El trabajo en el laboratorio Buchanan-Wollaston en etapa de perfiles de tipo celular y de desarrollo específico con el apoyo del proyecto AGRON-ómicas (subvención # LSHG-CT-2006 a 037.704) en el 6 º progamme Marco de la Comisión Europea. El trabajo en el laboratorio de Gifford en el perfil de tipo celular específico está soportado por un BBSRC Nueva Investigador subvención (BB/H019502/1). Los KC274 y KC464 líneas de Arabidopsis se obtuvieron de AAR Webb (Universidad de Cambridge).

1. Generación de protoplastos <ol><li> Cosecha de material de hojas y se cortó en tiras de 1 mm de ancho (Figura 1) con una hoja de afeitar. Para las muestras que contienen más de una sola hoja hasta 15 hojas se pueden apilar fácilmente antes de cortar. </li><li> Inmediatamente transferir las tiras de hoja en un plato de 9 cm ronda de Petri que contiene 20 ml de solución A (400 mM de manitol, 20 mM de hidrato de MES, 20 mM KCl, 10 mM CaCl 2, 2 mM de MgCl 2, 0,1% de BSA y 2,5 mM β-mercaptoetanol, pH 5,7) incluyendo enzimas protoplastos (1,2% de celulosa R-10, 0,6% de celulosa RS y 0,4% macerozima R-10) y RNasa e inhibidores de la transcripción (1 x ProtectRNA y 10 ug / ml de actinomicina D); suavemente separar las tiras de hoja y vacío infiltrado de 2 × 5 min. </li><li> Place cápsula de Petri en un agitador orbital a 90 rpm a temperatura ambiente y protoplastos para 3-4 hr. <ol><li> Durante la incubación de las tiras de hoja deben estar separados el uno del otro, por el uso de unjuego de pinzas planas, en intervalos de media hora. </li></ol></li><li> Colocar un 70 micras de células colador (Fisher Scientific) en un tubo de 50 ml y suavemente, filtrar la solución a través de protoplastos. Esto eliminará las tiras de hoja, los cuales puedan ser retenidos por el tamiz mientras que permite que los protoplastos que pasar. </li><li> Lavar las tiras de hoja con una solución de 4 ml de A y suavemente filtro a través del mismo tamiz. </li><li> Transferir los protoplastos en tubos de fondo redondo y se centrifuga la solución de protoplastos a 300 xg durante 5 min para sedimentar los protoplastos. </li><li> Suavemente aspirar la mayor cantidad del sobrenadante como sea posible sin perturbar los protoplastos. </li><li> Se lavan los protoplastos con 5 ml de solución A y se centrifuga a 300 xg durante 5 min. Remover el sobrenadante </li><li> Resuspender los protoplastos en un volumen apropiado de la solución A, usando una pipeta Pasteur o una punta de corte P1000. </li></ol> 2. FACS de protoplastos de hoja </p&gt; <ol><li> Inmediatamente antes de la clasificación, se resuspenden los protoplastos utilizando una (no cortada) P1000 punta para evitar protoplastos se amontonen. </li><li> Transferir a un tubo de protoplastos de clasificación a través de un filtro de 50 micras Filcon (BD Biosciences) y se diluye en su caso para evitar la obstrucción de la boquilla del clasificador de células. Los protoplastos se ordenan utilizando una boquilla de 100 micras a una presión de 20 psi (vaina) y 21-21.5 psi (muestra), una frecuencia de 39,2 kHz y una tasa de sucesos de &lt;4000 (estos valores son óptimos en un clasificador de células Influx BD (BD Biosciences). Optimización en otras máquinas de clasificación celular vez necesite una modificación en estas opciones). </li><li> Protoplastos GFP positivos se identifican utilizando un láser de argón de 488 nm y el trazado de la salida del paso de banda 580/30 filtro (naranja) vs el filtro 530/40 de paso de banda (verde). Protoplastos GFP positivos será en la población de alto 530/low 580, con protoplastos no-GFP en el bajo 530/580 bajo la población y muertos / protoplastos que mueren y los desechos en la población de alto 580mento (Figura 2). <ol><li> Al ordenar los protoplastos a partir de la que se extrajeron los ARN, los protoplastos se deben ordenar directamente en al menos 4 volúmenes de un tampón de lisis que contiene un agente reductor (por ejemplo, β-mercaptoetanol). Además, el tiempo de tipo de una sola muestra debe limitarse a 20-30 min, y un máximo de dos a tres muestras procesadas en un momento dado. </li><li> Para la visualización de protoplastos según, los protoplastos se deben ordenar directamente en al menos 8 volúmenes de la solución A y posteriormente recogidas por centrifugación para concentrar los protoplastos. </li></ol></li></ol> 3. Los resultados representativos Este protocolo describe un método para la obtención de protoplastos a partir de hojas de Arabidopsis, que se utilizan para la clasificación de células activadas por fluorescencia (Figura 1). Generación de protoplastos en presencia de RNasa e inhibidores transcripcionales impide la f célulasrom montaje de una respuesta transcripcional. Esto tiene la consecuencia de que da lugar a muchos protoplastos muertos y moribundos, que tienen un nivel significativo de autofluorescencia. Al ordenar los protoplastos preparados con este método es por lo tanto muy común ver varias poblaciones distintas en las gráficas de las 580 nm frente a 530 nm de fluorescencia utilizados para la clasificación. Ejemplos de este, junto con las puertas de clasificación utilizados en este protocolo se muestran en la Figura 3. Los protoplastos se pueden clasificar en 8 volúmenes de la solución A y se recoge para la visualización para verificar el enriquecimiento. Figura 2G muestra un ejemplo de este uso de la línea de TP382, que expresa GFP en las células guardas. Ejemplos de los rendimientos obtenidos utilizando este método, tanto antes como después de la amplificación, se muestran en la Tabla 1. Las cantidades obtenidas son suficientes para la amplificación usando el Ovation Pico WTA Sistema (500 pg-50 ng) y por lo tanto sanálisis ubsequent por cualquiera de qPCR (Figura 4), ​​la secuenciación de próxima generación o microarrays. <img alt="Figura 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Figura 1. Flujo de trabajo general para el experimento. 1) Harvest deja de interés de una línea que expresan GFP Arabidopsis. 2) rápidamente cortado en tiras de 1 ~ mm de ancho y transferirlas inmediatamente en una solución de protoplastos y vacío infiltrado. 3) Se incuba durante 3-4 horas. 4) suavemente filtrado solución de protoplastos a través de un tamiz de 70 micras, traslado a la vuelta de tubos de fondo y protoplastos pellet por centrifugación. 5) Inmediatamente antes de la clasificación, los protoplastos se resuspenden y la transferencia a un tubo de clasificación a través de un filtro de 50 micras. 6) Ordenar GFP positivas y las buenas prácticas agrarias viables protoplastos negativos. 7) Los protoplastos ahora se pueden analizar visualmente o mediante técnicas tales como la qPCR, secuenciación de próxima generación o microarrays. Figura 2. Las líneas KC464, KC274 y TP382 utilizados en este estudio. A) Sección transversal de una hoja KC464 que muestra la expresión de GFP en la epidermis adaxial. B) los protoplastos derivados de KC464 hojas. C) Sección transversal de una hoja KC274 que muestra la expresión de GFP en la vasculatura. D) Los protoplastos derivados de KC274 hojas. E) TP382 hoja que muestra la expresión de GFP en las células de guarda. F) los protoplastos derivados de TP382 hojas. G) Ejemplo del enriquecimiento obtenido por FACS de las células que expresan GFP guardia en el fondo complejo de células de las hojas, mostrando las buenas prácticas agrarias que contiene los protoplastos de la 530/low alta población de 580 protoplastos derivados de TP382 hojas. AF: Confocal de imágenes de microscopio; G: Imagen del microscopio de fluorescencia. Las barras de escala dentro de las imágenes son de 50 micras. <img alt="Figura 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Figura 3. Típicos gráficos de puntos de FACS de adquisición de la salida de los 580/30 nm (naranja) vs 530/40 nm (verde) filtros de paso de banda (afluencia BD clasificador de células). Las puertas de clasificación se muestran en las que normalmente se utilizan durante la clasificación. A) Dot parcela de protoplastos de hoja Col-4 protoplastos derivados, en ausencia de inhibidores, que muestran una sola 530/low bajo 580 población. B) Dot parcela de WT Col-4 hoja protoplastos derivados, protoplastos en presencia de inhibidores, que muestran un cambio en la fluorescencia de 580 debido a la tensión y la coloración por los inhibidores. CE) Dot parcelas de la hoja de protoplastos derivados de las líneas KC74, KC464 y TP382, respectivamente, protoplastos en presencia de inhibidores, que muestran la GFP que contiene las poblaciones en el 530/low alta 580 poblaciones. Los porcentajes de los acontecimientos en las buenas prácticas agrarias (alta 530/low 580) poblaciones se dan. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Haga clic aquí para ampliar la cifra</a> . e_content &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Figura 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Figura 4. Expresión de GFP en las fracciones de población representativas cerradas como se muestra en la Figura 3. Dos repeticiones biológica se obtuvieron para cada tipo de fracción, amplificado utilizando el Ovation Pico WTA Sistema y qPCR utilizando GFP cebadores específicos (Tabla 2) se realizó a continuación. Los valores mostrados son los más altos (rojo), el más bajo (verde) y el promedio de los valores relativos. La población fue de 580 alto en este caso se partió en dos, bajo 530/low 580 y alto 530/low 580, para que una réplica biológica sólo se estudió lo que sólo el valor único. ACT2 (At3g18780) fue utilizado como un estándar para todas las muestras. Hoja: hoja entera. Unsorted: protoplastos sin clasificar. GFP1: alto 530/low 580 y Rest1: bajo 530/low 580, GFP2: 530/high alta 580 y Rest2: bajo 530/high 580, tal como se describe en la figura 3 y la inserción. Los resultados son una verificación of evaluaciones ópticas del contenido de células GFP en las fracciones ordenados (por ejemplo 2G figura). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Haga clic aquí para ampliar la cifra</a> . <table border="1"><tbody><tr><td> Muestra </td><td> N º de hojas </td><td> N º de celdas </td><td> ARN rendimiento (Ng) </td><td> ARN rendimiento (Amplificado; ng) </td></tr><tr><td> Una hoja entera B hoja entera </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> A protoplastos Unsorted Protoplastos B Unsorted </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> A GFP1 A Rest1 </td><td> 15 </td><td> 6039 (0.39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10.783 (0,63% *) 57.040 (7.49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18.337 (1.49% *) 62.405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Las muestras Tabla 1. Recolectados a través de FACS y se analizaron con qPCR para determinar qué fracción contenida en vivo que expresan GFP-protoplastos. También se incluyen en esta tabla es el rendimiento total de ARN en ng antes y después de la amplificación con el sistema Ovation Pico WTA (NuGen). Fracciones GFP1, GFP2, Rest1 y Rest2 son como se muestra en el inserto en la Figura 4. * El porcentaje de células de la especie de células de ejecución total se da entre paréntesis al lado del número de células en la fracción. Estos porcentajes no están correlacionadasentre sí para cada muestra como el tipo FACS tiene una duración de fracciones &quot;resto&quot; se detuvo antes de lo que las buenas prácticas agrarias para las fracciones por el número mucho mayor de células recolectadas de descanso. ** 50 ng utiliza como entrada para reacciones de amplificación, según el protocolo del fabricante. <table border="1"><tbody><tr><td> Cartilla </td><td> Secuencia </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tabla 2. QPCR primers.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

No hay conflictos de interés declarado.

Se ha descrito un método que permite el uso de plantas de Arabidopsis que expresan GFP en las hojas para la generación de protoplastos y células de clasificación subsiguiente usando FACS. Este método produce cantidades suficientes de ARN para ser utilizados para la amplificación y el análisis posterior por lo tanto, ya sea por qPCR o microarrays. Las fracciones según son altamente enriquecido para GFP células que contienen, como se demuestra por qPCR (Figura 2). Para lograr altos rendimientos de protoplastos vivos es crítico para trabajar rápidamente durante las etapas iniciales del procedimiento, hasta que las tiras de hoja de vacío han sido infiltrada con la solución de protoplastos que contienen un inhibidor. Además, cuando se generan tiras de 1 mm de hoja que es muy importante para rebanar o cortar las hojas en lugar de &#39;tajada&#39; o puré de ellos, ya que esto conduce a un daño excesivo y por lo tanto un rendimiento de protoplastos inferior. Una diferencia fundamental entre el método descrito aquí y otro Published métodos es el uso de inhibidores de RNasa e inhibidores de la transcripción. La mayoría de los métodos se han desarrollado para las raíces de Arabidopsis, de las cuales los protoplastos se pueden generar más fácilmente. Sin embargo, cuando se trabaja con hojas, excepto mesófilo, es necesario aumentar el tiempo de generación de protoplastos. Por lo tanto, es importante incluir estos inhibidores para proteger contra los cambios en la expresión génica como resultado de la generación de tratamiento de protoplastos sí mismo (datos no mostrados). Sin embargo, la presencia de los inhibidores conduce a una incapacidad de montar una respuesta de transcripción, ya sea por conmutación o eliminar genes, que es probable que los protoplastos más vulnerables ya que esto conduce a una pérdida de plasticidad con el cual contrarrestar las tensiones de la protoplastos procedimiento. Se ha utilizado el método descrito aquí con éxito con un número de líneas que expresan GFP Arabidopsis. Es importante destacar que han utilizado este método con las líneas que expresan GFP GFP sea fuertemente enel núcleo, o mucho más débilmente de forma citosólica non-localized/diffuse, como es el caso con los KC464 y KC274 líneas utilizadas aquí. Ambos tipos de líneas son compatibles con el método y el rendimiento de fracciones altamente enriquecidas de GFP-expresando protoplastos (Figura 2 y 3). El método puede ser fácilmente adaptado para otros fluoróforos, aunque el fluoróforo debe ser seleccionado para fluorescencia que es significativamente diferente de la autofluorescencia de las células muertas / morir a fin de preservar la capacidad de seleccionar células vivas.

<table border="1"><tbody><tr><td> Nombre del reactivo </td><td> Empresa </td><td> Número de catálogo </td></tr><tr><td> Celulasa R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Celulasa RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomicina D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 micras filtro de células </td><td> Pescador </td><td> FB35181 </td></tr><tr><td> 50 micras Filcon tipo de copa filtros </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Después de la iniciación de la primordio de hoja, acumulación de biomasa es controlado principalmente por la proliferación celular y la expansión de las hojas 1. Sin embargo, la hoja de Arabidopsis es un órgano complejo compuesto de muchos tipos de células diferentes y varias estructuras. Al mismo tiempo, la hoja creciente contiene células en diferentes etapas de desarrollo, con las células más alejadas del pecíolo siendo la primera a detener la expansión y se someten a la senescencia 1. Las diferentes células dentro de la hoja, por lo tanto dividir, alargando o diferenciar, activo, estresado o muerto, y / o responder a los estímulos en los sub-conjuntos de su tipo celular en un momento dado. Esto hace que el estudio genómico de la hoja desafiante: por ejemplo en el análisis de datos de expresión de hojas enteras, las señales de redes genéticos que operan en distintas zonas de respuesta celular o tipos de células se confunden, lo que resulta en un perfil incorrecto que se generan. Para abordar esta cuestión, sarias métodos se han descrito, que permiten los estudios de la expresión génica específica de la célula. Estos incluyen la captura de microdisección por láser (LCM) 2 o plantas que expresan GFP utilizados para la generación de protoplastos y la posterior clasificación de células activadas por fluorescencia (FACS) 3,4, el sistema descrito recientemente intacto por precipitación nuclear 5 y la inmunoprecipitación de los polisomas 6. FACS ha sido utilizado con éxito para una serie de estudios, incluyendo el mostrar que la identidad de la célula y la distancia desde la punta de la raíz tuvo un efecto significativo en los perfiles de expresión de un gran número de genes 3,7. FACS de líneas de GFP también se han utilizado para demostrar células específicas de regulación transcripcional durante las respuestas de nitrógeno raíces y el desarrollo de raíces laterales 8, 9 estrés sal distribución de auxina en la raíz 10 y para crear un mapa de la expresión de genes de la Arabidopsis meristemo apical 11. AunqueFACS se ha utilizado anteriormente para ordenar protoplastos de Arabidopsis hoja derivados basados ​​en autofluorescencia 12,13, hasta ahora el uso de FACS en las líneas de Arabidopsis que expresan GFP en las hojas ha sido muy limitado 4. En el siguiente protocolo se describe un método para la obtención de protoplastos de Arabidopsis hoja que son compatibles con FACS mientras se minimiza el impacto del régimen de generación de protoplastos. Se demuestra el método que utiliza la línea de Arabidopsis KC464, que expresa GFP en la epidermis adaxial 14, la línea KC274, que expresa GFP en el tejido vascular 14 y la línea de Arabidopsis TP382, que expresan un doble constructo GFP ligado a una señal de localización nuclear en las células de guarda (datos no mostrados; Figura 2). Actualmente estamos utilizando este método para estudiar tanto la expresión de tipo celular específico durante el desarrollo y el estrés, así como las poblaciones celulares heterogéneas en diversas etapas de la senescencia.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Un método para producir<em&gt; Arabidopsis</em&gt; Protoplastos de hoja que son compatibles con la clasificación de células activadas por fluorescencia (FACS), lo que permite estudios de poblaciones celulares específicas. Este método es compatible con cualquier<em&gt; Arabidopsis</emLine&gt; que expresa GFP en un subconjunto de las células.

Análisis específico de célula de<em&gt; Arabidopsis</em&gt; Hojas usando citometría de flujo

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K vistas.  University of Warwick. Un método para producir Arabidopsis Protoplastos de hoja que son compatibles con la clasificación de células activadas por fluorescencia (FACS), lo que permite estudios de poblaciones celulares específicas. Este método es compatible con cualquier Arabidopsis que expresa GFP en un subconjunto de las células.

Video: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescencia de células activadas por la clasificación de los protoplastos de la planta

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Investigación

Biología

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

La investigación de los tejidos y órganos específicos de las respuestas fitocromo usando FACS asistida por células de tipo Perfiles de expresión específica en Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Lípidos vesículas mediada por cromatografía de afinidad utilizando magnética clasificación de células activadas (LIMACS): un nuevo método para analizar la interacción de proteínas y lípidos

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) El etiquetado y posterior clasificación de células activadas fluorescencia para la Cultura independiente de la identificación de carbono orgánico disuelto degradación bacterioplancton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Optimizado manchas y Proliferación métodos de modelización para la vigilancia del uso de tintes División Celular Celulares de seguimiento

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Aislamiento de fibroblastos normales y el cáncer asociado-de los tejidos frescos por Clasificación células activadas por fluorescencia (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Microaspiración de células únicas como estrategia alternativa a la clasificación celular activada por fluorescencia para la separación de mezclas de virus gigantes

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Clasificación celular activada por fluorescencia para el aislamiento de las poblaciones celulares escleractinianas

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Aislar ARN específicos del tipo de célula de muestras de tejido heterogéneo congeladas a presión sin clasificación celular

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Macro Imager de vida útil de fluorescencia para aplicaciones biomédicas

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...