Este proyecto fue financiado por la Fundación Samuel Roberts Noble. Los autores agradecen a Mss. Janie Gallaway y Colleen Elles para un excelente cuidado de las plantas, y la Sra. Katie Brown para las ilustraciones. También nos gustaría dar las gracias a Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda y el Sr. Isaac Greenhut ayuda técnica durante la creación de este protocolo.

1. Crecimiento de las plantas y Target Silenciador del Gen <ol><li> Las condiciones de crecimiento de las plantas: <ol><li> Siembre N. semillas benthamiana en suelo-menos mezcla para macetas, Metro-Mix 350 y germinar las semillas en una cámara de crecimiento. Cualquier otro suelo o suelo-menos medio también se pueden utilizar en lugar de Metro-Mix. </li><li> Trasplante de tres semanas de edad plantas de semillero en macetas individuales y crecer en un invernadero mantenido a 21 ± 2 ° C junto con otras condiciones de crecimiento, como se detalla en la literatura anterior 12. Dos a tres días después del trasplante, las plantas se pueden utilizar para TRV inoculación. </li></ol></li><li> Creciendo TRV2 clones: TRV es un virus bipartito y su genoma consta de ARN1 y ARN2. ARN1 codifica una ARN polimerasa dependiente de ARN y una proteína de movimiento 20,21. ARN2 codifica una proteína de cubierta (CP) y dos proteínas no estructurales de los RNAs subgenómicos 21. Se requieren dos ARN1 y ARN2 para la formación de vir maduradosomos partículas y su propagación 20,21. construcción de la biblioteca de ADNc en el vector TRV2 se describe en la literatura previa 22,23. Brevemente, la biblioteca VIGS utilizado en este estudio se construyó a partir del ARN extraído de tejidos de las hojas expuestas a diferentes elicitores bióticos y abióticos. <ol><li> Tome cabo por Agrobacterium (cepa GV2260) que contiene los clones de ADNc en el vector TRV2 (una placa de 96 pocillos) del congelador. Poco a poco descongelarlos y después de los cultivos alcancen la temperatura ambiente, inocular el cultivo de Agrobacterium individuo en medio Luria-Bertani (LB) placa de agar con rifampicina (10 mg / ml) y kanamicina (50 mg / ml) utilizando un replicador de 96 pines. </li><li> Incubar las placas a 28 ° C durante dos días. Por lo general, crecen cuatro colonias idénticas para cada clon para que adecuada inóculo Agrobacterium está disponible para pinchar la inoculación de dos plantas. Realice todos los pasos bajo condiciones estériles. </li></ol></li><li> VIGS: <ol><li> CrecerAgrobacterium (GV2260) llevar a TRV1 a 28 ° C en medio líquido LB con los antibióticos mencionados anteriormente. Células de la cosecha por centrifugación a partir de cultivos desarrollados durante una noche, volver a suspender en el tampón de inoculación (MES 10 mM, pH 5,5, 200 mM de acetosiringona), y se incuba durante 3 horas a temperatura ambiente en un agitador a 50 rpm. </li><li> Recoger las células por centrifugación y se vuelve a suspender en tampón MES 5 mM (pH 5,5) e inocular (DO600 = 0,3) en el lado abaxial de 3-4 N. benthamiana hojas usando una jeringa sin aguja. Procedimiento de inoculación detallada se demuestra en la literatura anterior 24. Más tarde, en el sitio de inoculación TRV1, inocular respectivos TRV2 colonias mediante un pinchazo en las hojas con un palillo. </li><li> Mantener las plantas con una nutrición adecuada ya que el crecimiento vigoroso es importante para VIGS eficientes 12. Alrededor de dos semanas después de la inoculación de las transcripciones de genes específicos se empiezan a reducir y las plantas están listas para patógenos inoculadosblación a las tres semanas después de la inoculación TRV. </li></ol></li></ol> 2. Preparación de los cultivos no hospedantes de patógenos y la inoculación Plant <ol><li> Detalles de los agentes patógenos utilizados en este estudio: Pseudomonas syringae pv. Tabaci, P. syringae pv. tomato T1, P. syringae pv. glycinea y Xanthomonas campestris pv. vesicatoria se utilizan en este estudio. Crecer P. cepas syringae en King B (KB) medio líquido suplementado con rifampicina (10 mg / ml), kanamicina (50 mg / ml) a 28 º C durante 12 horas. Crecer X. campestris pv. vesicatoria en medio líquido LB durante 16 horas. Todos los patógenos albergan un plásmido que puede expresar GFPuv como se describe en la literatura anterior 19. </li><li> Preparación de los cultivos para la inoculación de patógenos de plantas: <ol><li> Cosecha de las células bacterianas por centrifugación y confirmar la presencia de fluorescencia verde usando largo walámpara UV velength en la oscuridad. Lavar las células dos veces con agua estéril y se las vuelve a suspender a la concentración deseada con agua estéril. </li><li> Se inocula el patógeno correspondiente (s) al envés de las hojas de genes diana silenciadas (5 º a 8 º) como puntos (alrededor de 1,5 cm diámetro). Varios agentes patógenos no hospedantes se pueden probar simultáneamente para su crecimiento en el gen diana plantas silenciadas. Simultáneamente inocular el patógeno host que ésta se puede utilizar como un control positivo para la visualización en el crecimiento bacteriano planta. También el control de vectores inocular (TRV :: 00) plantas. </li></ol></li></ol> 3. La observación de in planta crecimiento de patógenos bacterianos <ol><li> Exponer las hojas inoculadas a una larga luz ultravioleta de longitud de onda en la oscuridad. Las colonias bacterianas se pueden ver como puntos fluorescentes verdes en el lado abaxial de la hoja en el fondo de la fluorescencia roja emitida por la superficie de la hoja. </li><li> Observar el crecimiento de patógenosde 2 días después de la inoculación (dpi) a 5 dpi. La observación cotidiana durante este intervalo de tiempo es necesario. </li><li> Después de la primera pantalla, la lista corta de los clones cuya silenciamiento resultados en el crecimiento de uno o más patógenos no hospedante (s). </li><li> Repita VIGS para los clones seleccionados y otra vez probar la respuesta de las plantas de genes silenciados para no hospedante patógeno (s). Este segundo nivel de detección se lleva a cabo para eliminar los falsos positivos obtenidos en la primera pantalla. </li></ol> 4. Confirmación de Plantas preseleccionados para la Resistencia no hospedantes Comprometida <ol><li> Silenciar los clones de ADNc seleccionados de la pantalla como se describe anteriormente. Inocular toda la planta con el patógeno no hospedante (s) por inmersión de las plantas con los respectivos cultivos de patógenos con 0,01% (v / v) Silwet L-77 y sometiendo las plantas sumergidas a vacío durante 3 - 5 min. Cuantificar el crecimiento bacteriano mediante ensayo de crecimiento convencional 6,18,19 como se describe a continuación. </li><li> A 0 h después de la inoculación (hpi),3 ppp y 5 dpi, recogen dos muestras de hojas de cinco repeticiones biológica para cada patógeno no hospedante (s) hojas inoculadas con un punzón de hoja (0,5 cm 2). Moler las muestras de hojas, serie diluido y placa de la savia en el KB medio de agar suplementado con antibióticos y se incuba correspondientes a 28 ° C durante 2 días. Contar las colonias bacterianas utilizando un contador de colonias y calcular el crecimiento de bacterias en las hojas como se describe en la literatura anterior 6. </li><li> Las plantas no hospedantes susceptibles a patógenos (s) deben mostrar un mayor número de crecimiento de patógenos en comparación con el control de vectores. </li></ol> 5. La secuenciación del inserto e identificación de gen diana <ol><li> Realizar la PCR de colonias para el clon seleccionado utilizando att B1 y attB2 cebadores o utilizando los cebadores que flanquean el sitio de clonación en el vector de TRV2. Ejecute el producto de PCR en el gel y se les presentarán para la amplificación de la banda única. </li><li> Inserción de genes de plantas en el vector TRV2 puede ser secuenciado usando attBcebadores o cebadores que flanquean el sitio de clonación. </li><li> Realizar BLAST usando la secuencia e identificar los detalles de genes. </li><li> Obtener la secuencia génica de longitud completa junto con las regiones sin traducir (UTR). </li><li> Seleccione 300-400 bp fragmentos de tres regiones diferentes de la secuencia y clonar ellos en TRV2 vector. Independientemente realizar VIGS utilizando los tres VIGS construcciones y confirmar el compromiso de la resistencia de no huésped en las tres plantas de genes silenciados. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

No tenemos nada que revelar.

Planta de inmunidad limita el crecimiento de patógenos no hospedantes y por lo tanto, poco o nada de fluorescencia verde se emite desde la planta de control de vectores de hojas inoculadas con patógenos no hospedante bajo luz UV de longitud de onda larga (Figura 3D). Sin embargo, cuando un gen implicado en la resistencia de no huésped es silenciada, las plantas de genes silenciados favorecen el crecimiento de la fluorescencia verde y no hospedante patógeno se ve (Figura 3E). Este es...

Resistencia no hospedantes es la resistencia de todas las especies de plantas contra razas de un patógeno en particular 1,2. Esto imparte amplio espectro y resistencia a las enfermedades en las plantas duradera 2,3. Sin embargo, su mecanismo, en particular contra patógenos bacterianos, no se entiende bien 4. La detección de mutantes o plantas silenciadas que la resistencia de no huésped de compromiso, y de alto rendimiento de perfiles de transcripción para la identificación de genes expresados ​​diferencialmente durante la resistencia no hospedante 5-9 son dos enfoques principales usados ​​anteriormente para la disección de la resistencia no hospedante bacteriana. Debido a que la resistencia no huésped es controlada por un complejo mecanismo (s) 4 con la participación de muchos genes, un enfoque genómico funcional de alto rendimiento para la identificación de genes es esencial para una mejor comprensión del mecanismo de resistencia no hospedante (s). Inducida por el virus de silenciamiento génico (VIGS) ha sido utilizado con éxito para silenciar vegetal endógenoAhora genes en muchas especies de plantas. 10,11 Nicotiana benthamiana es una de las mejores plantas adecuados para VIGS 10,12 y su proyecto de secuencia del genoma está disponible 13. virus del cascabel del tabaco (TRV) basados ​​en VIGS ha sido ampliamente utilizado como herramienta genética inversa para caracterizar los genes implicados en la resistencia no hospedante 2,4,14. Esto VIGS vectores y derivados ya están disponibles a través del Centro de Recursos Biológicos Arabidopsis (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS también se ha utilizado como una herramienta genética hacia delante para la identificación de genes implicados en la inmunidad planta de 15-17, especialmente la resistencia no hospedante 6,18. La evaluación de la respuesta hipersensible (HR) mediada por la muerte celular inducida por las plantas contra un patógeno no hospedante específica y la evaluación de la muerte celular inducida por la enfermedad son dos ensayos principales que se utilizan principalmente para IDENTIFICAgen susceptibles g silenciada plantas. Sin embargo, la muerte celular HR se induce sólo contra los agentes patógenos de tipo II no hospedantes y no contra los de tipo I patógenos no hospedantes 2. Por lo tanto, los ensayos de recursos humanos no se pueden usar universalmente para identificar estrategias de resistencia no hospedantes utilizados por las plantas, especialmente contra la amplia gama de agentes patógenos de tipo I no hospedantes. Además, la pérdida parcial de la resistencia no hospedante en una planta silenciada gen no siempre conduce a síntomas de la enfermedad 6 y por lo tanto de puntuación enfermedad no se puede utilizar para la identificación de plantas comprometer la resistencia no hospedante. Por el contrario, la evaluación de la proliferación de patógenos no hospedantes en las plantas silenciadas de genes es un mejor método para el estudio de la pérdida de resistencia en las plantas no huésped de genes silenciados. En comparación con el ensayo de crecimiento convencional de 6,19, un método más rápido para evaluar el crecimiento bacteriano no hospedante en las plantas silenciadas de genes puede acortar el tiempo requerido para la detección genética hacia adelante. Nos han informado de un método de observación de bacteriasluz de l crecimiento de patógenos en las hojas por simple vista bajo la luz ultravioleta (UV) con bacterias que expresan la proteína verde fluorescente (GFP) 19. En este manuscrito se demuestra la utilidad de GFPuv expresando bacterias patógenas no hospedantes para facilitar la identificación de los genes silenciados plantas que están comprometidos para la resistencia no huésped. Esta metodología es precisa para la identificación de las plantas sensibles y susceptibles de cribado de alto rendimiento.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

No hospedantes resistencia a las enfermedades de las plantas frente a patógenos bacterianos es controlado por las vías de defensa complejas. La comprensión de este mecanismo es importante para el desarrollo de plantas resistentes a las enfermedades duraderas contra la amplia gama de patógenos. Inducida por el virus de silenciamiento génico (VIGS) basado en la detección genética hacia adelante es un enfoque útil para la identificación de genes que confieren resistencia a la defensa de las plantas no huésped. Virus del cascabel del tabaco (TRV) vector basado en VIGS es el vector más eficiente VIGS hasta la fecha y se ha utilizado de manera eficiente para silenciar genes diana endógenos en Nicotiana benthamiana. En este manuscrito, se demuestra un método de detección genética adelante para el silenciamiento de clones individuales de una biblioteca de ADNc de N. benthamiana y la evaluación de la respuesta de las plantas silenciadas de genes para la resistencia no huésped frente a patógenos comprometida no hospedantes, Pseudomonas syringae pv. tomate T1, P. syringae pv. glycINEA y X. campestris pv. vesicatoria. Estos patógenos bacterianos están diseñados para expresar proteínas GFPuv y sus colonias fluorescentes verdes se pueden ver a simple vista bajo luz UV en las plantas inoculadas no hospedantes de patógenos si el objetivo de genes silenciados está implicado en la difusión de la resistencia no huésped. Esto facilita la identificación fiable y más rápida de las plantas de genes silenciados no hospedantes susceptibles a los agentes patógenos. Además, la información gen candidato prometedor puede ser conocido por la secuenciación del inserto de genes de plantas en TRV vectorial. Aquí se demuestra la capacidad de alto rendimiento de la genética hacia adelante VIGS mediadas para identificar los genes implicados en la resistencia no hospedante. Aproximadamente, 100 ADNc pueden ser silenciados individualmente en alrededor de dos a tres semanas y su importancia en la resistencia de no huésped frente a varios patógenos bacterianos no hospedantes pueden ser estudiados en una semana a partir de entonces. En este manuscrito, enumeramos los pasos detallados que participan en esta prueba. Adelante VIGS mediada genética Screening enfoque se puede extender no sólo a la identificación de los genes implicados en la resistencia no huésped, sino también para el estudio de los genes que imparten varias tolerancias de estrés biótico y abiótico en varias especies de plantas.

Objetivo principal de este estudio es demostrar un método para la identificación fácil y precisa de genes silenciados N. benthamiana plantas que están comprometidos para la resistencia no huésped. Hay cuatro pasos principales en esta metodología. El primer paso es silenciar individualmente gran número de genes utilizando TRV-VIGS. Habíamos silenciada alrededor de 5.000 genes de 6,18 durante un período de alrededor de 1,5 años utilizando el protocolo representado en la Figura 1.</str...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Inducida por el virus de silenciamiento génico es una herramienta útil para la identificación de genes implicados en la resistencia de las plantas hospedantes. Se demuestra el uso de patógenos bacterianos que expresan GFPuv en la identificación de genes silenciados plantas susceptibles a los agentes patógenos no hospedantes. Este método es fácil, rápido y facilita la detección a gran escala y protocolo similar se puede aplicar al estudio de otras interacciones planta-microorganismo.

VIGS mediada por delante de detección genética para la identificación de genes implicados en la resistencia no huésped


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K vistas.  The Samuel Roberts Noble Foundation.  Inducida por el virus de silenciamiento génico es una herramienta útil para la identificación de genes implicados en la resistencia de las plantas hospedantes. Se demuestra el uso de patógenos bacterianos que expresan GFPuv en la identificación de genes silenciados plantas susceptibles a los agentes patógenos no hospedantes. Este método es fácil, rápido y facilita la detección a gran escala y protocolo similar se puede aplicar al estudio de otras interacciones ...

Video: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi detección de los factores del huésped implicados en Vaccinia Infección del virus utilizando Drosophila Celdas

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Investigación

Inmunología e Infección

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Humano In Vitro Supresión como herramienta de cribado para el reconocimiento de un estado inicial de desequilibrio inmunológico

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Recuperación Genética inversa mediada por norovirus murino Infecciosas

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Enfoques Forward genéticos en<em&gt; Chlamydia trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

El uso de ARN de interferencia para Investigar la respuesta inmune innata en macrófagos de ratón

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Identificación de nuevos genes asociados con alginato producción en<em&gt; Pseudomonas aeruginosa</em&gt; Uso de Mini-<em&gt; Himar1</em&gt; La mutagénesis mediada por transposón Mariner

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Detección rápida de la transcriptasa inversa del VIH y inhibidores de la integrasa

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

Adelante Genética pantallas usando macrófagos identificar<em&gt; Toxoplasma gondii</empara la resistencia a IFN-γ por células dependiente&gt; Genes Importante Inmunidad Autónoma

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Los ensayos basados ​​en la microscopía para la selección de alto rendimiento de los factores del huésped que participan en<em&gt; Brucella</em&gt; Infección de células Hela

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.