Travailler dans le laboratoire Buchanan-Wollaston sur le profilage stade des cellules de type et de développement spécifique est prise en charge par le projet AGRON-OMICS (subvention n LSHG-CT-2006-037704) dans le cadre Progamme 6 ème de la Commission européenne. Travailler dans le laboratoire Gifford sur un type de cellule spécifique profilage est soutenu par une subvention de nouveau chercheur BBSRC (BB/H019502/1). Les KC274 KC464 et les lignes d&#39;Arabidopsis ont été obtenus à partir de l&#39;AAR Webb (Université de Cambridge).

1. Génération de protoplastes <ol><li> Matériel foliaire Récolte et les couper en lanières 1 mm de large (figure 1) avec une lame de rasoir. Pour les échantillons contenant plus d&#39;une seule feuille jusqu&#39;à 15 feuilles peuvent être facilement empilés avant de couper. </li><li> Transférer immédiatement les bandes de feuilles dans une boîte de Petri de 9 cm rond contenant 20 ml de solution A (400 mM de mannitol, 20 mM de MES hydrate, 20 mM KCl, CaCl2 10 mM, MgCl2 2 mM, BSA 0,1% et 2,5 mM de β-mercaptoéthanol, pH 5,7) y compris les enzymes protoplastes (1,2% de cellulose R-10, la cellulose 0,6% et 0,4% RS macerozyme R-10) et de RNase et d&#39;inhibiteurs de la transcription (1 × ProtectRNA et 10 pg / ml d&#39;actinomycine D); séparer délicatement les feuilles et bandes aspirateur infiltrer pour 2 x 5 min. </li><li> Lieu boîte de Pétri sur un agitateur orbital réglé à 90 tours par minute à la température ambiante et de protoplastes pour 3-4 heures. <ol><li> Au cours de l&#39;incubation, les bandes de feuille doivent être séparés les uns des autres, par utilisation d&#39;unjeu de pinces plates, les demi-heures. </li></ol></li><li> Placez un 70 um tamis cellulaire (Fisher Scientific) dans un tube de 50 ml et doucement filtrer la solution à travers protoplastes. Cela permettra d&#39;éliminer les bandes de feuilles, qui seront retenues par le tamis tout en permettant aux protoplastes à passer. </li><li> Laver les barrettes de feuilles avec 4 ml de solution A et doucement à travers le tamis de filtre même. </li><li> Transférez les protoplastes dans des tubes à fond rond et centrifuger la solution de protoplastes à 300 xg pendant 5 min à pellets les protoplastes. </li><li> Aspirer le maximum de surnageant sans déranger les protoplastes. </li><li> Laver les protoplastes avec 5 ml de solution A et centrifuger à 300 xg pendant 5 min. Retirer le surnageant </li><li> Remettre en suspension les protoplastes dans un volume approprié de la solution A, à l&#39;aide d&#39;une pipette Pasteur ou une pointe P1000 coupure. </li></ol> 2. FACS de protoplastes foliaires </p&gt; <ol><li> Immédiatement avant le triage, remettre en suspension les protoplastes en utilisant une liste (non coupé) P1000 pointe pour éviter les protoplastes s&#39;agglomérer. </li><li> Transférer des protoplastes à un tube de tri à travers un filtre 50 um Filcon (BD Biosciences) et le cas échéant diluer pour éviter le colmatage de la buse de la trieuse de cellules. Les protoplastes sont triés à l&#39;aide d&#39;une buse de 100 um à une pression de 20 psi (gaine) et de 21 à 21,5 psi (échantillon), une fréquence de 39,2 kHz et un taux d&#39;événements de &lt;4000 (ces paramètres sont optimales sur un trieur de cellules BD Afflux (BD Biosciences). Optimisation sur d&#39;autres machines de tri de cellules devrez peut-être ajuster ces paramètres). </li><li> Protoplastes GFP positives sont identifiées à l&#39;aide d&#39;un laser argon à 488 nm et le tracé de la sortie du passe-bande 580/30 de filtre (orange) par rapport au filtre 530/40 passe-bande (vert). Protoplastes GFP-positives sera dans la grande 530/low 580 de la population, avec les non-GFP protoplastes dans le bas 530/580 à faible population et de morts qui meurent / protoplastes et les débris de la grande population 580ment (Figure 2). <ol><li> Lors du tri des protoplastes à partir de l&#39;ARN qui seront extraites, protoplastes doivent être triés directement dans au moins 4 volumes d&#39;un tampon de lyse contenant un agent réducteur (par exemple β-mercaptoéthanol). En outre, le temps de tri d&#39;un échantillon unique devrait être limitée à 20-30 min, et un maximum de deux à trois échantillons traités à un moment donné. </li><li> Pour la visualisation des protoplastes triés, les protoplastes doivent être triés directement dans au moins 8 volumes de la solution A, puis recueillies par centrifugation pour concentrer les protoplastes. </li></ol></li></ol> 3. Les résultats représentatifs Ce protocole décrit un procédé d&#39;obtention de protoplastes de feuilles d&#39;Arabidopsis, qui sont utilisés pour le tri de cellules activé par fluorescence (figure 1). Génération de protoplastes en présence de RNase et d&#39;inhibiteurs de la transcription empêche le f cellulesrom montage d&#39;une réponse transcriptionnelle. Cela ne veut avoir pour conséquence de donner lieu à de nombreuses protoplastes morts et mourants, qui ont un niveau élevé d&#39;auto-fluorescence. Lors du tri des protoplastes préparés avec cette méthode, il est donc très fréquent de voir plusieurs populations distinctes dans les graphes des 580 nm contre 530 nm fluorescence utilisés pour le tri. Des exemples de ce qui, avec les portes de tri utilisés dans ce protocole sont présentés dans la figure 3. Les protoplastes peuvent être classés en 8 volumes de la solution A et recueilli pour la visualisation de vérifier l&#39;enrichissement. Figure 2G montre un exemple de cette utilisation de la ligne TP382, qui exprime la GFP dans les cellules de garde. Exemples de rendements obtenus en utilisant cette méthode, à la fois avant et après amplification, sont présentés dans le tableau 1. Les montants obtenus sont suffisants pour l&#39;amplification en utilisant le système Ovation Pico WTA (500 pg-50 ng) et donc subsequent analyse par qPCR soit (figure 4), le séquençage de prochaine génération ou puces à ADN. <img alt="Figure 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Figure 1. Flux de travail globale de l&#39;expérience. 1) Récolte des feuilles de l&#39;intérêt d&#39;une ligne exprimant la GFP Arabidopsis. 2) rapidement coupé en ~ 1 mm larges bandes et transférer immédiatement dans la solution de ces protoplastes et le vide s&#39;infiltrer. 3) Incuber pendant 3-4 heures. 4) doucement filtrat protoplastes solution à travers un tamis 70 pm, transfert à arrondir les tubes à fond et les protoplastes par centrifugation. 5) Immédiatement avant le triage, remettre les protoplastes et le transfert d&#39;un tube de tri à travers un filtre 50 um. 6) Trier GFP positives et négatives GFP protoplastes viables. 7) Les protoplastes peuvent maintenant être analysées visuellement ou en utilisant des techniques telles que qPCR, séquençage de nouvelle génération ou puces à ADN. Figure 2. Les lignes KC464, KC274 et TP382 utilisées dans cette étude. A) Coupe transversale d&#39;une feuille KC464 montrant l&#39;expression de la GFP dans l&#39;épiderme ventral. B) Les protoplastes provenant de feuilles KC464. C) Coupe transversale d&#39;une feuille KC274 montrant l&#39;expression de la GFP dans le système vasculaire. D) Les protoplastes issus de KC274 feuilles. E) feuille TP382 montrant l&#39;expression de la GFP dans les cellules de garde. F) provenant de protoplastes TP382 feuilles. G) Exemple de l&#39;enrichissement obtenu par FACS de la GFP exprimant des cellules de garde à l&#39;arrière-plan complexe de cellules de la feuille, montrant GFP contenant des protoplastes de la 530/low 580 de population de protoplastes issus de TP382 feuilles. AF: les images microscope confocal; G: image Microscope à fluorescence. Barres d&#39;échelle dans les images sont de 50 um. <img alt="Figure 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Figure 3. Typiques parcelles FACS points d&#39;acquisition de la sortie de la 580/30 nm (orange) vs 530/40 nm (vert) filtres passe-bande (trieur de cellules BD Influx). Les portes de tri indiquées sont celles généralement utilisées pendant le tri. A) en points de protoplastes Col-4 feuilles dérivés, protoplasted en l&#39;absence d&#39;inhibiteurs, montrant une seule 530/low bas 580 habitants. B) en points de poids Col-4 feuilles de protoplastes dérivés, protoplasted en présence d&#39;inhibiteurs, montrant un changement de la fluorescence 580 à cause du stress et la coloration par les inhibiteurs. CE) Dot parcelles de feuilles protoplastes dérivés à partir des lignes KC74, KC464 et TP382, respectivement, protoplasted en présence d&#39;inhibiteurs de la GFP, montrant contenant populations dans le haut 530/low 580 populations. Les pourcentages des événements dans les GFP (haute 530/low 580) les populations sont donnés. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Cliquez ici pour agrandir la figure</a> . e_content &quot;fo: keep-together.within pages =&quot; always &quot;&gt; <img alt="Figure 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Figure 4. Expression de la GFP dans les fractions représentatives de la population dépendants comme le montre la figure 3. Deux biologique reproduit ont été obtenus pour chaque type de fraction, amplifié en utilisant le système Ovation Pico WTA et qPCR utilisant des amorces spécifiques de la GFP (tableau 2) a été effectuée. Les valeurs indiquées sont les plus élevées (rouge), le plus bas (vert) et la moyenne des valeurs relatives. La population était élevée 580 dans ce cas divisée en deux, une faible 530/low 580 et haute 530/low 580, dont une réplique biologique unique a été utilisé afin que la seule valeur est indiquée. ACT2 (At3g18780) a été utilisé comme un standard pour tous les échantillons. Feuille: Feuilles entières. Unsorted: protoplastes non triés. GFP1: haute 530/low 580 et REST1: faible 530/low 580, GFP2: 530/high haute 580 et REST2: faible 530/high 580, tel que décrit à la figure 3 et l&#39;insert. Les résultats sont un o vérificationf évaluations optiques du contenu de la cellule GFP dans les fractions triées (2G figure, par exemple). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Cliquez ici pour agrandir la figure</a> . <table border="1"><tbody><tr><td> Échantillon </td><td> Nombre de feuilles </td><td> Nombre de cellules </td><td> ARN rendement (Ng) </td><td> ARN rendement (Amplifié; ng) </td></tr><tr><td> Une feuille entière B Feuilles entières </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Un protoplastes Unsorted Unsorted B protoplastes </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> Un GFP1 Un REST1 </td><td> 15 </td><td> 6039 (0.39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B REST1 B </td><td> 15 </td><td> 10.783 (0.63% *) 57 040 (7,49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18337 (1.49% *) 62 405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Les échantillons Tableau 1. Recueillies à l&#39;aide FACS et analysées par qPCR afin de déterminer quelle fraction contenait vivantes exprimant GFP-protoplastes. Sont également inclus dans ce tableau est le rendement d&#39;ARN total en ng avant et après amplification avec le système Ovation Pico WTA (NuGen). Fractions GFP1, GFP2, REST1 REST2 et sont indiquées dans l&#39;insert de la figure 4. * Le pourcentage de cellules de la course de tri cellulaire total est donné entre parenthèses à côté du nombre de cellules dans la fraction. Ces pourcentages ne sont pas corrélées àl&#39;autre pour chaque échantillon, le type FACS fonctionne pour les fractions «repos» ont été arrêtés plus tôt que pour les fractions GFP en raison du nombre beaucoup plus élevé de cellules de repos collectées. ** 50 ng utilisé comme entrée pour les réactions d&#39;amplification, selon le protocole du fabricant. <table border="1"><tbody><tr><td> Apprêt </td><td> Séquence </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tableau 2. Amorces qPCR.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Nous avons décrit une méthode qui permet l&#39;utilisation de plantes d&#39;Arabidopsis exprimant la GFP dans les feuilles pour la production de protoplastes et tri cellulaire ultérieure à l&#39;aide FACS. Cette méthode donne des quantités suffisantes d&#39;ARN à être utilisées pour l&#39;amplification et l&#39;analyse subséquente par conséquent supporte qPCR ou puce à ADN. Les fractions triées sont hautement enrichi pour la GFP contenant des cellules, tel que démontré par qPCR (Figure 2). Pour obtenir des rendements élevés de protoplastes vivants, il est essentiel de travailler rapidement au cours des premières étapes de la procédure, jusqu&#39;à ce que les bandes de feuilles ont été infiltrées sous vide avec la solution de protoplastes contenant l&#39;inhibiteur. En outre, lors de la génération bandes de 1 mm feuilles, il est très important de trancher ou couper les feuilles plutôt que «chop» ou écrasez-les, car cela conduit à des dommages excessifs et donc un rendement inférieur de protoplastes. Une différence cruciale entre la méthode décrite ici et publishe autreméthodes d est l&#39;utilisation d&#39;inhibiteurs de RNase et d&#39;inhibiteurs de la transcription. La plupart des méthodes sont développées pour les racines d&#39;Arabidopsis, dont protoplastes peuvent être générées plus facilement. Toutefois, lorsque vous travaillez avec des feuilles, à l&#39;exception du mésophylle, il est nécessaire d&#39;augmenter le temps de génération de protoplastes. Par conséquent, il est important d&#39;inclure ces inhibiteurs pour protéger contre les variations de l&#39;expression des gènes à la suite du traitement génération de protoplastes lui-même (données non présentées). Cependant, la présence des inhibiteurs conduit à une incapacité à monter une réponse transcription, soit par commutation des gènes ON ou OFF, ce qui est susceptible de rendre les protoplastes plus vulnérables car cela conduit à une perte de plasticité permet de contrer le stress de la protoplastes procédure. Nous avons utilisé la méthode décrite ici avec succès un certain nombre de lignes exprimant la GFP Arabidopsis. Surtout, nous avons utilisé cette méthode avec des lignes GFP exprimant la GFP soit fortementle noyau, ou beaucoup plus faiblement de manière non-localized/diffuse cytosolique, comme c&#39;est le cas avec les KC464 KC274 et lignes utilisées ici. Les deux types de lignes sont compatibles avec la méthode et le rendement des fractions hautement enrichi de GFP exprimant protoplastes (Figure 2 et 3). La méthode pourrait être facilement adaptée à d&#39;autres fluorophores, bien que le fluorophore doit être sélectionné pour que la fluorescence est significativement différente de l&#39;autofluorescence des cellules mortes / meurt afin de préserver la possibilité de sélectionner les cellules vivantes.

<table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomycine D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 um tamis cellulaire </td><td> Pêcheur </td><td> FB35181 </td></tr><tr><td> 50 um tasse de filtres de type Filcon </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Après le début de l&#39;ébauche de feuille, l&#39;accumulation de la biomasse est commandé principalement par la prolifération des cellules et de l&#39;expansion dans les feuilles 1. Toutefois, la feuille d&#39;Arabidopsis est un organe complexe composé de plusieurs types cellulaires différents et plusieurs structures. Dans le même temps, la feuille de plus en plus contient des cellules à différents stades de développement, les cellules les plus éloignées du pétiole Soyez le premier à arrêter l&#39;expansion et se soumettre à la sénescence 1. Les différentes cellules dans la feuille sont donc diviser, élongation ou de différenciation; actif, stressés ou morts, et / ou répondre à des stimuli dans les sous-ensembles de leur type cellulaire à un moment donné. Cela rend l&#39;étude génomique de la contestation feuille: par exemple lors de l&#39;analyse des données d&#39;expression de feuilles entières, des signaux de réseaux génétiques qui opèrent dans des zones distinctes de réponse cellulaire ou des types cellulaires seront confondus, résultant en un profil inexactes généré. Pour résoudre ce problème, slusieurs méthodes ont été décrites qui permettent les études d&#39;expression génique de cellules spécifiques. Il s&#39;agit notamment de capture microdissection laser (LCM) 2 ou les plantes exprimant la GFP utilisées pour la production de protoplastes et après le tri cellulaire par fluorescence (FACS) 3,4, le système a récemment décrit l&#39;état intact de précipitation nucléaire 5 et 6 immunoprécipitation de polysomes. FACS a été utilisé avec succès pour un certain nombre d&#39;études, notamment en montrant que l&#39;identité de la cellule et la distance de l&#39;extrémité de la racine a eu un effet significatif sur les profils d&#39;expression d&#39;un grand nombre de gènes 3,7. FACS de lignes GFP ont également été utilisées pour démontrer spécifique des cellules régulation transcriptionnelle lors des interventions d&#39;azote racines et le développement des racines latérales 8, 9 Répartition sel de stress auxine dans la racine 10 et de créer une carte d&#39;expression génique du méristème apical Arabidopsis 11. Bien queFACS a déjà été utilisée pour trier les protoplastes de feuilles d&#39;Arabidopsis dérivés fondés sur autofluorescence 12,13, jusqu&#39;à l&#39;utilisation de FACS sur des lignes d&#39;Arabidopsis exprimant la GFP dans les feuilles a été très limitée 4. Dans le protocole suivant, nous décrivons une méthode pour obtenir des protoplastes de feuilles d&#39;Arabidopsis qui sont compatibles avec FACS, tout en minimisant l&#39;impact du régime de production de protoplastes. Nous démontrons la méthode utilisant la ligne KC464 Arabidopsis, qui expriment la GFP dans l&#39;épiderme ventral 14, la ligne KC274, qui expriment la GFP dans le tissu vasculaire 14 et la ligne Arabidopsis TP382, qui expriment la GFP construction en double lié à un signal de localisation nucléaire les cellules de garde (données non présentées, figure 2). Nous sommes en train d&#39;utiliser cette méthode pour étudier à la fois l&#39;expression spécifique au type cellulaire au cours du développement et le stress, ainsi que des populations de cellules hétérogènes à différents stades de la sénescence.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Procédé de fabrication d&#39;<em&gt; Arabidopsis</em&gt; Protoplastes de feuilles qui sont compatibles avec le tri cellulaire activé par fluorescence (FACS), ce qui permet l&#39;étude des populations cellulaires spécifiques. Cette méthode est compatible avec n&#39;importe quel<em&gt; Arabidopsis</em&gt; Line qui exprime la GFP dans un sous-ensemble de cellules.

Analyse cellulaire spécifique de<em&gt; Arabidopsis</em&gt; Feuilles en utilisant la fluorescence par tri cellulaire activé

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K vues.  University of Warwick. Procédé de fabrication d' Arabidopsis Protoplastes de feuilles qui sont compatibles avec le tri cellulaire activé par fluorescence (FACS), ce qui permet l'étude des populations cellulaires spécifiques. Cette méthode est compatible avec n'importe quel Arabidopsis Line qui exprime la GFP dans un sous-ensemble de cellules.

Vidéo: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Tri cellulaire activé par fluorescence des protoplastes végétaux

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Recherche

Biologie

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Étude des tissus et des organes spécifiques Réponses phytochrome utilisant FACS assistée type cellulaire profilage expression spécifique dans Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Chromatographie d&#39;affinité lipidique des vésicules médiée utilisant magnétique tri cellulaire activé (LIMACS): une nouvelle méthode pour analyser les interactions protéines-lipides

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodésoxyuridine (BrdU) l&#39;étiquetage et ultérieures de tri cellulaire activé par fluorescence de la culture indépendante Identification de carbone organique dissous dégradants bactérioplancton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Optimisé méthodes de modélisation de coloration et de prolifération pour la surveillance division cellulaire en utilisant des colorants Suivi cellulaires

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Isolation des fibroblastes normales et cancéreuses associées à partir de tissus frais par tri cellulaire activé par fluorescence (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Micro-aspiration à cellule unique comme stratégie alternative au tri cellulaire activé par fluorescence pour la séparation du mélange de virus géants

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Tri cellulaire activée par fluorescence pour l’isolement des populations de cellules sclérosiennes

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Isoler des ARN spécifiques à un type cellulaire à partir d’échantillons de tissus hétérogènes congelés sans tri cellulaire

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Macro-imageur à vie de fluorescence pour applications biomédicales

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...