Name: biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes
Uploaded: 2014-10-25T14:00:00.000+00:00
Duration: 10 min 14 s
Description: Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Work in the authors' laboratory is supported by a grant from the National Institute of General Medical Sciences (GM41628) and by a grant to the Stowers Institute for Medical Research from the Helen Nelson Medical Research Fund at the Greater Kansas City Community Foundation.

1. ATP-abhängigen Nucleosome Remodeling Assays Zur Messung ATP-abhängige Nukleosom-Remodeling-Aktivitäten, immun INO80 oder INO80 Subkomplexe mit ATP und einem mononucleosomal Substrat, welches eine einzelne Nukleosomen an einem Ende eines 216-bp-, 32 P-markierten DNA-Fragment enthält, angeordnet inkubiert. Die Reaktionsprodukte werden dann einer Elektrophorese in nativen Polyacrylamid-Gelen unterzogen. <ol><li> Die 32 P-markierten, &quot;601&quot;-DNA-Fragment zu erzeugen, zu verstärken, aus pGEM-3Z-601 4 a 216 bp DNA-Fragment, enthaltend eine endständige 601 Nukleosomen Positionierungssequenz unter Verwendung der Oligonukleotide 5&#39;-und 5&#39;-ACAGGATGTATATATCTGACACGTGCCTGG AATACTCAAGCTTGGATGCCTGCAG als Vorwärts und Rückwärtsprimer. <ol><li> Einrichten einer 100 ul PCR-Reaktion, wie in Tabelle 1 beschrieben. </li><li> Die PCR-Reaktionen durchzuführen in einem Thermocycler mit folgendem Programm: 1 min bei 96 ° C, followed von 45 sec bei 94 ° C, 30 sec bei 57 ° C, 60 sec bei 72 ° C für 30 Zyklen; endend mit 7 min bei 72 ° C aufweist. </li><li> Nach der PCR-Reaktion abgeschlossen ist, entfernen Sie die eingebauten Nukleotiden, indem die Reaktionsprodukte durch Nuclease-Free-Spin-Säulen zweimal. </li><li> Versuch 5 ul des gereinigten PCR-Produkts in einem 1,2% Agarose-Gel, um zu bestätigen, dass die PCR-Reaktion erzeugt das gewünschte ~ 216 bp-DNA-Fragment. </li><li> Verdünnen 5 ul des gereinigten PCR-Produkt 20-fach, und messen Sie die DNA-Konzentration mit einem UV-Spektrophotometer. Der Durchschnittsertrag ist ~ 40 ng / ul. </li><li> Messung der Radioaktivität von 1 ul des gereinigten PCR-Produkts in einem Szintillationszähler. Schätzen Sie die Markierungseffizienz durch die Berechnung der cpm / ng. Eine erfolgreiche Markierungsreaktion wird erwartet, ~ 15.000 cpm / ng von 601 DNA-Fragment erhalten. </li></ol></li><li> HeLa-Zellen übertragen Nukleosomen auf der markierten DNA-601 über eine serielle Verdünnungsmethode 5. <ol><li> Mix 2 pmol32 P-markierten 601-DNA-Fragment mit 6 ug von Hela Nukleosomen (hergestellt wie beschrieben 5) in 50 ul eines Puffers, enthaltend 1,0 M NaCl, 10 mM Tris-HCl, pH 8,0, 1 mM EDTA, 0,1 mM PMSF und 1 mM DTT und Inkubation bei 30 ° C für 30 min. </li><li> Sequentiell verdünnt das Gemisch auf 0,8 M, 0,6 M und 0,4 M NaCl durch Verdünnen mit 12,5 ul, 20,8 ul, und 41,6 ul jeweils 10 mM Tris-HCl (pH 8,0), 1 mM EDTA, 0,1 mM PMSF, und 1 mM DTT, mit einer 30-minütigen Inkubation bei 30 ° C nach jeder Verdünnung. </li><li> Weiteren Verdünnung der Mischung auf 0,2 M und 0,1 M NaCl durch Zugabe von 125 ul und 250 ul des gleichen Puffers, enthaltend 0,1% Nonidet P-40, 20% Glycerin und 200 ug / ml BSA, mit einem 30-minütigen Inkubation bei 30 ° C zwischen den beiden letzten Verdünnungen. Speichern die mononucleosome Substrat bei 4 ° C für bis zu 3 Monate. </li></ol></li><li> Führen ATP-abhängige Nukleosom Schiebe Reaktionen in einem Gesamtvolumen von 10 ul. Das REAction Komponenten sind in Tabelle 2 aufgeführt. Da die optimale NaCl-Konzentration für INO80 Nukleosom Remodeling-Aktivität ~ 50 mM NaCl (unveröffentlichte Ergebnisse), passen die Gesamtkonzentration von NaCl in jedem Reaktions bis 50 mM, unter Berücksichtigung der Menge von NaCl in geschlossenen Zubereitungen von Nukleosomen und Enzym. <ol><li> Vor Beginn der Tests, um die Einrichtung, Guss nativen Polyacrylamid-Gele (18 x 16 cm). Um eine einzelne Gel mit 5% Acrylamid vorzubereiten (Acrylamid: Bisacrylamid 37,5: 1), 0,5 x TBE (45 mM Tris Borat, 1 mM EDTA), 0,01% Ammoniumpersulfat (APS) und 0,001% N, N, N&#39;, N&#39;-Tetramethylethylendiamin (TEMED), mischen Sie die in Tabelle 3 aufgeführten Zutaten. Lassen Sie das Gel für mindestens 2 Stunden bei Raumtemperatur polymerisieren. </li><li> In der Zwischenzeit für jede Reaktion durchgeführt werden, verbinden sich in ein vorgekühltes 1,5 ml siliconisierten Mikrozentrifugenröhrchen ~ 20 nM INO80 oder INO80 Unterkomplex (hergestellt wie beschrieben 3) mit einer Menge von EB100 Puffer ( <strOng&gt; Tabelle 4) ausreichend ist, um ein Volumen von 4,75 ul zu ergeben. Sofort wieder einfrieren alle verbleibenden INO80 haltigen Fraktionen in Pulver Trockeneis oder flüssigem Stickstoff. </li><li> Einrichten einer Master-Cocktail mit dem Rest der Bestandteile, Skalieren um einen Faktor von &quot;X&quot; (X = Gesamtzahl der Reaktionen +3). Die Menge jedes Bestandteils für eine 10 ul-Reaktion benötigt wird, aufgelistet in Tabelle 5; das Rezept sollte entsprechend der Anzahl von Reaktionen durchgeführt werden skaliert werden. Gut mischen, indem Sie den Schlauch oder durch Auf-und Abpipettieren mit einer Pipetman und drehen Sie das Rohr für ein paar Sekunden in einer Tischmikrozentrifuge. </li><li> Verzichten 5,25 ul des Master-Cocktail zu jedem der Reaktionsgefäße in Schritt 1.3.2. Gut mischen durch Pipettieren von oben und unten. Starten Sie die Reaktionen, die durch ein auf 30 ° C Wärmeblock oder Wasserbad Übertragung Reaktionsröhrchen und Inkubation für 2 Stunden. </li><li> Unterdessen bereiten die &quot;Beseitigung Mix&quot; Cocktail enthält Konkurrenz-DNAund Nukleosomen, Skalieren um einen Faktor von X (X = Gesamtzahl der Reaktionen + 4). Die Menge jeder Zutat benötigt, um 1,5 ul Entfernen Mischung für einen einzigen Reaktion vorzubereiten ist in Tabelle 6; das Rezept sollte abhängig von der Anzahl von Assays durchgeführt werden skaliert werden. </li><li> Beenden Reaktionen durch Zugabe von 1,5 ul der Mischung zu entfernen. Gut mischen, Spin-down, und Inkubation bei 30 ° C für weitere 30 min. </li><li> Inzwischen Vorlauf die native Polyacrylamid-Gel in einer vertikalen Elektrophorese-Einheit bei 100 V für 30 min bei 4 ° C mit 0,5 x TBE als Laufpuffer mit einem magnetischen Rührstab in der unteren Kammer zu konstanten Pufferkreislauf aufrecht zu erhalten. </li><li> , Um die Probe zu laden, fügen 2,5 ul Ladefarbstoff enthält 3x TBE, 30% Glycerin, 0,25% Bromphenolblau, 0,25% Xylencyanol FF. Gut mischen, kurz drehen die Proben, und laden Sie auf das Gel mit Lade Tipps. </li><li> Die Elektrophorese bei 200 V für 4,5 h bei 4 ° C mit Puffer Zirkulation.</li><li> Um das Signal zu erfassen, zu übertragen, um das Gel zu einem Stapel aus zwei Blättern Filterpapier. Wickeln Sie das Filterpapier mit dem Gel auf mit klaren Plastikverpackung, und dann setzen Sie es zu einem Speicherleuchtschirm bei 4 ° C für die gewünschte Zeit. </li><li> Scannen Sie den Bildschirm mit einem Isotop Imaging-Scanner-System und mit einer geeigneten Software die Daten analysieren. </li></ol></li></ol> 2. Mononucleosome Bindungstests Um die Bindungsaffinität eines gegebenen INO80 komplex Mononukleosomen Assay, führen einem elektrophoretischen Mobility Shift Assay (EMSA) unter Verwendung der in Schritt 1.2 generiert mononucleosomal Substrat. <ol><li> Bis die Reaktion eingestellt Mischungen für Bindungsassays für Nukleosomen Umbau Assays beschrieben, aber lassen Sie die ATP und Entfernen Mix aus den Reaktionen; Inkubieren bei 30 ° C für 30 min. </li><li> Fügen 2,5 ul Beladungsfarbstoff zu jeder Reaktionsmischung und gelten für eine native Polyacrylamidgel, enthaltend 3,5% Acrylamid (Acrylamid: Bis 37,5: 1), 1% Glycerin, 0,5 × TBE, 0,01% APS und 0,001% TEMED. </li><li> Mit 0.5x TBE als Laufpuffer, führen Sie das Gel bei 200 V für 2,5 h bei 4 ° C mit Pufferkreislauf und setzen auf ein Speicherleuchtschirm. </li></ol> 3. DNA und Nukleosomen-abhängige ATPase-Assays Führen ATPase-Assays in 5 ul Reaktionsmischungen, enthaltend 20 mM Tris-HCl (pH 7,5), 60 mM NaCl, 6,6 mM MgCl 2, 0,8 mM EDTA, 0,015% Nonidet P-40, 2,5% Glycerin, 0,1 mg / ml BSA, 1 mM DTT, 0,1 mM PMSF, 2 mM ATP, 2 uCi [α- 32 P] ATP (3000 Ci / mmol). Für jedes komplexe INO80 oder die Menge des Komplexes zu prüfen INO80 bis drei Parallelreaktionen, eine mit EB100 Puffer, um DNA-oder Nukleosomen-unabhängige ATPase, ein Set bestehend messen geschlossen zirkuläre Plasmid-DNA (5000 bp, ~ 30 nM) zu messen, werden DNA- abhängige ATPase und eine mit Hela Oligonukleosomen (~ 185 nm), um Nukleosomen-abhängige ATPase messen. Richten Sie alle Reaktionen auf Eis. <ol&gt; <li> Für jede Reaktion kombinieren 10-50 nm der immun INO80 oder INO80 Subkomplexe mit einer Menge von EB100 Puffer ausreichend ist, um ein Volumen von 2,2 ul in vorgekühlte 1,5 ml geschmiert Mikrozentrifugenröhrchen geben. Sofort wieder einfrieren keine INO80 haltigen Fraktionen in Pulver Trockeneis oder flüssigem Stickstoff. </li><li> Richten Sie ein Master-Cocktail. Die Menge jedes Bestandteils für eine Reaktion benötigt, ist in Tabelle 7 aufgeführt. Maßstab das Rezept durch Skalieren um einen Faktor von 3 (X + 2) + 1, wobei X = Anzahl der INO80 Zubereitungen getestet werden. </li><li> Zur Vorbereitung &#39;Unter Cocktails &quot;, die Puffer nur, DNA oder Nukleosomen, verzichten 2,5 (X + 2) ul des Master-Cocktail in drei getrennten Röhren. Fügen 0,3 (X + 2) ul entweder EB100, geschlossene zirkuläre Plasmid-DNA (1,5 ug / ul) oder Hela Oligonukleosomen (1,5 ug / ul) und gut mischen. </li><li> Verzichten 2,8 ul der entsprechenden Sub-Cocktail auf die enzymhaltige Reaktionsgefäße bis in str gesetztEP 3.1. Sanft auf und ab pipettieren zu mischen; Einführung zu vermeiden Blasen. </li><li> Reaktionen beginnen, übertragen Sie die Reaktionsgefäße auf 30 ° C Wärmeblock. </li><li> Nach 5, 15, 30, und 60 min Inkubation, vor Ort 0,5 ul jeder Reaktionsgemisch auf ein Polyethylenimin Cellulose Dünnschicht-Chromatographie (DC) Platte (20 x 10 cm) in einer geraden Linie, die mindestens 1,5 cm von der Unterkante . Reaktionsgefäße sofort an die 30 ° C Wärmeblock so mehrere Zeitpunkte können aus einem einzigen Rohr genommen werden zurückkehren. Nach dem Spotten, trocknen die DC-Platten mit einem Föhn. </li><li> Übertragen Sie die DC-Platten auf einer Glaskammer, die genug 0,375 M Kaliumphosphat (pH 3,5), damit die unteren 0,5 cm von der DC-Platte in die Lösung eingetaucht werden. </li><li> Decken Sie die Kammer und zu entwickeln, bis die vor der Flüssigphase an die Spitze der DC-Platten erreicht. Sofort trocknen die Platten gründlich mit einem Föhn. </li><li> Setzen die getrockneten DC-Platten zu einem Storage Phosphor Screen bei RT.Scannen Sie den Bildschirm mit einem Isotop Imaging-Scanner-System und bestimmen die Menge an radioaktivem ATP und ADP-Substrat Produkt. </li><li> Um die Menge des ATP hydrolysiert berechnen, multiplizieren Sie die ATP% durch die Menge des vorhandenen ATP in der Startreaktionsmischung hydrolysiert nach der folgenden Formel: pmol ATP hydrolysiert = 10 pmol ATP in Ausgangsreaktions x [ADP / (ATP + ADP)] </li></ol>

<ol>
	<li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+chromatin+remodeling+complexes.">The biology of chromatin remodeling complexes.</a> Annual Review of Biochemistry. 78, 273-304 (2009).</li><li>Narlikar, G. J., Sundaramoorthy, R., Owen-Hughes, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+and+functions+of+ATP-dependent+chromatin-remodeling+enzymes.">Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes.</a> Cell. 154 (3), 490-503 (2013).</li><li>Chen, L., Ooi, S. K., Conaway, J. W., Conaway, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+purification+of+human+INO80+chromatin+remodeling+complexes+and+subcomplexes.">Generation and purification of human INO80 chromatin remodeling complexes and subcomplexes.</a> , (2013).</li><li>Lowary, P. T., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+DNA+sequence+rules+for+high+affinity+binding+to+histone+octamer+and+sequence-directed+nucleosome+positioning.">New DNA sequence rules for high affinity binding to histone octamer and sequence-directed nucleosome positioning.</a> J. Mol. Biol. 276 (1), (1006).</li><li>Owen-Hughes, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+nucleosome+disruption+by+ATP-driven+chromatin+remodeling+complexes.">Analysis of nucleosome disruption by ATP-driven chromatin remodeling complexes.</a> Methods Mol. Biol. 119, 319-331 (1999).</li><li>Udugama, M., Sabri, A., Bartholomew, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INO80+ATP-dependent+chromatin+remodeling+complex+is+a+nucleosome+spacing+factor.">The INO80 ATP-dependent chromatin remodeling complex is a nucleosome spacing factor.</a> Mol. Cell Biol. 31 (4), 662-673 (2011).</li><li>Jin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mammalian+chromatin+remodeling+complex+with+similarities+to+the+yeast+INO80+complex.">A mammalian chromatin remodeling complex with similarities to the yeast INO80 complex.</a> Journal of Biological Chemistry. 280 (50), 41207-41212 (1074).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organization+of+the+human+INO80+chromatin+remodeling+complex:+an+evolutionarily+conserved+core+complex+catalyzes+ATP-dependent+nucleosome+remodeling.">Subunit organization of the human INO80 chromatin remodeling complex: an evolutionarily conserved core complex catalyzes ATP-dependent nucleosome remodeling.</a> Journal of Biological Chemistry. 286 (13), 11283-11289 (2011).</li><li>Hamiche, A., Sandaltzopoulos, R., Gdula, D. A., Wu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATP-dependent+histone+octamer+sliding+mediated+by+the+chromatin+remodeling+complex+NURF.">ATP-dependent histone octamer sliding mediated by the chromatin remodeling complex NURF.</a> Cell. 97 (7), 833-842 (1999).</li><li>Polach, K. J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Restriction+enzymes+as+probes+of+nucleosome+stability+and+dynamics.">Restriction enzymes as probes of nucleosome stability and dynamics.</a> Methods Enzymol. 304, 278-298 (1999).</li><li>Anderson, J. D., Thastrom, A., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+of+proteins+to+buried+nucleosomal+DNA+target+sites+occurs+via+a+mechanism+that+is+distinct+from+nucleosome+translocation,+Mol.Cell+Biol.">Spontaneous access of proteins to buried nucleosomal DNA target sites occurs via a mechanism that is distinct from nucleosome translocation, Mol.Cell Biol.</a> 22 (20), 7147-7157 (2002).</li><li>Saha, A., Wittmeyer, J., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+remodeling+through+directional+DNA+translocation+from+an+internal+nucleosomal+site.">Chromatin remodeling through directional DNA translocation from an internal nucleosomal site.</a> Nature Structural and Molecular Biology. 12 (9), 747-755 (2005).</li><li>Gottschalk, A. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+directs+recruitment+and+activation+of+an+ATP-dependent+chromatin+remodeler,+Proc.Natl.Acad.Sci.U.S.A.">Poly(ADP-ribosyl)ation directs recruitment and activation of an ATP-dependent chromatin remodeler, Proc.Natl.Acad.Sci.U.S.A.</a> 106 (33), 13770-13774 (2009).</li><li>Clapier, C. R., Cairns, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+ISWI+involves+inhibitory+modules+antagonized+by+nucleosomal+epitopes.">Regulation of ISWI involves inhibitory modules antagonized by nucleosomal epitopes.</a> Nature. 492 (7428), 280-284 (2012).</li><li>Brune, M., Hunter, J. L., Corrie, J. E. T., Direct Webb, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-Time+Measurement+of+Rapid+Inorganic+Phosphate+Release+Using+a+Novel+Fluorescent+Probe+and+Its+Application+to+Actomyosin+Subfragment+1+ATPase,+Biochemistry.">Real-Time Measurement of Rapid Inorganic Phosphate Release Using a Novel Fluorescent Probe and Its Application to Actomyosin Subfragment 1 ATPase, Biochemistry.</a> 33 (27), 8262-8271 (1994).</li><li>Luk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stepwise+histone+replacement+by+SWR1+requires+dual+activation+with+histone+H2A.Z+and+canonical+nucleosome.">Stepwise histone replacement by SWR1 requires dual activation with histone H2A.Z and canonical nucleosome.</a> Cell. 143 (5), 725-736 (2010).</li></ol>

The authors declare that they have no competing financial interests.

Um sicherzustellen, dass Nukleosomen Umbau-und ATPase-Aktivitäten, die wir in Tests zu beobachten, hängt von der katalytischen Aktivität des INO80 Komplexe und nicht auf kontaminierende Umbau-und / oder ATPase-Enzyme, die wir routinemßig Assay Nukleosom Umbau-und ATPase-Aktivität der katalytisch inaktiven Versionen INO80 Komplexe, gereinigt parallel mit Wildtyp-INO80 mit dem gleichen Verfahren. Eine negative Kontrollreaktion fehlt ATP sollte auch bei der Untersuchung von Nukleosomen Umbau Aktivität, um das Vorhand...

SNF2 Familie Chromatin-Remodeling Komplexe umfassen eine zentrale SNF2-ATPase-Untereinheit wie 1,2. Einige SNF2 artigen ATPasen Funktion als einzelne Untereinheit Enzyme, andere Funktion als die katalytische Untereinheit von größeren Multi-Untereinheiten-Komplexen. Aufklärung der molekularen Mechanismen, durch die jede der Untereinheiten von Chromatin-Remodeling-Komplexe beitragen, ihre Tätigkeit erfordert die Fähigkeit, biochemische Assays, die die Umbauprozess auszuführen sezieren. ATP-abhängige Nukleosom-Remodeling vom menschlichen INO80 Komplex und andere Chromatin-Remodeling-Enzyme können nach einem mehrstufigen Prozess, der mit der Bindung des Enzyms an Nukleosomen Umbau beginnt in Betracht gezogen werden, gefolgt von der Aktivierung der DNA-und / oder Nukleosom-abhängige ATPase, Translokation des Enzyms auf Umbau nukleosomalen DNA und eventuelle Neupositionierung der Nukleosomen 1,2. Das Verständnis der molekularen Details der ATP-abhängigen Chromatin-Remodeling-Prozess requires Dissektion der Umbau Reaktion in seine einzelnen Schritte des Wortes der Beiträge der einzelnen Untereinheiten des Chromatin-Remodeling-Komplexes, um jeden Schritt der Reaktion. Solche Analysen erfordern die Fähigkeit zur Analyse Nukleosomen Umbau-und andere Aktivitäten mit definierten molekularen Substrate in vitro. In einem früheren JOVE Protokoll beschrieben wir Verfahren verwendet werden, um INO80 Chromatin-Remodeling-Komplexe und Subkomplexe mit definierten Untereinheit 3 Kompositionen zu erzeugen. Hier präsentieren wir drei biochemischen Assays, die quantitative Analyse der Nukleosomen-Bindung, DNA und Nukleosomen-ATPase aktiviert, und Nukleosomen Umbau Aktivitäten mit solchen Komplexen assoziiert zu ermöglichen.

<table><tbody><tr><td>Protease Inhibitor Cocktail</td><td>Sigma</td><td>P8340</td><td></td></tr><tr><td>10x PCR reaction buffer&amp;nbsp;</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>Roche Taq DNA Polymerase</td><td>Roche Applied Science&amp;nbsp;</td><td>11435094001</td><td></td></tr><tr><td>NucAway Nuclease-free Spin Columns&amp;nbsp;</td><td>Ambion</td><td>Cat. # AM10070</td><td></td></tr><tr><td>ultrapure ATP&amp;nbsp;</td><td>USB/Affymetrix</td><td>77241 25 UM</td><td></td></tr><tr><td>bovine serum albumin&amp;nbsp;</td><td>Sigma</td><td>A9418&amp;nbsp;</td><td></td></tr><tr><td>40% Acrylamide/Bis 37.5:1</td><td>Amresco</td><td>0254-500ML</td><td></td></tr><tr><td>Sonicated salmon sperm DNAs&amp;nbsp;</td><td>GE Healthcare</td><td>27-4565-01</td><td></td></tr><tr><td>10% ammonium persulfate (APS)</td><td>Thermo Scientific</td><td>17874</td><td></td></tr><tr><td>benzonase&amp;nbsp;</td><td>Novagen</td><td>Cat. No. 70664</td><td></td></tr><tr><td>dCTP, [&amp;alpha;-&lt;sup&gt;32&lt;/sup&gt;P]- 6,000 Ci/mmol</td><td>PerkinElmer</td><td>BLU013Z250UC</td><td></td></tr><tr><td>PCR thermal cycler PTC 200</td><td>MJ Research</td><td>PTC 200</td><td></td></tr><tr><td>Hoefer vertical electrophoresis unit</td><td>Hoefer</td><td>SE600X-15-1.5</td><td></td></tr><tr><td>lubricated 1.5 ml microcentrifuge tubes&amp;nbsp;</td><td>Costar</td><td>3207</td><td></td></tr><tr><td>Storage Phosphor Screen&amp;nbsp;</td><td>Molecular Dynamics</td><td>63-0034-79</td><td></td></tr><tr><td>3MM filter paper</td><td>Whatman&amp;nbsp;</td><td>28458-005</td><td>VWR</td></tr><tr><td>Typhoon PhosphorImager&amp;nbsp;</td><td>GE Healthcare</td><td>8600</td><td></td></tr><tr><td>ImageQuant software</td><td>GE Healthcare</td><td>ver2003.02</td><td></td></tr><tr><td>TLC Glass Plates, PEI-Cellulose F</td><td>Millipore</td><td>5725-7</td><td></td></tr><tr><td>Immobilon-FL Transfer Membrane 7 x 8.4</td><td>Millipore</td><td>IPFL07810</td><td></td></tr><tr><td>General purpose survey meter with end-window or pancake GM (Geiger-Mueller) probe</td><td>Biodex</td><td>Model 14C</td><td></td></tr></tbody></table>

biochemical assays for analyzing activities of atp-dependent chromatin remodeling enzymes

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Biochemically dissecting the contributions of individual subunits of such complexes to the multi-step ATP-dependent chromatin remodeling reaction requires the use of assays that monitor the production of reaction products and measure the formation of reaction intermediates. This JOVE protocol describes assays that allow one to measure the biochemical activities of chromatin remodeling complexes or subcomplexes containing various combinations of subunits. Chromatin remodeling is measured using an ATP-dependent nucleosome sliding assay, which monitors the movement of a nucleosome on a DNA molecule using an electrophoretic mobility shift assay (EMSA)-based method. Nucleosome binding activity is measured by monitoring the formation of remodeling complex-bound mononucleosomes using a similar EMSA-based method, and DNA- or nucleosome-dependent ATPase activity is assayed using thin layer chromatography (TLC) to measure the rate of conversion of ATP to ADP and phosphate in the presence of either DNA or nucleosomes. Using these assays, one can examine the functions of subunits of a chromatin remodeling complex by comparing the activities of the complete complex to those lacking one or more subunits. The human INO80 chromatin remodeling complex is used as an example; however, the methods described here can be adapted to the study of other chromatin remodeling complexes.

Die Zahlen zeigen repräsentative Ergebnisse von biochemischen Tests zur INO80 Aktivitäten charakterisieren, einschließlich Nukleosomen Schiebe (Abbildung 1) und Bindung (Abbildung 2)-Assays und DNA-oder Nukleosomen-abhängige ATPase-Assays (Abbildung 3). Die in Figur 1 gezeigte Experiment vergleicht die Fähigkeit von intakten Komplexen durch INO80 FLAG-Ies2 oder FLAG-INO80E gereinigt und INO80 Subkomplexe durch entweder ...

Watch this Scientific Journal Video about Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes at JoVE.com

Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Biochemischen Assays zur Analyse von Aktivitäten von ATP-abhängigen Chromatin-Remodeling-Enzyme

Members of the SNF2 family of ATPases often function as components of multi-subunit chromatin remodeling complexes that regulate nucleosome dynamics and ...

biochemical-assays-for-analyzing-activities-atp-dependent-chromatin

Research

JoVE Journal

Biology

14.7K Aufrufe.  Stowers Institute for Medical Research. Here we describe biochemical assays that can be used to characterize ATP-dependent chromatin remodeling enzymes for their abilities to 1) catalyze ATP-dependent nucleosome sliding, 2) engage with nucleosome substrates, and 3) hydrolyze ATP in a nucleosome- or DNA-dependent manner.

Serie: Biochemical Assays for Analyzing Activities of ATP-dependent Chromatin Remodeling Enzymes

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Sequentielle Salz Extraktionen für die Analyse von Bulk-Chromatin bindenden Eigenschaften von Chromatin komplexe ändern

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Forschung

Genetik

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Echtzeit-Analyse des Transkriptionsfaktors verbindlich, Transkription, Übersetzung und Umsatz, globale Ereignisse während der zellulären Aktivierung anzuzeigen

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

In Vitro Ubiquitination and Deubiquitination Assays of Nucleosomal Histones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination of chromatin function and DNA-associated processes. This modification involves a sequential action of several enzymes including E1 ubiquitin-activating, E2 ubiquitin-conjugating and E3 ubiquitin-ligase and is reversed by deubiquitinases (DUBs). Ubiquitination induces degradation of proteins or alteration of protein function including modulation of enzymatic activity, protein-protein interaction and subcellular localization. A critical step in demonstrating protein ubiquitination or deubiquitination is to perform in vitro reactions with purified components. Effective ubiquitination and deubiquitination reactions could be greatly impacted by the different components used, enzyme co-factors, buffer conditions, and the nature of the substrate.&#160; Here, we provide step-by-step protocols for conducting ubiquitination and deubiquitination reactions. We illustrate these reactions using minimal components of the mouse Polycomb Repressive Complex 1 (PRC1), BMI1, and RING1B, an E3 ubiquitin ligase that monoubiquitinates histone H2A on lysine 119. Deubiquitination of nucleosomal H2A is performed using a minimal Polycomb Repressive Deubiquitinase (PR-DUB) complex formed by the human deubiquitinase BAP1 and the DEUBiquitinase ADaptor (DEUBAD) domain of its co-factor ASXL2. These ubiquitination/deubiquitination assays can be conducted in the context of either recombinant nucleosomes reconstituted with bacteria-purified proteins or native nucleosomes purified from mammalian cells. We highlight the intricacies that can have a significant impact on these reactions and we propose that the general principles of these protocols can be swiftly adapted to other E3 ubiquitin ligases and deubiquitinases.

Ubiquitination is a post-translational modification that plays important roles in cellular processes and is tightly coordinated by deubiquitination. Defects in both reactions underlie human pathologies. We provide protocols for conducting ubiquitination and deubiquitination reaction in vitro using purified components.

In Vitro Ubiquitination und Deubiquitination Assays von Nucleleosomalhistones

Ubiquitination is a post-translational modification that plays important roles in various signaling pathways and is notably involved in the coordination ...

Biochemie

Assays for Validating Histone Acetyltransferase Inhibitors

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene expression. KATs, such as CBP/p300, are under intense investigation as therapeutic targets due to their critical role in tumorigenesis of diverse cancers. The development of novel small molecule inhibitors targeting the histone acetyltransferase (HAT) function of KATs is challenging and requires robust assays that can validate the specificity and potency of potential inhibitors.
This article outlines a pipeline of three methods that provide rigorous in vitro validation for novel HAT inhibitors (HATi). These methods include a test tube HAT assay, Chromatin Hyperacetylation Inhibition (ChHAI) assay, and Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR). In the HAT assay, recombinant HATs are incubated with histones in a test tube reaction, allowing for acetylation of specific lysine residues on the histone tails. This reaction can be blocked by a HATi and the relative levels of site-specific histone acetylation can be measured via immunoblotting. Inhibitors identified in the HAT assay need to be confirmed in the cellular environment.
The ChHAI assay uses immunoblotting to screen for novel HATi that attenuate the robust hyperacetylation of histones induced by a histone deacetylase inhibitor (HDACi). The addition of an HDACi is helpful because basal levels of histone acetylation can be difficult to detect via immunoblotting.
The HAT and ChHAI assays measure global changes in histone acetylation, but do not provide information regarding acetylation at specific genomic regions. Therefore, ChIP-qPCR is used to investigate the effects of HATi on histone acetylation levels at gene regulatory elements. This is accomplished through selective immunoprecipitation of histone-DNA complexes and analysis of the purified DNA through qPCR. Together, these three assays allow for the careful validation of the specificity, potency, and mechanism of action of novel HATi.

Inhibitors of histone acetyltransferases (HATs, also known as lysine acetyltransferases), such as CBP/p300, are potential therapeutics for treating cancer. However, rigorous methods for validating these inhibitors are needed. Three in vitro methods for validation include HAT assays with recombinant acetyltransferases, immunoblotting for histone acetylation in cell culture, and ChIP-qPCR.

Assays zur Validierung von Histon-Acetyltransferase-Inhibitoren

Lysine acetyltransferases (KATs) catalyze acetylation of lysine residues on histones and other proteins to regulate chromatin dynamics and gene ...

Krebsforschung

CD Spectroscopy to Study DNA-Protein Interactions

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent advancements in CD spectroscopy have enabled the study of DNA-protein interactions and conformational dynamics of DNA in different microenvironments in detail for a better understanding of transcriptional regulation in vivo. The area around a potential transcription zone needs to be unwound for transcription to occur. This is a complex process requiring the coordination of histone modifications, binding of the transcription factor to DNA, and other chromatin remodeling activities. Using CD spectroscopy, it is possible to study conformational changes in the promoter region caused by regulatory proteins, such as ATP-dependent chromatin remodelers, to promote transcription. The conformational changes occurring in the protein can also be monitored. In addition, queries regarding the affinity of the protein towards its target DNA and sequence specificity can be addressed by incorporating mutations in the target DNA. In short, the unique understanding of this sensitive and inexpensive method can predict changes in chromatin dynamics, thereby improving the understanding of transcriptional regulation.

The interaction of an ATP-dependent chromatin remodeler with a DNA ligand is described using CD spectroscopy. The induced conformational changes on a gene promoter analyzed by the peaks generated can be used to understand the mechanism of transcriptional regulation.

CD-Spektroskopie zur Untersuchung von DNA-Protein-Wechselwirkungen

Circular dichroism (CD) spectroscopy is a simple and convenient method to investigate the secondary structure and interactions of biomolecules. Recent ...

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting of two copies of the core histones H2A, H2B, H3, and H4, wrapped around by the DNA. The octamer is composed of two copies of an H2A/H2B dimer and a single copy of an H3/H4 tetramer. The highly charged core histones are prone to non-specific interactions with several proteins in the cellular cytoplasm and the nucleus. Histone chaperones form a diverse class of proteins that shuttle histones from the cytoplasm into the nucleus and aid their deposition onto the DNA, thus assisting the nucleosome assembly process. Some histone chaperones are specific for either H2A/H2B or H3/H4, and some function as chaperones for both. This protocol describes how in vitro laboratory techniques such as pull-down assays, analytical size-exclusion chromatography, analytical ultra-centrifugation, and histone chaperoning assay could be used in tandem to confirm whether a given protein is functional as a histone chaperone.

In Vitro Characterization of Histone Chaperones using Analytical, Pull-Down and Chaperoning Assays

This protocol describes a battery of methods that includes analytical size-exclusion chromatography to study histone chaperone oligomerization and stability, pull-down assay to unravel histone chaperone-histone interactions, AUC to analyze the stoichiometry of the protein complexes, and histone chaperoning assay to functionally characterize a putative histone chaperone in vitro.

In vitro Charakterisierung von Histon-Chaperonen mittels analytischer, Pull-Down- und Chaperoning-Assays

Histone proteins associate with DNA to form the eukaryotic chromatin. The basic unit of chromatin is a nucleosome, made up of a histone octamer consisting ...

Deciphering Molecular Mechanism of Histone Assembly by DNA Curtain Technique

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in response to environmental stimuli. These changes are essential for genomic integrity, epigenetic regulation, and DNA metabolic reactions such as replication, transcription, and repair. Chromatin assembly is crucial for chromatin dynamics and is catalyzed by histone chaperones. Despite extensive studies, the mechanisms by which histone chaperones enable chromatin assembly remains elusive. Moreover, the global features of nucleosomes organized by histone chaperones are poorly understood. To address these problems, this work describes a unique single-molecule imaging technique named DNA curtain, which facilitates the investigation of the molecular details of nucleosome assembly by histone chaperones. DNA curtain is a hybrid technique that combines lipid fluidity, microfluidics, and total internal reflection fluorescence microscopy (TIRFM) to provide a universal platform for real-time imaging of diverse protein-DNA interactions.Using DNA curtain, the histone chaperone function of Abo1, the Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase, is investigated, and the molecular mechanism underlying histone assembly of Abo1 is revealed. DNA curtain provides a unique approach for studying chromatin dynamics.

DNA curtain, a high-throughput single-molecule imaging technique, provides a platform for real-time visualization of diverse protein-DNA interactions. The present protocol utilizes the DNA curtain technique to investigate the biological role and molecular mechanism of Abo1, a Schizosaccharomyces pombe bromodomain-containing AAA+ ATPase.

Entschlüsselung des molekularen Mechanismus der Histonassemblierung mittels DNA-Vorhangtechnik

Chromatin is a higher-order structure that packages eukaryotic DNA. Chromatin undergoes dynamic alterations according to the cell cycle phase and in ...

Chromatin Immunoprecipitation (ChIP) to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited from their latent state in the cytoplasm to cell surface receptors where they are activated by phosphorylation at a single tyrosine residue1. They then dimerize and translocate to the nucleus to drive the transcription of target genes, affecting growth, differentiation, homeostasis and the immune response. Not surprisingly, given their widespread involvement in normal cell processes, dysregulation of STAT function contributes to human disease, particularly to cancers2 and autoimmune diseases3. It is well established that transcription is regulated by alterations to the chromatin template4,5. These alterations include the activities of ATP-dependent complexes, as well as covalent histone modifications and DNA methylation6. Because STAT activation of gene expression is both rapid and transient, it requires specific mechanisms for modulating the chromatin template at STAT-dependent gene loci. To define these mechanisms, we characterize the histone modifications and the enzymatic activities that generate them at gene loci that respond to STAT signaling. This protocol describes chromatin immunoprecipitation, a method that is valuable for the study of STAT signaling to chromatin in activated gene expression.

Chromatin Immunoprecipitation ChIP to Assay Dynamic Histone Modification in Activated Gene Expression in Human Cells

This protocol describes how chromatin immunoprecipitation (ChIP) is used to study the dynamic alterations to the chromatin template that regulate transcription induced by a signal transduction pathway.

Chromatin Immunopräzipitation (ChIP) zur Assay Dynamische Histonmodifikationen in Activated Gene Expression in menschlichen Zellen

In response to a variety of extracellular ligands, the STAT (signal transducer and activator of transcription) transcription factors are rapidly recruited ...

Biologie

Entwicklung eines Click-basierten Assays zum Screening der HAT1-Enzymaktivität

An Acetyl-Click Chemistry Assay to Measure Histone Acetyltransferase 1 Acetylation

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome assembly. It is required for tumor growth in various systems, making it a potential target for cancer treatment. To facilitate the identification of compounds that can inhibit HAT1 enzymatic activity, we have devised an acetyl-click assay for rapid screening. In this simple assay, we employ recombinant HAT1/Rbap46, which is purified from activated human cells. The method utilizes the acetyl-CoA analog 4-pentynoyl-CoA (4P) in a click-chemistry approach. This involves the enzymatic transfer of an alkyne handle through a HAT1-dependent acylation reaction to a biotinylated H4 N-terminal peptide. The captured peptide is then immobilized on neutravidin plates, followed by click-chemistry functionalization with biotin-azide. Subsequently, streptavidin-peroxidase recruitment is employed to oxidize amplex red, resulting in a quantitative fluorescent output. By introducing chemical inhibitors during the acylation reaction, we can quantify enzymatic inhibition based on a reduction of the fluorescence signal. Importantly, this reaction is scalable, allowing for high throughput screening of potential inhibitors for HAT1 enzymatic activity.

Autor im Rampenlicht: Entwicklung eines Acetyl-Click-Assays für das HAT1-Inhibitor-Screening

Quick and accurate chemical assays to screen for specific inhibitors are an important tool in the drug development arsenal. Here, we present a scalable acetyl-click chemistry assay to measure the inhibition of HAT1 acetylation activity.

Ein Acetyl-Click-Chemie-Assay zur Messung der Histon-Acetyltransferase-1-Acetylierung

HAT1, also known as Histone acetyltransferase 1, plays a crucial role in chromatin synthesis by stabilizing and acetylating nascent H4 before nucleosome ...

Biochemischen Assays zur Analyse von Aktivitäten von ATP-abhängigen Chromatin-Remodeling-Enzyme

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Sequentielle Salz Extraktionen für die Analyse von Bulk-Chromatin bindenden Eigenschaften von Chromatin komplexe ändern

Echtzeit-Analyse des Transkriptionsfaktors verbindlich, Transkription, Übersetzung und Umsatz, globale Ereignisse während der zellulären Aktivierung anzuzeigen

In Vitro Ubiquitination und Deubiquitination Assays von Nucleleosomalhistones

Assays zur Validierung von Histon-Acetyltransferase-Inhibitoren

CD-Spektroskopie zur Untersuchung von DNA-Protein-Wechselwirkungen

In vitro Charakterisierung von Histon-Chaperonen mittels analytischer, Pull-Down- und Chaperoning-Assays

Entschlüsselung des molekularen Mechanismus der Histonassemblierung mittels DNA-Vorhangtechnik

Chromatin Immunopräzipitation (ChIP) zur Assay Dynamische Histonmodifikationen in Activated Gene Expression in menschlichen Zellen

Ein Acetyl-Click-Chemie-Assay zur Messung der Histon-Acetyltransferase-1-Acetylierung

Ein Acetyl-Click-Chemie-Assay zur Messung der Histon-Acetyltransferase-1-Acetylierung