Hücre tipine ve gelişim evrelerine özgü profil üzerine Buchanan-Wollaston laboratuarında çalışma Avrupa Komisyonu 6. Çerçeve Programı&#39;nın en AGRON-omics projesi (hibe # LSHG-CT-2006-037704) tarafından desteklenmektedir. Hücre tipine özgü profil üzerine Gifford laboratuarda çalışmak bir BBSRC Yeni Araştırmacı hibe (BB/H019502/1) tarafından desteklenmektedir. KC274 ve KC464 Arabidopsis hatları AAR Webb (Cambridge University of) elde edilmiştir.

1. Protoplast Nesil <ol><li> Bir jilet ile 1 mm genişliğinde şeritler (Şekil 1) içine Hasat yaprak malzeme ve kesim. Için en fazla 15 yaprak, tek bir yaprak daha içeren örnekleri kolay kesim öncesinde yığılmış olabilir. </li><li> Derhal 20 ml solüsyon içeren bir 9 cm olan yuvarlak Petri kabı içine yaprak şerit aktarma A (400 mM, mannitol, 20 mM MES hidrat, 20 mM KCI, 10 mM CaCI2, 2 mM MgCl2,% 0.1 BSA, 2.5 mM β-merkaptoetanol, protoplasting enzimler (% 1.2 selüloz R-10,% 0.6 selüloz RS ve% 0,4 &#39;macerozyme R-10) ve RNase ve transkripsiyonel inhibitörleri (1 x ProtectRNA ve 10 ug / ml Aktinomisin D) içeren pH 5.7), yavaşça yaprak şeritler ayırmak ve 2 × 5 dk sızmak vakum. </li><li> Bir orbital çalkalayıcı üzerinde yer Petri tabağına 3-4 saat boyunca oda sıcaklığında ve protoplast 90 rpm&#39;ye ayarlayın. <ol><li> İnkübasyon sırasında, şeritler bir yaprak kullanılarak, her biri diğerinden ayrılması gerekiryarım saatlik aralıklarla, düz cımbız ayarlayın. </li></ol></li><li> 50 ml&#39;lik bir tüp içinde 70 mikron hücre süzgecinden (Fisher Scientific) yerleştirin ve yavaşça yoluyla protoplasting çözüm filtre. Bu protoplast geçmesi için izin verirken elek tarafından muhafaza edilecektir yaprak şeritler kaldıracaktır. </li><li> 4 ml solüsyon aynı elekten A ve hafifçe filtre ile yaprak şeritler yıkayın. </li><li> Yuvarlak dipli tüpler içine protoplast aktarın ve pelet protoplast 5 dakika boyunca 300 xg&#39;de protoplast çözümü santrifüj. </li><li> Yavaşça protoplast bozmadan kadar süpernatant mümkün olduğunca kapalı aspire. </li><li> 5 dakika boyunca 300 x g 5 ml çözelti A ve protoplastlar santrifüj ile yıkanır. Süpernatantı </li><li> Pasteur pipeti veya cut-off P1000 ucunu kullanarak, çözelti A uygun bir hacim protoplast süspanse edin. </li></ol> 2. Yaprak protoplast FACS </p&gt; <ol><li> Hemen sıralama önce, birlikte topaklanma protoplast önlemek için bir (non-cut) P1000 ucu kullanarak protoplast tekrar süspansiyon haline getirin. </li><li> 50 mikron filcon filtresi (BD Biosciences) ile bir sıralama tüp protoplast aktarın ve hücre sıralayıcı meme tıkanmasını önlemek için uygun sulandırmak. Protoplast 20 psi (kılıf) ve 21-21,5 psi (örnek), 39.2 kHz frekansta bir basınç ve &lt;4000 (bu ayarlar BD Akın hücre sıralayıcı üzerinde optimal bir olay hızında 100 mikron nozul kullanılarak sıralanır Diğer hücre sıralama makinelerinde (BD Biosciences). Optimizasyon bu ayarları için ayarlamalar) gerekebilir. </li><li> GFP pozitif protoplast bir 488 nm argon lazer kullanarak ve 580/30 bandpass (turuncu) vs 530/40 bandpass (yeşil) çıkışı komplo tanımlanır. GFP pozitif protoplast yüksek 580 popu içinde 530 düşük / düşük 580 nüfus ve ölü / ölmekte protoplast ve enkaz olmayan GFP protoplast sahip, yüksek 530/low 580 nüfus olacaklasyon (Şekil 2). <ol><li> RNA ekstre olacak olan protoplast ayırma zaman, protoplast bir indirgeyici madde ihtiva eden bir lizis tamponu en az 4 hacimde (örneğin, β-merkaptoetanol) doğrudan sıralanması. Buna ek olarak, tek bir örnek sıralama zamanı 20-30 dk, ve herhangi bir zamanda işlenmiş 2-3 numune maksimum sınırlı olmalıdır. </li><li> Kriteri protoplast görselleştirilmesi için, protoplast çözelti en az 8 birimleri A ve daha sonra konsantre protoplastlar için santrifüjleme ile toplanmış doğrudan sıralanması. </li></ol></li></ol> 3. Temsilcisi Sonuçlar Bu protokol, floresan aktive hücre tasnif (Şekil 1) için kullanılan Arabidopsis yaprağı, protoplast dan elde etmek için bir yöntem açıklanmaktadır. RNase ve transkripsiyonel inhibitörlerinin varlığında Protoplast kuşak hücreleri f önlerrom bir transkripsiyonel yanıt montaj. Bu otofloresans önemli düzeyde birçok ölü ve ölmekte protoplast, doğuran bir sonucu var. Bu yöntem ile hazırlanan protoplast sıralama zaman sıralama için kullanılan 580 nm vs 530 nm floresan grafikleri birkaç farklı toplumlarda görmek için bu nedenle çok yaygındır. Birlikte bu protokolde kullanılan cinslere ayırma kapıları ile bu örnekler Şekil 3 &#39;de gösterilmiştir. Protoplast çözüm A 8 cilt halinde sıralanır ve zenginleştirme doğrulamak için görselleştirme için toplanan. Şekil 2G bekçi hücreleri GFP ifade TP382 hattı kullanarak bu bir örnek gösteriyor olabilir. Önce ve amplifikasyon sonrası, bu yöntem kullanılarak elde edilen verimleri örnekleri arasında Tablo 1 &#39;de gösterilmektedir. Elde edilen miktarlar Ovation Pico WTA Sistem (500 pg-50 ng) ve bu nedenle s kullanılarak amplifikasyon için yeterlidirqPCR biri tarafından ubsequent analizi (Şekil 4), yeni nesil dizileme veya mikroarray. <img alt="Şekil 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Şekil 1. Deney için genel iş akışı. 1) Hasat Arabidopsis satırı ifade eden bir GFP gelen ilgi bırakır. 2) Hızlı ~ 1 mm genişliğinde şeritler halinde kesilir ve hemen protoplasting Çözelti ve vakum sızmak içine bu transfer. 3) 3-4 saat süreyle inkübe edin. 4) 70 mikron elekten yavaşça süzülen protoplast çözümü, santrifüjle alt tüpleri ve pelet protoplast yuvarlak aktarmak. 5) Derhal sıralama önce, 50 mikron ile tekrar süspansiyon protoplast ve sıralama tüp transfer filtresi. 6) Sıralama GFP pozitif ve negatif GFP canlı protoplast. 7) protoplast şimdi ya görsel analiz veya qPCR, yeni nesil dizileme veya mikroarray gibi teknikler kullanılarak yapılabilir. Şekil 2. Bu çalışmada kullanılan KC464, KC274 ve TP382 hatları. Adaxial epidermiste GFP gösteren bir KC464 yaprak A) enine kesit. B) protoplast KC464 yapraklarından elde edilen. Vaskülatürde GFP tanımı gösteren bir KC274 yaprak C) enine kesit. D KC274 yapraklarından elde edilen) protoplast. E) TP382 yaprak koruma hücrelerde GFP tanımı göstermektedir. F) protoplast TP382 yapraklarından elde edilen. TP382 yapraklarından elde edilen protoplastlar yüksek 530/low 580 popülasyonundan protoplast içeren GFP gösteren yaprak hücrelerin kompleks arka koruma hücre ifade GFP FACS ile elde zenginleştirme G) Örnek. AF: Konfokal mikroskop görüntüleri, G: Floresans mikroskop görüntüsü. Görüntülerdeki Ölçek çubukları 50 mm&#39;dir. <img alt="Şekil 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Şekil 3. 580/30 nm (turuncu) vs 530/40 nm (yeşil) bant geçiren filtreler (BD Akın hücre sıralayıcı) çıktısı tipik FACS edinimi nokta araziler. Gösterilen ayırma kapıları tipik olarak eleme sırasında kullanılan olanlardır. Bir düşük 530/low 580 nüfus gösteren inhibitörleri yokluğunda protoplasted Col-4 yaprak elde protoplast, A) Dot arsa. Nedeniyle inhibitörleri tarafından gerilme ve boyama için 580 floresan bir değişim gösteren inhibitörlerinin varlığında protoplasted ağırlıkça Col-4 yaprak elde protoplast, B) Dot arsa. Yüksek 530/low 580 popülasyonlarında popülasyonlarının içeren GFP gösteren inhibitörlerinin varlığında protoplasted sırasıyla KC74, KC464 ve TP382 hatları, gelen yaprak edilen protoplast dan CE) Dot araziler. GFP (yüksek 530/low 580) toplumlarda olayların yüzdeleri verilmiştir. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">büyük bir rakam görmek için buraya tıklayın</a> . e_content &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Şekil 4," src="/files/ftp_upload/4214/4214fig4.jpg" /> Şekil 4,. Şekil 3&#39;te gösterildiği gibi temsil eden kapı popülasyon fraksiyonu olarak GFP tanımı. Çoğaltır iki biyolojik sonra yapıldı GFP-özgü primerler (Tablo 2) ile Ovation Pico WTA sistemi ve qPCR kullanılarak amplifiye, her fraksiyonda tipi için elde edilmiştir. Gösterilen değerler yüksek (kırmızı), düşük (yeşil) ve ortalama bağıl değerlerdir. Yüksek 580 nüfusu ikiye bölünmüş durumda idi, düşük 530/low 580 ve tek bir biyolojik çoğaltmak yalnızca tek bir değer gösterilir böylece kullanıldığı için yüksek 530/low 580,. ACT2 (At3g18780) tüm örnekler için standart olarak kullanılmıştır. Yaprak: Tüm yaprak. Unsorted: Unsorted protoplast. GFP1: Yüksek 530/low 580 ve Rest1: düşük 530/low 580, GFP2: Yüksek 530/high 580 ve Rest2: Şekil 3 ve insert açıklanan düşük 530/high 580,. Sonuçlar bir doğrulama o vardırkriteri fraksiyonları (örneğin Şekil 2G) GFP hücre içeriğinin f optik değerlendirmeler. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">büyük bir rakam görmek için buraya tıklayın</a> . <table border="1"><tbody><tr><td> Örnek </td><td> Yaprakların sayısı </td><td> Hücre sayısı </td><td> Verim RNA (Ng) </td><td> Verim RNA (Güçlendirilmiş; ng) </td></tr><tr><td> Tüm yaprak A Tüm yaprak B </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Unsorted protoplast A Unsorted protoplast B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 A Rest1 A </td><td> 15 </td><td> 6039 (0.39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10783 (% 0.63 *) 57.040 (7.49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18337 (% 1.49 *) 62.405 (% 73.49 *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Tablo 1. Numuneler FACS ile toplandı ve canlı GFP-ifade eden protoplast ihtiva eden oranını belirlemek için qPCR ile analiz edilmiştir. Ayrıca Ovation Pico WTA Sistemi (NuGen) ile amplifikasyon önce ve sonra ng toplam RNA&#39;dan verim bu tabloya dahil edilmiştir. GFP1, GFP2, Rest1 ve Rest2 fraksiyonlar, Şekil 4&#39;te elemanı gösterilmiştir. Toplam hücre tür çalışma hücrelerinin * yüzdesi fraksiyonu içinde hücrelerin sayısı yanında parantez içinde verilmektedir. Bu yüzdeler arasında ilişki bulunmamaktadırFACS sıralama &#39;Rest&#39; kesirler için çalışır gibi her bir örnek için birbirlerine daha önce alınan istirahat hücreleri daha fazla sayıda nedeniyle GFP kesirler için daha durdu. Üreticinin protokole göre amplifikasyon reaksiyonları için girdi olarak kullanılan ** 50 ng. <table border="1"><tbody><tr><td> Astar boya </td><td> Sıra </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tablo 2. QPCR astar.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Çıkar çatışması ilan etti.

Biz protoplast nesil ve FACS kullanan sonraki hücre sıralama için yapraklarda GFP ifade Arabidopsis bitkilerin kullanımına izin veren bir yöntem tarif var. Bu yöntem, qPCR veya mikroarray ya tarafından amplifikasyon ve bu yüzden bir sonraki analiz için kullanılacak olan RNA, yeterli miktarlarda elde edilir. Kriteri fraksiyonlar son derece olarak qPCR (Şekil 2) ile gösterilen GFP-içeren hücreler için zenginleştirilmiştir. Yaprak şeritler inhibitörü içeren protoplast solüsyonu ile infiltre vakum olmuştur kadar canlı protoplast yüksek verimi elde etmek için bu prosedürün ilk adımları sırasında hızla çalışmak önemlidir. Buna ek olarak, 1 mm yaprak şerit üretirken, bu aşırı hasar ve bu nedenle daha düşük bir protoplast verim neden olarak, yapraklar yerine &quot;kesme&quot; püre ya da bunların dilim veya kesim için çok önemlidir. Yöntemi arasındaki kritik fark burada ve diğer publishe tarifd yöntem RNase inhibitörleri ve transkripsiyonel inhibitörlerinin kullanımı. Çoğu yöntemleri protoplast daha kolay elde edilebilir hangi Arabidopsis kökleri için geliştirilmiştir. Bununla birlikte, mezofil hariç, yaprakları ile çalışma zaman, protoplast üretim süresini artırmak için gereklidir. Bu nedenle, protoplast kuşak tedavinin kendisi (veriler gösterilmemiştir) bir sonucu olarak gen ekspresyonu değişikliklere karşı korumak için bu inhibitörleri dahil etmek önemlidir. Ancak, inhibitörlerin varlığı bu stresinden karşı hangi ile plastisite kaybına neden olarak protoplast daha savunmasız yapmak olasıdır kapalı genlerin veya geçiş yoluyla, bir transkripsiyon yanıt monte için bir yetersizlik yol açar prosedürü protoplasting. Biz, GFP-ifade eden Arabidopsis hatları bir dizi ile başarılı bir şekilde burada tarif edilen yöntem kullanılmıştır. Önemlisi, biz GFP hatları ya kuvvetli GFP ifade ile bu yöntemi kullanmışçekirdek, ya da çok daha zayıf bir non-localized/diffuse sitosolik bir şekilde, burada kullanılan KC464 ve KC274 hatları ile bir durumdur. Hatları Her iki tip yöntem ile uyumlu olan ve GFP-ifade eden protoplast arasında yüksek oranda zenginleştirilmiş fraksiyon için (Şekil 2 ve 3) elde edildi. Fluorofor ölü / ölüm hücreleri otofloresans canlı hücreleri seçmek için yeteneğimizi korumak amacıyla önemli ölçüde farklı olduğu floresans seçilmelidir rağmen metod, diğer floroforlar adapte olabilir.

<table border="1"><tbody><tr><td> Reaktif Adı </td><td> Şirket </td><td> Katalog numarası </td></tr><tr><td> Selülaz R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Selülaz RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Aktinomisin D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 mikron hücre süzgecinden </td><td> Balıkçı </td><td> FB35181 </td></tr><tr><td> 50 mikron filcon kâse tipi filtreler </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Yaprak primordium&#39;un başlangıcından sonra, biyomas birikim esas olarak hücre çoğalması ve yaprak 1 genişleme tarafından kontrol edilir. Bununla birlikte, Arabidopsis yaprağı çok farklı hücre tipleri ve çeşitli yapılar oluşan bir kompleks bir organdır. Aynı zamanda, büyüyen yaprak genişleyen durdurmak ve yaşlanması 1. geçmesi için ilk olmanın sapı en uzak hücreler, farklı gelişim aşamalarında hücreler içerir. Yaprağın içinde farklı hücreler bu nedenle bölünmesi uzayarak veya ayırıyoruz; aktif stresli veya ölü ve / veya herhangi bir zamanda kendi hücresel tip alt setleri uyaranlara yanıt. Bu yaprak zorlu genomik araştırma yapar: örneğin farklı hücresel yanıt bölgeler veya hücre tiplerinde faaliyet genetik ağların bütün yaprakları, sinyallerinden ifade verileri analiz ederken şaşırmış olacak, üretilen yanlış bir profil elde edilir. Bu adres için, several yöntemler hücre spesifik gen ifadesi çalışmalar imkan veren tarif edilmiştir. Bu lazer yakalama mikrodiseksiyon (LCM) 2 veya protoplast nesil ve sonraki floresan aktive hücre sıralama (FACS) 3,4, nükleer yağış 5 ve polysomes 6 immünopresipitasyon için son açıklanan INTACT sistemi için kullanılan GFP ifade bitkileri bulunmaktadır. FACS başarılı bir şekilde kök ucu hücre kimlik ve mesafe 3,7 genlerin büyük bir sayısını ifade profilleri üzerinde önemli bir etkisi olduğunu gösteren da dahil olmak üzere bir dizi çalışma için kullanıldı. GFP hatlarının FACS da kök azot yanıtları ve lateral kök gelişimi 8, tuz stresine kök 10 9 oksin dağıtımı sırasında hücre spesifik transkripsiyonel düzenleme göstermek ve Arabidopsis sürgün apikal meristem 11 bir gen ekspresyonu harita oluşturmak için kullanılır olmuştur. RağmenFACS önce otofloresans 12,13 dayalı Arabidopsis yaprak elde protoplast sıralamak için kullanılır olmuştur, yapraklarda GFP ifade Arabidopsis hatlarında FACS kadar kullanımı 4 çok sınırlı olmuştur. Aşağıdaki protokol biz protoplast nesil rejiminin etkilerini en aza FACS uyumlu Arabidopsis Yaprak protoplast elde etmek için bir yöntem açıklanmaktadır. Biz vasküler doku 14 ve TP382 Arabidopsis doğrultusunda, ifade GFP çift GFP ifade adaxial epidermisin 14 KC274 doğrultusunda, ifade GFP bir nükleer lokalizasyon sinyal bağlantılı yapıtaşıdır KC464 Arabidopsis hattı kullanarak yöntem gösterilmektedir bekçi hücreleri (veriler gösterilmemiştir; Şekil 2). Şu anda, ihtiyarlık çeşitli evrelerinde her iki hücre tipi geliştirme ve stres esnasında spesifik ifade, hem de heterojen hücre popülasyonları incelemek için bu yöntemi kullanarak.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Üretmek için bir yöntem<em&gt; Arabidopsis</em&gt; Belirli hücre popülasyonlarının çalışmaları için izin floresan aktive hücre sıralama (FACS) ile uyumlu yaprak protoplast. Bu yöntem, herhangi bir uyumlu<em&gt; Arabidopsis</emHücrelerinin bir alt kümesi olarak GFP ifade&gt; satırı.

Hücre Özgül Analizi<em&gt; Arabidopsis</em&gt; Floresans Aktif Hücre Ayırma kullanma Leaves

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.1K Görüntüleme.  University of Warwick. Üretmek için bir yöntem Arabidopsis Belirli hücre popülasyonlarının çalışmaları için izin floresan aktive hücre sıralama (FACS) ile uyumlu yaprak protoplast. Bu yöntem, herhangi bir uyumlu Arabidopsis satırı.

Video: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Bitki protoplast Floresan Aktif Hücre Ayırma

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Biyoloji

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Hücre tipi Özgül gösterilmeden FACS yardımlı kullanarak Doku ve Organ spesifik Fitokrom Yanıtları incelenmesi Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Manyetik Aktif Hücre Ayırma (LIMACS) kullanarak Lipid veziküllü aracılı Afinite Kromatografisi: Protein-lipit Etkileşim Analiz Roman Yöntemi

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) Etiketleme ve Çözünmüş Organik Kültür bağımsız Kimlik sonraki Floresan Aktive Hücre Sıralama Karbon-aşağılayıcı Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Cep Takip Boyalar kullanarak Hücre Bölünmesi İzleme için optimize Boyama ve Çoğalma Modelleme Yöntemleri

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Floresans Aktif Hücre Ayırma (FACS) Taze Dokular Normal ve Kanser ilişkili Fibroblastlar İzolasyonu

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Dev Virüs Karışım Ayırma için Floresan-Aktive Hücre Sıralama alternatif bir strateji olarak Tek Hücreli Mikro-aspirasyon

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

Fluorescence-Activated Cell Sorting for the Isolation of Scleractinian Cell Populations

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the mechanisms are not well understood. To investigate coral response to stressors, we need tools for analyzing cellular responses. In particular, we need tools that facilitate the application of functional assays to better understand how cell populations are reacting to stress. In the current study, we use fluorescence-activated cell sorting (FACS) to isolate and separate different cell populations in stony corals. This protocol includes: (1) the separation of coral tissues from the skeleton, (2) creation of a single cell suspension, (3) labeling the coral cells using various markers for flow cytometry, and (4) gating and cell sorting strategies. This method will enable researchers to work on corals at the cellular level for analysis, functional assays, and gene expression studies of different cell populations.

Corals create biodiverse ecosystems important for both humans and marine organisms. However, we still do not understand the full potential and function of many coral cells. Here, we present a protocol developed for the isolation, labeling, and separation of stony coral cell populations.

Skleraktin Hücre Popülasyonlarının İzolasyoniçin Floresan-Aktive Hücre Sıralaması

Coral reefs are under threat due to anthropogenic stressors. The biological response of coral to these stressors may occur at a cellular level, but the ...

Isolate Cell-Type-Specific RNAs from Snap-Frozen Heterogeneous Tissue Samples without Cell Sorting

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids potential pitfalls caused by the heterogeneity of tissues and unleashes the powerful transcriptome analysis. The protocol described here demonstrates how to use the Translating Ribosome Affinity Purification (TRAP) method to isolate ribosome-bound RNAs from a small amount of EGFP-expressing cells in a complex tissue without cell sorting. This protocol is suitable for isolating cell-type-specific RNAs using the recently available NuTRAP mouse model and could also be used to isolate RNAs from any EGFP-expressing cells.

This protocol aims to isolate cell-type-specific translating ribosomal mRNAs using the NuTRAP mouse model.

Hücre Tipine Özgü RNA'ları, Hücre Sıralama Olmadan Dondurulmuş Heterojen Doku Örneklerinden İzole Edin

Cellular heterogeneity poses challenges to understanding the function of complex tissues at a transcriptome level. Using cell-type-specific RNAs avoids ...

Fluorescence Lifetime Macro Imager for Biomedical Applications

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ranging from solid-state, O2-sensitive coatings to live animal tissue samples stained with soluble O2-sensitive probes. In particular, the nanoparticle-based near-infrared probe NanO2-IR, which is excitable with a 625 nm light-emitting diode (LED) and emits at 760 nm, was used. The imaging system is based on the Timepix3 camera (Tpx3Cam) and the opto-mechanical adaptor, which also houses an image intensifier. O2 phosphorescence lifetime imaging microscopy (PLIM) is commonly required for various studies, but current platforms have limitations in their accuracy, general flexibility, and usability.
The system presented here is a fast and highly sensitive imager, which is built on an integrated optical sensor and readout chip module, Tpx3Cam. It is shown to produce high-intensity phosphorescence signals and stable lifetime values from surface-stained intestinal tissue samples or intraluminally stained fragments of the large intestine and allows the detailed mapping of tissue O2 levels in about 20 s or less. Initial experiments on the imaging of hypoxia in grafted tumors in unconscious animals are also presented. We also describe how the imager can be re-configured for use with O2-sensitive materials based on Pt-porphyrin dyes using a 390 nm LED for the excitation and a bandpass 650 nm filter for emission. Overall, the PLIM imager was found to produce accurate quantitative measurements of lifetime values for the probes used and respective two-dimensional maps of the O2 concentration. It is also useful for the metabolic imaging of ex vivo tissue models and live animals.

This paper describes the use of a new, fast optical imager for the macroscopic photoluminescence lifetime imaging of long decay emitting samples. The integration, image acquisition, and analysis procedures are described, along with the preparation and characterization of the sensor materials for the imaging and the application of the imager in studying biological samples.

Biyomedikal Uygulamalar için Floresan Ömür Boyu Makro Görüntüleyici

This paper presents a new photoluminescence lifetime imager designed to map the molecular oxygen (O2) concentration in different phosphorescent samples ...