Die Arbeit in der Buchanan-Wollaston Labor auf Zelltyp, Entwicklungsstadium spezifische Profilierung wird durch die AGRON-omics Projekt (Grant # LSHG-CT-2006 bis 037.704) in der 6. Rahmenprogramm der EU der Europäischen Kommission unterstützt. Die Arbeit in der Gifford Labor auf Zelltyp-spezifische Profilierung wird durch eine BBSRC New Investigator Grant (BB/H019502/1) unterstützt. Die KC274 und KC464 Arabidopsis-Linien wurden aus AAR Webb (University of Cambridge) erhalten.

Ein. Protoplasten-Generation <ol><li> Ernte Blattmaterial und schneiden Sie in 1 mm breite Streifen (Abbildung 1) mit einer Rasierklinge. Für Proben, die mehr als ein einzelnes Blatt bis zu 15 Blätter leicht vor dem Schneiden gestapelt werden. </li><li> Sofortüberweisung Blatt Streifen in einen 9 cm Runde Petrischale mit 20 ml Lösung A (400 mM Mannitol, 20 mM MES Hydrat, 20 mM KCl, 10 mM CaCl 2, 2 mM MgCl 2, 0,1% BSA und 2,5 mM β-Mercaptoethanol, pH 5,7) einschließlich protoplasting Enzymen (1,2% Cellulose R-10, 0,6% Cellulose und 0,4% RS Macerozym R-10) und RNase-Inhibitoren und transkriptionelle (1 × ProtectRNA und 10 ug / ml Actinomycin D); sanft trennen die blatt Streifen und Vakuum zu infiltrieren für 2 × 5 min. </li><li> Ort Petrischale auf einem Orbitalschüttler auf 90 rpm bei Raumtemperatur und Protoplasten für 3-4 Std. <ol><li> Während der Inkubation werden die Streifen sollten Blatt voneinander getrennt werden, unter Verwendung von aSatz von flachen Pinzette, um halb Stundentakt. </li></ol></li><li> Legen Sie eine 70 um Zellsieb (Fisher Scientific) in einem 50 ml-Tube und schonend filtern protoplasting Lösung durch. Dies entfernt die blatt Streifen, die durch das Sieb zurückgehalten werden, während es den Protoplasten zu durchlaufen wird. </li><li> Waschen Sie die Blätter Streifen mit 4 ml Lösung A und sanft Filter durch dasselbe Sieb. </li><li> Übertragen Sie die Protoplasten in Rundbodengefäße und zentrifugieren Sie die Protoplasten Lösung bei 300 xg für 5 min zur Pelletierung der Protoplasten. </li><li> Sanft absaugen so viel von der Überstand wie möglich, ohne die Protoplasten. </li><li> Waschen Protoplasten mit 5 ml Lösung A und Zentrifuge bei 300 × g für 5 min. Überstand entfernen </li><li> Resuspendieren der Protoplasten in einem geeigneten Volumen der Lösung A unter Verwendung einer Pasteur-Pipette oder eines abgeschnittenen Spitze P1000. </li></ol> 2. FACS von Blattprotoplasten </p&gt; <ol><li> Unmittelbar vor Sortierung, resuspendieren Protoplasten unter Verwendung eines (nicht geschnitten) P1000 Spitze um Protoplasten Verklumpen zu vermeiden. </li><li> Übertragen Protoplasten zu einer Sortiermaschine Röhre durch ein 50 um Filcon Filter (BD Biosciences) und verdünnter gegebenenfalls zur Vermeidung von Verstopfungen der Düse des Zellsorters. Die Protoplasten werden unter Verwendung eines sortierten Düse 100 um bei einem Druck von 20 psi (Hülle) und 21 bis 21,5 psi (Probe), einer Frequenz von 39,2 kHz und einer Ereignisrate von &lt;4000 (diese Einstellungen sind optimal auf einem BD Influx Zellsortierer (BD Biosciences). Optimierung auf andere Zelle Sortiermaschinen müssen Anpassungen an diesen Einstellungen). </li><li> GFP-positive Protoplasten werden anhand einer 488 nm Argon-Laser und Plotten der Ausgabe von dem 580/30 Bandpass-Filter (orange) gegenüber dem 530/40 Bandpass-Filter (grün). GFP-positive Protoplasten werden im hohen 530/low 580 Bevölkerung, mit nicht-GFP Protoplasten im Low 530/580 niedrig Bevölkerung und tot / sterbenden Protoplasten und Schutt in die hohe 580 PopulationenVerordnung (Abbildung 2). <ol><li> Beim Sortieren von Protoplasten aus dem RNA extrahiert werden soll, sollte Protoplasten direkt in mindestens 4 Volumen eines Lysepuffers enthaltend ein Reduktionsmittel (z. B. β-Mercaptoethanol) aufgelöst werden. Darüber hinaus sollte die Art Zeit eines einzigen Probe auf 20-30 min und einem maximalen von zwei bis drei Proben zu einem beliebigen Zeitpunkt verarbeitet begrenzt. </li><li> Zur Visualisierung von sortierten Protoplasten, sollte die Protoplasten direkt in wenigstens 8 Volumen der Lösung A und anschließend durch Zentrifugation gesammelt, um die Protoplasten zu konzentrieren sortiert werden. </li></ol></li></ol> 3. Repräsentative Ergebnisse Dieses Protokoll beschreibt ein Verfahren zur Gewinnung von Protoplasten aus Arabidopsis Blätter, die für fluoreszenzaktivierten Zellsortierung (Abbildung 1) verwendet werden. Protoplast Generation in Gegenwart von RNase und Transkriptions-Inhibitoren verhindert die Zellen from Montieren eines transkriptionellen Reaktion. Das hat auch zur Folge, was zu zahlreichen Toten und Sterbenden Protoplasten, die ein erhebliches Maß an Autofluoreszenz haben. Beim Sortieren der Protoplasten mit diesem Verfahren hergestellt ist es daher sehr häufig mehrere verschiedene Populationen in Graphen der 580 nm vs 530 nm Fluoreszenz für die Sortierung verwendet sehen. Beispiele hierfür zusammen mit den Sortierweichen in diesem Protokoll verwendet, sind in Abbildung 3 dargestellt. Protoplasten können in 8 Volumen der Lösung A sortiert und gesammelt zur Visualisierung, um die Anreicherung zu verifizieren. 2G zeigt ein Beispiel für diese Verwendung der TP382-Linie, die GFP exprimiert in den Schließzellen. Beispiele erzielten Ausbeuten unter Verwendung dieses Verfahrens, sowohl vor als auch nach der Verstärkung, sind in Tabelle 1 gezeigt. Die erhaltenen Mengen sind ausreichend für die Amplifikation unter Verwendung Ovation Pico WTA System (500 pg-50 ng) und daher subsequent Analyse entweder durch qPCR (Abbildung 4), Next Generation Sequencing oder Mikroarray. <img alt="Abbildung 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> Abbildung 1. Insgesamt Workflow für das Experiment. 1) Ernte Blätter von Interesse von einer GFP-exprimierenden Arabidopsis Linie. 2) Schnell in ~ 1 mm breite Streifen geschnitten und sofort übertragen diese in protoplasting Lösung und Vakuum zu infiltrieren. 3) für 3-4 Stunden inkubieren. 4) vorsichtig Filtrat Protoplasten Lösung durch einen 70 um-Sieb, Transfer zum unteren Rohre und Pellet Protoplasten durch Zentrifugation abzurunden. 5) Unmittelbar vor Sortierung, resuspendieren Protoplasten und Transfer zu einem Sortier-Rohr durch ein 50 um-Filter. 6) Sortieren GFP positiven und negativen GFP lebensfähige Protoplasten. 7) Die Protoplasten können nun entweder visuell analysiert werden oder unter Verwendung von Techniken wie qPCR nächsten Generation Sequenzierung oder Mikroarray. Abbildung 2. Die KC464, KC274 und TP382 Linien in dieser Studie verwendet. A) Transversalschnitt einer KC464 Blatt mit GFP-Expression in der adaxialen Epidermis. B) Die Protoplasten aus Blättern KC464 abgeleitet. C) Transversalschnitt einer KC274 Blatt mit GFP-Expression in dem Gefäßsystem. D) Die Protoplasten aus Blättern KC274 abgeleitet. E) TP382 Blatt mit GFP-Expression in den Schließzellen. F) Protoplasten aus Blättern TP382 abgeleitet. G) Beispiel der Anreicherung durch FACS von GFP exprimierenden Schließzellen im Komplex Hintergrund Blattzellen, zeigt GFP enthaltenden Protoplasten aus der hohen 530/low 580 Population von Protoplasten aus Blättern TP382 gewonnen wird. AF: Konfokalmikroskop Bilder; G: Fluoreszenzmikroskop Bild. Maßstabsbalken in Bilder 50 um. <img alt="Abbildung 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> Abbildung 3. Typische FACS-Dot-Plots Übernahme des Ausgangssignals aus den 580/30 nm (Orange) vs 530/40 nm (grün) Bandpassfiltern (BD Influx Zellsortierer). Die Sortier-Toren gezeigt, sind die in der Regel bei der Sortierung verwendet. A) Dot Grundstück von Col-4 Blatt abgeleitet Protoplasten, in Abwesenheit von Inhibitoren protoplasted, zeigt eine einzige niedrige 530/low 580 Bevölkerung. B) Dot-Plot von wt Col-4 Blatt-, Wurzel-Protoplasten in Gegenwart von Inhibitoren protoplasted, das eine Verschiebung in der 580-Fluoreszenz aufgrund von Stress und Färbung durch die Inhibitoren. CE) Dot Plots aus Blatt-, Wurzel Protoplasten aus den KC74, und KC464 TP382 Linien, die jeweils in Gegenwart von Inhibitoren protoplasted, zeigt den GFP enthaltenden Populationen im hohen 530/low 580 Populationen. Die Prozentsätze der Ereignisse in den GFP (high 530/low 580) Populationen gegeben sind. <a href="http://www.jove.com/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">Klicken Sie hier, um größere Zahl anzuzeigen</a> . e_content &quot;fo: keep-together.within-page =&quot; always &quot;&gt; <img alt="Abbildung 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> Abbildung 4. GFP-Expression in den repräsentativen Population gated Fraktionen wie in Abbildung 3 dargestellt. Zwei biologischen repliziert wurden für jede Fraktion Typs erhalten wird, amplifiziert unter Verwendung der Ovation Pico WTA System und qPCR mit GFP-spezifische Primer (Tabelle 2) wurde dann durchgeführt. Die angegebenen Werte sind die höchsten (rot), am niedrigsten (grün) und die durchschnittliche relative Werte. Die hohe Population 580 war in diesem Fall zweigeteilt, niedrige und hohe 530/low 580 530/low 580, für die eine einzige biologische Replikation so verwendet wurde nur der einzelnen Wert dargestellt ist. ACT2 (At3g18780) wurde als Standard für alle Proben verwendet. Blatt: Whole Blatt. Unsorted: Unsorted Protoplasten. GFP1: hohe 530/low 580 und REST1: niedrig 530/low 580, GFP2: hohe 530/high 580 und REST2: niedrig 530/high 580, wie in Abbildung 3 und des Einsatzes beschrieben. Die Ergebnisse sind eine Verifikation of optische Beurteilung der GFP Zellinhalt in der sortierten Fraktionen (zB 2G). <a href="http://www.jove.com/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">Klicken Sie hier für eine größere Abbildung zu sehen</a> . <table border="1"><tbody><tr><td> Probe </td><td> Anzahl der Blätter </td><td> Anzahl der Zellen </td><td> RNA-Ausbeute (Ng) </td><td> RNA-Ausbeute (Verstärkt; ng) </td></tr><tr><td> Ganze Blatt A Ganze Blatt B </td><td> 1 1 </td><td> - - </td><td> 8001 10525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> Unsorted Protoplasten A Unsorted Protoplasten B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 A REST1 A </td><td> 15 </td><td> 6039 (0,39% *) 55389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B REST1 B </td><td> 15 </td><td> 10.783 (0,63% *) 57.040 (7,49% *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 REST2 </td><td> 15 </td><td> 18.337 (1,49% *) 62.405 (73,49% *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> Tabelle 1. Proben gesammelt mittels FACS analysiert und mit qPCR zu bestimmen, welche Fraktion enthielt Live GFP-exprimierenden Protoplasten. Auch in dieser Tabelle nicht enthalten ist die gesamte RNA-Ausbeute in ng vor und nach der Verstärkung mit dem Ovation Pico WTA System (NuGen). GFP1, GFP2, REST1 und REST2 Fraktionen werden wie in dem Einsatz in 4 gezeigt. * Der Prozentsatz an Zellen der Gesamtzellzahl Sortierlauf wird in Klammern neben der Anzahl der Zellen in der Fraktion gegeben. Diese Prozentzahlen sind nicht zu korrelierendeneinander für jede Probe die FACS sortiert wird für &#39;Rest&#39; Fraktionen wurden früher als GFP Fraktionen aufgrund der viel größeren Anzahl von Rest-Zellen gesammelt gestoppt. ** 50 ng als Input für Amplifikationsreaktionen verwendet, gemäß dem Protokoll des Herstellers. <table border="1"><tbody><tr><td> Grundierung </td><td> Folge </td></tr><tr><td> mGFP5-ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5-ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> Tabelle 2. QPCR Primer.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

Keine Interessenskonflikte erklärt.

Wir haben ein Verfahren, das die Verwendung von Arabidopsis-Pflanzen, die GFP in den Blättern für Protoplasten und folgenden Zellsortierung mittels FACS ermöglicht beschrieben. Diese Methode führt zu ausreichenden Mengen an RNA zur Amplifikation und somit die anschließende Analyse durch entweder qPCR oder Mikroarray verwendet werden. Die Fraktionen sortiert werden besonders für GFP-haltigen Zellen, wie durch qPCR (Abbildung 2) nachgewiesen angereichert. Um hohe Ausbeuten von Live-Protoplasten zu erreichen ist es wichtig, schnell zu arbeiten, während der ersten Schritte des Verfahrens, bis das Blatt Streifen gewesen Vakuum mit dem Inhibitor-haltigen Protoplasten Lösung infiltriert. Darüber hinaus bei der Erzeugung 1 mm Blatt Streifen ist es sehr wichtig zu schneiden oder schneiden Sie die Blätter anstatt &quot;Chop&quot; oder zerdrücken, da dies führt zu einer übermäßigen Schäden und damit einem niedrigeren Protoplasten Ausbeute. Ein entscheidender Unterschied zwischen dem hier beschriebenen Verfahren und andere Published Methoden ist die Verwendung von RNase-Inhibitoren und Transkriptions-Inhibitoren. Die meisten Methoden sind für Arabidopsis Wurzeln, aus denen Protoplasten leichter erzeugt werden können entwickelt. Bei der Arbeit mit Blättern, mit Ausnahme Mesophyll, ist es notwendig, die Protoplasten Generationszeit erhöhen. Daher ist es wichtig, diese Inhibitoren umfassen, gegen Veränderungen in der Genexpression als Ergebnis des Protoplasten Generation Behandlung selbst (Daten nicht gezeigt) zu schützen. Allerdings führt die Anwesenheit der Inhibitoren zu einer Unfähigkeit, eine Transkriptions-Reaktion montieren, entweder durch Umschalten Gene an-oder ausgeschaltet, die wahrscheinlich machen die Protoplasten anfälliger ist, da dies zu einem Verlust der Plastizität mit denen die Belastungen des Zählers protoplasting Prozedur. Wir haben die hier beschriebenen Verfahren erfolgreich mit einer Anzahl der GFP-exprimierenden Arabidopsis-Linien verwendet. Wichtig ist, dass wir diese Methode mit GFP exprimieren GFP entweder stark in verwendetder Kern, oder viel schwächer in einer cytosolischen non-localized/diffuse Weise, wie es der Fall mit den KC464 und KC274 Linien hier verwendet. Beide Arten von Leitungen sind mit dem Verfahren und ergeben hoch angereicherten Fraktionen von GFP-exprimierenden Protoplasten (Abbildung 2 und 3). Das Verfahren kann leicht auf andere Fluorophore angepasst werden, obwohl das Fluorophor für die Fluoreszenz, die signifikant verschieden von der Autofluoreszenz von tot / sterbenden Zellen, um die Fähigkeit, lebende Zellen auszuwählen bewahren ausgewählt werden muss.

<table border="1"><tbody><tr><td> Name des Reagenzes </td><td> Firma </td><td> Katalog-Nummer </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> Sigma-Aldrich </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> Sigma-Aldrich </td><td> R7397 </td></tr><tr><td> Actinomycin D </td><td> Sigma-Aldrich </td><td> A1410 </td></tr><tr><td> 70 um Zellsieb </td><td> Fischer </td><td> FB35181 </td></tr><tr><td> 50 um Filcon Tasse-Typ-Filter </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

Nach der Initiierung des Blattes Primordium wird Biomasseakkumulation hauptsächlich durch die Zellproliferation und die Expansion in den Blättern 1 gesteuert. Jedoch ist die Arabidopsis Blatt ein komplexes Organ aus vielen verschiedenen Zelltypen und mehrere Strukturen. Gleichzeitig enthält das wachsende Blattzellen in verschiedenen Stadien der Entwicklung, die mit den Zellen am weitesten von der Blattstiel die erste zu stoppen Expandieren und durchlaufen ein Seneszenz. Verschiedene Zellen innerhalb des Blattes werden daher Dividieren, Verlängern oder Unterscheidungswert ist, wirksamen, gespannten oder tot, und / oder als Reaktion auf Reize in Teilsätze von ihren zellulären Typs zu einem bestimmten Zeitpunkt. Dies macht genomische Untersuchung des Blattes herausfordernden: zum Beispiel bei der Analyse Expressionsdaten aus ganzen Blättern, Signale von genetischen Netze in unterschiedlichen Zonen oder zellulären Antwort Zelltypen verwechselt werden, was zu einer ungenauen Profil erzeugt wird. Um dieses Problem anzugehen, sehrere Methoden beschrieben worden, die es ermöglichen Studien von zellspezifischen Genexpression. Hierzu gehören Laser-Mikrodissektion (LCM) 2 oder GFP exprimierenden Pflanzen für Protoplasten und folgenden fluoreszenzaktivierten Zellsortierung (FACS) 3,4, das vor kurzem beschriebene INTACT System für nukleare Niederschlag 5 und Immunpräzipitation von Polysomen 6 verwendet. FACS wurde erfolgreich für eine Reihe von Studien, einschließlich zeigt, dass die Cell-Identität und Entfernung von der Wurzelspitze eine signifikante Wirkung auf die Expression Profilen einer Vielzahl von Genen 3,7 aufwies. FACS von GFP-Linien sind auch verwendet worden, um zellspezifische Transkriptionsregulation während Wurzel Stickstoff Antworten und seitlichen Wurzelentwicklung 8, Salzstress 9 Auxin Verteilung in der Wurzel 10 zu demonstrieren und einen Genexpression Karte der Arabidopsis Sprossapikalmeristem 11 zu erstellen. ObwohlFACS benutzt worden ist, um Arabidopsis Blatt abgeleitet Protoplasten auf 12,13 Autofluoreszenz zu sortieren, hat bisher die Verwendung von FACS auf Arabidopsis-Linien, die GFP in den Blättern sehr begrenzt 4. In dem folgenden Protokoll beschreiben wir ein Verfahren zur Gewinnung von Arabidopsis Blattprotoplasten, die kompatibel sind mit FACS wobei gleichzeitig die Auswirkungen des Protoplasten Generation Regimes. Wir demonstrieren die Methode mit dem KC464 Arabidopsis-Linie, die ausdrückliche GFP in der adaxialen Epidermis 14, KC274 Linie, die ausdrückliche GFP in das Gefäßgewebe 14 und dem TP382 Arabidopsis-Linie, die Ausdruck einer doppelten GFP zu einer Kernlokalisierungssignal in Zusammenhang Konstrukt die Schließzellen (Daten nicht gezeigt; Abbildung 2). Wir sind derzeit mit dieser Methode sowohl Zelltyp-spezifische Expression während der Entwicklung und Stress, sowie heterogene Zellpopulationen in verschiedenen Phasen der Seneszenz zu studieren.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Verfahren zur Herstellung<em&gt; Arabidopsis</em&gt; Blattprotoplasten, die kompatibel mit der fluoreszenzaktivierten Zellsortierung (FACS) sind, so dass für Studien spezifischer Zellpopulationen. Diese Methode ist kompatibel mit allen<em&gt; Arabidopsis</em&gt; Linie, die GFP drückt in einer Untergruppe von Zellen.

Zellspezifische Analyse<em&gt; Arabidopsis</em&gt; Blätter mit Fluorescence Activated Cell Sorting

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.2K Aufrufe.  University of Warwick. Verfahren zur Herstellung Arabidopsis Blattprotoplasten, die kompatibel mit der fluoreszenzaktivierten Zellsortierung (FACS) sind, so dass für Studien spezifischer Zellpopulationen. Diese Methode ist kompatibel mit allen Arabidopsis Linie, die GFP drückt in einer Untergruppe von Zellen.

Serie: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Fluorescence Activated Cell Sorting von Pflanzenprotoplasten

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Forschung

Biologie

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

Untersuchung Tissue-und Organ-spezifische Phytochrom Antworten mit FACS-gestützte zelltypspezifisch Expression Profiling in Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

Heterokaryon Technik zur Analyse von Zelltyp-spezifischen Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

Lipidvesikel-vermittelte Affinitätschromatographie unter Verwendung von Magnetic Activated Cell Sorting (LIMACS): Eine neue Methode zur Protein-Lipid-Wechselwirkungen Analyze

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) Labeling und anschließende Fluorescence Activated Cell Sorting für Kultur-unabhängige Identifizierung von gelöstem organischem Kohlenstoff abbauenden Bakterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of plant leaves or vertebrate lungs further difficulties arise from multiple transitions in refractive index between cellular components, between cells and airspaces and between the biological tissue and the rest of the optical system. Moreover, refractive index mismatches lead to attenuation of fluorophore excitation and signal emission in fluorescence microscopy. We describe here the application of the perfluorocarbon, perfluorodecalin (PFD), as an infiltrative imaging medium which optically improves laser scanning confocal microscopy (LSCM) sample imaging at depth, without resorting to damaging increases in laser power and has minimal physiological impact2. We describe the protocol for use of PFD with Arabidopsis thaliana leaf tissue, which is optically complex as a result of its structure (Figure 1). PFD has a number of attributes that make it suitable for this use3. The refractive index of PFD (1.313) is comparable with that of water (1.333) and is closer to that of cytosol (approx. 1.4) than air (1.000). In addition, PFD is readily available, non-fluorescent and is non-toxic. The low surface tension of PFD (19 dynes cm-1) is lower than that of water (72 dynes cm-1) and also below the limit (25 - 30 dyne cm-1) for stomatal penetration4, which allows it to flood the spongy mesophyll airspaces without the application of a potentially destructive vacuum or surfactant. Finally and crucially, PFD has a great capacity for dissolving CO2 and O2, which allows gas exchange to be maintained in the flooded tissue, thus minimizing the physiological impact on the sample. These properties have been used in various applications which include partial liquid breathing and lung inflation5,6, surgery7, artificial blood8, oxygenation of growth media9, and studies of ice crystal formation in plants10. Currently, it is common to mount tissue in water or aqueous buffer for live confocal imaging. We consider that the use of PFD as a mounting medium represents an improvement on existing practice and allows the simple preparation of live whole leaf samples for imaging.

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

We describe the use of perfluorodecalin as an infiltrative mounting medium. This is a simple method for improving depth of imaging in Arabidopsis thaliana leaf tissue with minimal physiological impact.

Eine einfache Methode zur Bildgebung Arabidopsis Leaves Mit Perfluordecalin als Infiltrative Imaging Medium

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of ...

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Quantitative Live Cell Fluoreszenz-Mikroskopie Analyse von Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

Optimiert Färbung und Proliferation Modeling-Methoden für die Zellteilung Überwachung mit Cell-Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

Isolation von Normal und Krebs-assoziierte Fibroblasten von Fresh Gewebe durch Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

Single Cell Micro-Aspiration als Alternative zur fluoreszenzaktivierten Zellsortierung für die Trennung von Riesenviren

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...