Este trabajo fue financiado por los Institutos Nacionales de Salud (NIH) Otorga CA127231 y el Premio Fundación Damon Runyon Investigador Clínico (IC 1502) (para SM). Nos gustaría dar las gracias al profesor Zdenek Dvorak desde Palacky Universidad de Olomouc, República Checa por sus útiles conocimientos sobre la discusión portabilidad de esta técnica para su institución y estandarización del protocolo.

1. Construcción de PXR y SRC-1 Las fusiones en vectores de levadura <ol><li> La amplificación por PCR de humano PXR LBD (107-434 aminoácidos) y SRC-1 humano de longitud completa (aminoácidos 1 a 1401). <ol><li> Utilice pSG5-hPXR plásmido 8 como plantilla PXR LBD, utilizar plásmido pCMX-SRC1 como SRC-1 plantillas. </li><li> Descongele la PCR Supermix, plantillas de ADN y cebadores (ver Materiales), mantenerlos en hielo. </li><li> Añadir 0,25 g / l de ADN plantilla 1 l, 10 mM de pares de cebadores 2 l cada uno, PCR Supermix 45 l y agregar H 2 O para traer volumen total de 50 l. </li><li> Conjunto de PCR en un ciclo de 94 ° C durante 2 min, 20 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg y 72 ° C durante 2 min, luego un ciclo de 72 ° C durante 10 min para la extensión. Compruebe los productos de PCR mediante la ejecución de un 1% en gel de agarosa. </li></ol></li><li> Productos de PCR en vectores de clonación Y2H. <ol><li> Purificar los productos de PCR de 1% en gel de agarosa. Resumen PXR, LBD, la PCR, y Y2H vector de pSH2-1 conBamHI y SalI; digieren SRC-1 PCR y Y2H vector pGADNOT con NotΙ y SalΙ. Para ello, agregue 1 g de ADN, 3 l de 10x tampón de reacción, 1 enzimas de restricción mu l, y, finalmente, H 2 O para traer volumen total de 30 l. </li><li> Coloque las muestras de digestión en 37 ° C baño de agua durante 1 hora. Compruebe la digestión mediante la ejecución de un 1% en gel de agarosa. </li><li> Purificar muestras de digestión de un 1% en gel de agarosa, ligar digerido productos de PCR y vectores Y2H y transformar a las células competentes DH5a. </li><li> Elige las colonias y aislar el ADN plásmido. </li></ol></li><li> Identificar el ADN plásmido pSH2-1-PXR por digestión BamHI / SalI, identificar pGADNOT-SRC-1 ADN plásmido por digestión con NotI / SalI. Verifique todo el ADN plásmido positivo por secuenciación. </li></ol> 2. La levadura de dos ensayos de híbridos <ol><li> Inocular la cepa de levadura en 5 ml de YPAD e incubar durante la noche por agitación constante (220 rpm a 30 ° C). Nota: La cepa de Saccharomyces cerevisiae era CTY10-5d(Mat A trp ade2 1-901 leu2-3, 112 his3-200 ga l4 - GAL80 - URA3 :: lexA-lacZ) que contiene un gen integrado GAL1-lacZ con lexA operador 10. Para obtener células de levadura viables resistentes a ketoconazol, pero los que no llevar a alteraciones del transportador como una causa de la resistencia a los azoles 18-20, nuevas cepas de levadura CTY10-5d se obtuvieron por primera ERG3 borrado (Δ ERG3) y luego la introducción de deleción adicional en ERG11 (ERG3 Δ / Δ ERG11) genes por recombinación homóloga. Los detalles de la construcción se han descrito en un manuscrito publicado previamente 6. </li><li> El día siguiente (por la mañana), inocular la levadura (1:20) en 5 ml de YAPD y se incuba para obtener un OD 600 ~ 0,2 por agitación constante (220 rpm a 30 ° C). </li><li> Sedimenten las células a 2000 rpm en una microcentrífuga durante 2 minutos y descartar el sobrenadante. A continuación, lavar el pellet dos veces con agua tratada en autoclave y una vez con 0,1 M LiAc. </li><li> Después del lavado final, desechar el sobrenadante y agregar los siguientes reactivos al sedimento celular: 240 l PEG 3500 al 50% w / v, 36 l 1 M LiAc, 50 l 2 mg / ml hervida ssDNA de esperma de salmón, H 2 O 34 l. Vortex para mezclar, añadir 1 g PSH-PXR y 1 mg pGADNOT-SRC-1 DNA y mezclar. </li><li> Transferir la mezcla al poliestireno tubo de fondo redondo, agitar la transformación, la mezcla (220 rpm a 30 ° C) durante 30 min. Mueva el tubo a 42 º C baño de agua y se incuba durante 30 min adicionales. </li><li> Centrifugar el tubo a 2000 rpm durante 2 min y separar el sobrenadante. Lave pellet una vez con agua tratada en autoclave. </li><li> Añadir 100 l de agua estéril en el tubo, vuelva a suspender las células mediante el dedo medio, tocando y pipeta, luego la placa en placas de -His/-Leu Dropout Medio (Formulación por litro -His/-Leu Dropout Medio: 20 g de dextrosa, 1,7 g YNB, 0,67 g CSM-His/-Leu, sulfato de amonio 5 g, 1,5% de agar) y IncUbaté a 30 ° C durante 3-4 días para aislar transformantes. </li></ol> 3. Ensayo Filtro de X-gal <ol><li> Cortar membrana de nitrocelulosa con el tamaño de una parte de una placa de Petri. Etiquetar la membrana de nitrocelulosa para marcar la orientación. </li><li> Coloque membrana de nitrocelulosa previamente marcada en colonias de levaduras, asegurarse de que la membrana está en contacto con la superficie del medio de placa. </li><li> Retire la membrana, colóquelo con las colonias hacia arriba sobre un papel de filtro de 3 mm, y colocar la membrana y el papel de filtro a -80 ° C durante 15 min. </li><li> Haga solución X-gal. Añadir 50 l 20 mg / ml de X-gal y 15 l β-mercaptoetanol al 5 ml de Z-buffer (tampón 1 L contiene 16,1 g de Na 2 HPO 4 7H 2 O, 5,5 g de NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO4 • 7H 2 O). Si Z tampón se mantuvo a 4 ° C, llevarlo a la temperatura ambiente antes de la adición de estos reactivos. </li><li> Coloque dos círculos de papel de filtro de 3 mmen una placa de Petri y déjelos remojar con 5 ml de solución de X-gal. Escurrir el exceso de tampón de la placa de Petri y colocar la membrana de nitrocelulosa con el lado de las colonias hacia arriba. </li><li> Cierre la tapa, asegúrese de que la membrana está en contacto completo con el papel de filtro y es completamente mojada. Envuelva la placa de Petri en papel de aluminio y se incuba a 37 ° C durante 30 min para toda la noche. </li></ol> 4. Líquido de ensayo β-gal <ol><li> Crecer levadura en medio líquido -His/-Leu Dropout a OD 600 de 0,7. </li><li> Transferencia de 1 ml de medio en un tubo de microcentrífuga de 1,5 ml y centrifugar a 3000 rpm durante 2 min. Eliminar el sobrenadante. </li><li> Añadir 1 ml de tampón Z para volver a suspender el sedimento, se centrifuga a 3000 rpm de nuevo durante 2 min. Eliminar el sobrenadante. </li><li> Añadir 150 l de buffer Z con 2ME para volver a suspender el sedimento celular, mezclar a continuación, añadir 50 l de cloroformo y 20 l 0,1% de SDS. Vigorosamente agite la muestra durante 15 segundos. </li><li> Añadir 700 l de solución de ONPG (1 mg / ml en Z BUFfer). Ajuste el temporizador, se incuba a 30 ° C el tiempo suficiente para permitir que el color amarillo para el desarrollo y tenga en cuenta el tiempo de reacción total. </li><li> Añadir 500 l de 1 M de Na 2 CO 3 para detener la reacción y determinar la absorbancia a 420 nm. El blanco es la solución de ONPG 700 l, más 500 l 1 M Na 2 CO 3. </li></ol> Calcular Unidades de Miller de la siguiente manera: Miller Unidades = (A420 * 1000) / (A600 * min * ml) A420: unidades de absorbancia a 420 nanómetros; A600: unidades de absorbancia a 600 nanómetros; min: el tiempo de reacción en minutos; ml: el volumen de reacción en ml

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

No hay conflictos de interés declarado.

En nuestro ensayo Y2H modificado, hemos identificado los residuos importantes para las interacciones ketoconazol sobre PXR 6. Desde SRC-1 es un coactivador (y se clonó en el vector de pGADNot), también a prueba si SRC-1 podría activar la expresión de lacZ cuando se clona en el sistema de vector PSH y si esto cambiaría el perfil de activación y / o afectar a la permeabilidad de el ensayo de dos híbridos de levadura. Uso de nuestros plásmidos rediseñados que llevamos a cabo dos ensayos de híbridos en ...

La levadura de dos híbridos (Y2H) de ensayo es ampliamente utilizado para descubrir las interacciones proteína-proteína y, más recientemente, para el descubrimiento de nuevas moléculas pequeñas que alteran los complejos proteína-proteína de interacción 7, 8, 9, 10, 11. Sin embargo, los enfoques convencionales de este ensayo, que se utiliza para la detección de drogas o &quot;hits&quot;, no permiten la detección de residuos de interacción alostéricos de compuestos químicos en las superficies de la proteína-proteína, que cuando se alteran aún interactuar y permitir el interrogatorio de los residuos alterados 11 . De hecho, un método (s) de tal manera, si es factible desarrollar, permitiría un sistema de levadura manejable para la evaluación de alto rendimiento de los residuos de interacción alostéricos críticos para la proteína-proteína interacción interrupción. En el contexto del descubrimiento de fármacos, la forma más directa para establecer la interacción de los compuestos con proteínas implicaría la determinación estructural (por ejemplo, cristalización del complejo de proteína-inhibidor). Estos métodos son cumbersome, utilizar los recursos elaborados y que no sea técnicamente factible realizar estudios estructurales de cada proteína. Sistemas de detección de drogas genética tratable se han establecido en las bacterias 1, 2 y otros sistemas modelo, como los mamíferos de dos híbridos. Sin embargo, estos sistemas necesitan optimización y sistemas alternativos como Y2H siguen siendo los más probado en el descubrimiento de fármacos. Hay limitaciones que incluyen poca sensibilidad y fiabilidad de las interacciones utilizando métodos singulares 13, sin embargo, un único ensayo Y2H puede ser modificado para responder a preguntas específicas respecto a los residuos de interacción. En el campo de la investigación de los receptores nucleares, Y2H se ha utilizado para definir las proteínas que interactúan 14, sin embargo, estas interacciones proteína rara vez se han utilizado para definir la naturaleza en el que los ligandos / antagonistas interactúan con complejos de proteína de receptor nuclear. Por lo tanto, nuestro laboratorio se centró esfuerzos en la definición de un método, especialmente para proteínas receptoras que no estánque se presta fácilmente a proteómicos métodos basados, eso sería desenterrar nuevo ligando / antagonista interactuar residuos utilizando una plataforma de descubrimiento Y2H basado inversa. Basándonos en nuestra anterior conclusión de que el ketoconazol altera PXR y su activador SRC-1, hemos desarrollado un novedoso sistema de reversa Y2H que nos permiten definir e interrogar a los residuos de ketoconazol interactuar en PXR 6. Nuestro método se basa en las propiedades de la proteína GAL4 de levadura que consiste en dominios separables responsables de la activación de unión a ADN y la transcripción. La proteína PXR LBD se expresa como una fusión con el dominio de unión a ADN LexA (ADN-BD), mientras que la longitud total co-activadores SRC-1 (coactivador del receptor de esteroides 1) las proteínas se expresan como fusiones al dominio de activación de GAL4 (AD ). Interacción entre PXR y SRC-1 proteínas de fusión conduce a la activación transcripcional de los sitios de unión de GAL4-que contiene el gen reportero de β-Lac Z que está integrado en el Genom levadurae. Ketoconazol, un antagonista de PXR, interrumpe PXR y SRC-1 interacción 15, 16, 17 y que puede detectar la interacción de PXR y SRC-1 en presencia o ausencia de ketoconazol después de la tinción colonias sobre filtros para la actividad de X-gal. El principio de Y2H se ilustra en la Figura 1 y el procedimiento experimental se resume en la Figura 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

Como un regulador crítico de la inflamación y el metabolismo de fármacos, pregnano receptor X (PXR), juega un papel importante en la fisiopatología de la enfermedad que une el metabolismo y la inflamación (por ejemplo, la esteatosis hepática) 1,2. Ha habido muchos avances en la identificación de ligandos agonistas de PXR, sin embargo, hay descripciones limitadas de antagonistas similares a las drogas y sus sitios de unión en PXR 3,4,5. Un obstáculo fundamental ha sido la incapacidad para purificar eficientemente la proteína de longitud completa para estudios estructurales con antagonistas a pesar de que PXR se clonó y caracterizó en 1998. Nuestro laboratorio desarrolló una nueva levadura de alto rendimiento basado en dos híbridos de ensayo para definir un antagonista, ketoconazol de, residuos de unión en PXR 6. Nuestro método implica la creación de bibliotecas mutacionales que rescatar el efecto de mutaciones individuales en la superficie de AF-2 de PXR espera que interactúe con ketoconazol. Rescate o &quot;ganancia de función&quot; second mutaciones pueden realizarse de tal manera que las conclusiones relativas a la interacción genética de ketoconazol y el residuo (s) de superficie en PXR son factibles. Por lo tanto, hemos desarrollado una evaluación de la levadura de dos híbridos de alto rendimiento de mutantes PXR que interactúan con su coactivador, SRC-1. El uso de este enfoque, en el que se modificó la levadura para acomodar el estudio del fármaco antifúngico, ketoconazol, hemos podido demostrar mutaciones específicas en PXR enriquecidos en los clones incapaces de unirse al ketoconazol. Por lógica inversa, llegamos a la conclusión de que los residuos originales son residuos de la interacción directa con ketoconazol. Este ensayo representa una novela, ensayo genético manejable para detectar sitios de unión sobre las superficies antagonistas de receptores nucleares. Este ensayo podría aplicarse a cualquier fármaco, independientemente de su potencial citotóxico a la levadura, así como a la proteína (s) celular que no pueden ser estudiados utilizando la biología estructural estándar o métodos proteómicos basada. Peligros potenciales incluyen la interpretación de los datos (métodos complementarios de utilidad), relición en un solo método Y2H, experiencia en el manejo de la levadura o la realización de dos ensayos de híbridos de levadura, y la optimización del ensayo.

Se realizó un ensayo para ver si podíamos detectar una lectura colorimétrica de la asociación de PXR y receptor de esteroides coactivador-1 (SRC-1). Dado que la levadura tiene una producción significativa de esterol, que previamente se ha demostrado que la expresión de lacZ en la levadura puede ser inducida sin la necesidad de ligando exógeno adicional. Hemos encontrado que la expresión de lacZ (colonias azules) también es inducida en la cepa de levadura transformada con PXR y SRC-1, sin embargo, no hay inducci...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

El ketoconazol se une a y antagoniza pregnano X activación del receptor (PXR). De levadura de alto rendimiento pantallas de mutantes PXR definen una región única para la unión ketoconazol. Este método de genética de la levadura descubre la interacción del receptor nuclear novedosas con ligandos que se asocian con los sitios de unión de la superficie.

Invierta levadura de dos sistema híbrido para identificar mamíferos Receptor Nuclear Residuos que interactúan con ligandos y / o antagonistas

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K vistas.  Albert Einstein College of Medicine.  El ketoconazol se une a y antagoniza pregnano X activación del receptor (PXR). De levadura de alto rendimiento pantallas de mutantes PXR definen una región única para la unión ketoconazol. Este método de genética de la levadura descubre la interacción del receptor nuclear novedosas con ligandos que se asocian con los sitios de unión de la superficie. 

Video: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Proteómica para identificar proteínas que interactúan con los canales de cationes P2X2 ligando

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Investigación

Biología

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-ubiquitina levadura membrana base de dos híbridos (MITO) del sistema: Una poderosa herramienta para identificar interacciones proteína-proteína

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Análisis de la cinética de exportación nuclear de ARNm en células de mamífero por microinyección

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

RNAi de detección para identificar fenotipos postembrionarios en C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

Modificado levadura sistema híbrido de dos para identificar proteínas que interactúan con el factor de crecimiento progranulina

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Screening siRNA para identificar ubiquitina y reguladores del sistema ubiquitina-como de las vías biológicas en células de mamífero en cultivo

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

Detección de ligandos estrogénica en productos de Cuidado Personal con una pantalla de estrógeno levadura optimizado para el laboratorio de enseñanza de pregrado

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Un análisis basado en la citometría de flujo para identificar compuestos que alteran la Unión del ligando de quimiocina CXC marcada con fluorescencia 12 al CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

Examen de la dinámica nuclear de levadura de ficción mitotica y meiótica por microscopía de células vivas de fluorescencia

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

Una estrategia de dos pasos que combina la modificación epigenética y las señales biomecánicas para generar células pluripotentes de mamíferos

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...