rapid, simple, fixing-staining procedure for fluorescent lipid droplet imaging leverages the spectral properties of the lipophilic dye Nile red. We then present biochemical measurement of triglycerides and phospholipids using solid phase extraction and gas chromatography-mass spectrometry.

Biochemische und High Throughput Mikroskopische Beurteilung der Fettmasse in<em&gt; Caenorhabditis elegans</em

The nematode C. elegans has emerged as an important  model for the study of conserved genetic pathways regulating fat metabolism as  it relates to human ...

Biochemical Titration of Glycogen In vitro

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular metabolism. Many methods to detect glycogen already exist but only a few are quantitative. We describe here a method using the Abcam Glycogen assay kit, which is based on specific degradation of glycogen to glucose by glucoamylase. Glucose is then specifically oxidized to a product that reacts with the OxiRed probe to produce fluorescence. Titration is accurate, sensitive and can be achieved on cell extracts or tissue sections. However, in contrast to other techniques, it does not give information about the distribution of glycogen in the cell. As an example of this technique, we describe here the titration of glycogen in two cell lines, Chinese hamster lung fibroblast CCL39 and human colon carcinoma LS174, incubated in normoxia (21% O2) versus hypoxia (1% O2). We hypothesized that hypoxia is a signal that prepares cells to synthesize and store glycogen in order to survive1.

Biochemical Titration of Glycogen In vitro

We describe here an accurate, reproducible and convenient biochemical method for titration of glycogen in vitro. This technique uses the Abcam Glycogen assay kit and is based on successive hydrolysis of glycogen to glucose and glucose titration by fluorescence.

Biochemische Titration von Glykogen<em&gt; In-vitro-</em

Glycogen is the main energetic polymer of glucose in vertebrate animals and plays a crucial role in whole body metabolism as well as in cellular ...

Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex&#39;s chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes.

This protocol describes a procedure for generating and purifying wild type and mutant versions of the human INO80 chromatin remodeling complex. Epitope tagged versions of INO80 subunits are stably expressed in HEK293 cells, and complete complexes and complexes lacking specific sets of subunits are purified by immunoaffinity chromatography.

Generation und Reinigung von Menschen INO80 Chromatin Remodeling Komplexe und Subkomplexe

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 ...

Isolation of Specific Genomic Regions and Identification of Associated Molecules by enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. To enable the non-biased identification of molecules interacting with a specific genomic region of interest, we recently developed the engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) technique. Here, we describe how to use enChIP to isolate specific genomic regions and identify the associated proteins and RNAs. First, a genomic region of interest is tagged with a transcription activator-like (TAL) protein or a clustered regularly interspaced short palindromic repeats (CRISPR) complex consisting of a catalytically inactive form of Cas9 and a guide RNA. Subsequently, the chromatin is crosslinked and fragmented by sonication. The tagged locus is then immunoprecipitated and the crosslinking is reversed. Finally, the proteins or RNAs that are associated with the isolated chromatin are subjected to mass spectrometric or RNA sequencing analyses, respectively. This approach allows the successful identification of proteins and RNAs associated with a genomic region of interest.

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the functions of these regions. This protocol describes procedures to perform engineered DNA-binding molecule-mediated chromatin imunoprecipitation (enChIP) for identification of proteins and RNAs associated with a specific genomic region.

Isolierung von spezifischen genomischen Regionen und Identifizierung von assoziierten Moleküle durch enChIP

The identification of molecules associated with specific genomic regions of interest is required to understand the mechanisms of regulation of the ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplification, Next-Generation-Sequenzierung und genomischer DNA Mapping von Retrovirale Integration Seiten

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...