Los autores agradecen la Fundación Robert W. Deutsch, la Agencia de Reducción de Amenazas de Defensa (DTRA), y la Fundación Nacional de Ciencias Emergentes Fronteras en la Investigación y la Innovación (EFRI) para el apoyo financiero. Los autores también agradecen a la Maryland NanoCenter y su FabLab apoyo instalación de salas limpias.

1. microfabricación del chip de microfluidos <ol><li> Preparar Electroquímica Viruta <ol><li> Patrón Oro Electrodos <ol><li> Enjuague un espacio en blanco 4 &#39;&#39; oblea de silicio (calidad de primer grado) con acetona, metanol, e isopropanol (&quot;AMI&quot; limpio). Enjuague el isopropanol de la oblea con agua desionizada (DI) seguido de secado con pistola de N 2. </li><li> Crecer una gruesa capa de pasivación 1 m SiO2 con la deposición de vapor químico mejorada por plasma herramienta (PECVD). Depositar una capa de espesor de 200 Å de cromo seguido de una capa de espesor de 2.000 Å de oro con una herramienta de pulverización catódica DC. </li><li> Spin &quot;PR1&quot; fotorresistente positivo (parámetros de giro: 3.000 rpm, 1000 rpm / s, 30 s) para crear película uniforme ~ 1,6 m de espesor. Pre-hornear la oblea durante 1 min a 100 ° C en una placa caliente. </li><li> Exponer la oblea con 190 mJ / cm 2 a 405 nm de longitud de onda a través de una fotomáscara. Desarrollar la oblea durante 30 segundos en 352 developer y enjuague la oblea con DI y secar con N2 arma. </li><li> Grabe el oro con grabador de oro durante 1,5 min. Grabe el cromo con mordiente de cromo para el ~ 30 seg. Enjuague la oblea con DI y secar con N2 arma. </li><li> Pele el fotoprotector con &quot;AMI&quot; procedimiento de limpieza. NOTA: OXIDANTE FUERTE Y POTENCIALMENTE EXPLOSIVA. </li><li> Limpie la oblea con 4: 1 H 2 SO 4: H 2 O 2 mezcla (&quot;Piranha&quot; limpia) durante 1 min. Enjuague la oblea con DI y secar con N2 arma. </li></ol></li><li> Patrón Platino Electrodos <ol><li> Spin &quot;PR2&quot; fotorresistente positivo (parámetros de giro: 3.000 rpm, 1000 rpm / s, 30 s) para crear película uniforme ~ 1.4 m de espesor. Pre-hornear la oblea durante 1 min a 100 ° C en una placa caliente. </li><li> Exponer la oblea con 30 mJ / cm 2 a 405 nm de longitud de onda a través de una fotomáscara. Hornee la oblea durante 45 segundos a 125 ° C en una placa caliente. Flood exponerla oblea con 1.000 mJ / cm 2 a 405 nm de longitud de onda sin una fotomáscara. Desarrollar la oblea durante 2 minutos en 6: 1 desarrollador AZ400K y enjuague la oblea con DI y secar con N2 arma. </li><li> Deposita una capa gruesa 400 de titanio seguido de una capa gruesa de 1.600 Å de platino usando un sistema de evaporación por haz de electrones. </li><li> Levante fotorresistente en un baño de acetona a ultrasonidos durante 5 min, seguido de enjuague con acetona e isopropanol. Enjuague la oblea con DI y secar con N2 arma. </li></ol></li></ol></li><li> Preparar Canales ensayo <ol><li> Preparar Molde para Canales de ensayo <ol><li> Enjuague un espacio en blanco 4 &#39;&#39; oblea de silicio (grado de calidad de prueba) con &quot;AMI&quot; procedimiento de limpieza. Enjuague el isopropanol de la oblea con DI seguido de secado con pistola de N 2. </li><li> Spin &quot;PR3&quot; fotorresistente negativo (parámetros de hilatura de 2 pasos:. Paso uno - 600 rpm, 120 rpm / s, 10 s Paso dos - 1.150 rpm, 383 rpm / seg,27 seg) para crear película uniforme ~ 100 m de espesor. Pre-hornear la oblea en una placa caliente (parámetros de cocción de 2 pasos:. Paso uno - la rampa encima de la temperatura ambiente a 65 ° C a 300 ° C / hr y mantenga la temperatura durante 10 minutos Paso 2 - rampa de hasta 95 ° C a 300 ° C / hr y temperatura de mantenimiento durante 30 min). </li><li> Exponer la oblea con 2.500 mJ / cm 2 a 405 nm de longitud de onda a través de una fotomáscara. Post-hornear la oblea a acelerar hasta 95 ° C a 300 ° C / hr y mantenga la temperatura durante 10 minutos en un plato caliente. Desarrollar la oblea durante 10 min en propilenglicol monometil éter acetato (PGMEA) desarrollador. Enjuague la oblea con isopropanol y se seca con N 2 arma. </li></ol></li><li> Fabrique Canales ensayo <ol><li> Preparar 10: 1 polidimetilsiloxano (PDMS) mezcla (20 g de elastómero, 2 g de agente de curado) y desgasificar completamente en una cámara de vacío durante 20 min. </li><li> Definir un recinto alrededor de la oblea molde con papel de aluminio y verter lentamente el curado PDMSsobre el molde. </li><li> Hornear el molde con el PDMS en un horno de caja (parámetros de cocción de 2 pasos:. Paso uno - 5 min rampa encima de la temperatura ambiente a 80 ° C Paso 2 - mantenga a 80 ° C durante 17 min). </li><li> Despegue la PDMS del molde y colocar en papel de aluminio. Cortar los chips de ensayo con un cuchillo cirujano, definir agujeros con una herramienta de troquelado de la biopsia. </li></ol></li></ol></li></ol> 2. Montar el dispositivo <ol><li> Alinear manualmente los canales de ensayo PDMS con los electrodos de trabajo en el chip electroquímica. PDMS pega bien al chip electroquímica, el sellado de los canales y la prevención de fugas. </li><li> Conecte un tubo flexible (OD 0.087 &#39;&#39; y el ID de 0,015 &#39;&#39;) a un codo de plástico o conector recto mediante un tubo flexible corto como un adaptador (OD 0.1875 &#39;&#39; y el ID de 0.0625 &#39;&#39;). Fije los conectores a cada una de las entradas perforados en el dispositivo. </li><li> Conectar una jeringa en el otro extremo deel tubo y coloque la jeringa en una bomba de jeringa. Alternativamente cambiar el conjunto de una jeringa, un tubo, y un conector de acuerdo con el procedimiento paso requerido en la sección 3 y su solución correspondiente. </li></ol> 3. Analizar ADN Hibridación NOTA: Introducir cada solución lentamente en el canal a una velocidad de flujo de 200 l / h hasta que se llena todo el canal. <ol><li> Funcionalizar cada microcanal vertical con una secuencia de sonda de ADN monocatenario diferente (realizar en paralelo a los 3 microcanales verticales separadas): <ol><li> Llenar cada microcanal con una solución diferente de incubación sonda de ADN monocatenario (tampón de fosfato 10 mM, NaCl 100 mM, 10 mM tris (2-carboxietil) fosfina (TCEP), y 1 sonda de ssDNA M), y se incuba durante 1 hora seguido de lavado del microcanal con PBS. </li><li> Llenar los microcanal con una solución que contiene 1 mM de 6-mercapto-1-hexanol (MCH) en un tampón de PBS 10 mM, NaCl 100 mM y 1,395 mM TCEP, y incubate durante 1 hora seguido de lavado de la microcanal con PBS. </li></ol></li><li> Levante el PDMS, girar 90 ° a una orientación horizontal, y colocar hacia abajo para mostrar filas separadas de cámaras de reacción con cada fila que contiene un contador único y electrodo de referencia (Figura S1). </li><li> Rellena los microcanales con solución de medición de control de 4x concentran citrato sódico salino tampón (SSC), y se incuba durante 20 min. </li><li> Medición de fondo: Completa los microcanales con 5 mM de ferricianuro de ferrocianuro / 5 mM en solución de PBS y registrar los valores de impedancia del sistema electroquímico para diferentes frecuencias (espectroscopia de impedancia electroquímica; EIS) usando un potenciostato conectado a la de trabajo, contador, y electrodos de referencia ( EIS parámetros: intervalo de frecuencia de 1 MHz a 0,1 Hz, 10 puntos de datos de frecuencia por década, 25 mV de amplitud, 5 mV de polarización frente al electrodo de referencia). Repetir esta medición para cada electrodo de trabajo en los microcanales. </li&gt; <li> Mida la hibridación de ADN (realizar para cada objetivo ssDNA no complementario y complementaria). <ol><li> Rellena los microcanales con destino solución de medición ssDNA de 4x concentrado tampón SSC que contiene 1 M de la meta de ssDNA, y se incuba durante 20 min. Mida el ADN según la etapa 3.4. </li></ol></li></ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

Los autores no tienen nada que revelar.

Nuestros procedimientos demuestran la fabricación de un biochip electroquímico basado en microfluidos y su utilización para el análisis de los eventos de hibridación de ADN. A través de un proceso de microfabricación de alto rendimiento controlada desarrollamos un dispositivo compuesto por canales microescala integrados con una serie de transductores electroquímicos. Hemos ideado parámetros de procesamiento controlados para el procedimiento de fotolitografía del chip electroquímica y el molde a través de un ...

Lab-on-a-chip de microfluidos dispositivos (LOC) proporciona numerosas ventajas en el diagnóstico clínico, monitoreo ambiental y la investigación biomédica. Estos dispositivos utilizan canales de microfluidos para controlar el flujo de fluido a las regiones del chip donde una variedad de procedimientos puede tener lugar incluida la mezcla de reactivo, de afinidad basada en la unión, transducción de señales, y la célula de cultivo de 1-4. Microfluídica proporciona muchas ventajas sobre las herramientas de diagnóstico clínicos convencionales, tales como lectores de placas de micropocillos o ensayos de cambio de gel electroforético. Los dispositivos microfluídicos requieren de 2 a 3 órdenes de magnitud (nanolitros en oposición a microlitros) menos reactivos para llevar a cabo ensayos similares. Además, estos dispositivos pueden aumentar la velocidad por la cual algunos eventos biológicos se producen debido al confinamiento más pequeña de las especies dentro de los canales 5,6. En tercer lugar, los sensores pueden ser integrados dentro de los dispositivos de microfluidos que utilizan técnicas de litografía y aguafuerte, que pueden proporcionar Detectio sin etiquetasn. Por último, estos dispositivos son baratos de producir y requieren poco trabajo por parte del técnico para operar 7-10. Detección libre de etiquetas típicamente se realiza usando un transductor óptico o eléctrico. Los dispositivos ópticos pueden presentar un mejor rendimiento de detección debido a la interferencia menor con analitos en la muestra. Sin embargo, su rendimiento se ve comprometida en los casos en que el fondo de la muestra tiene la misma longitud de onda de resonancia como el sensor 11. Hay muchas ventajas de utilizar las señales eléctricas para realizar la detección química y biológica en los sistemas de microfluidos. La fabricación es inherentemente menos complicado ya que estos sensores por lo general sólo requieren electrodos estampados para operar. Además, las señales eléctricas pueden conectarse directamente con la mayoría del equipo de medición, mientras que otras modalidades de señal pueden requerir un transductor para convertir la señal 12-15. Sensores eléctricos comúnmente medir los cambios en impedance 16,17, capacitancia 18, o redox actividad 19. Sin embargo, nuevos desafíos se presentan como estos sistemas son miniaturizados. Los retos más importantes para superar incluyen: preparación de la muestra y la mezcla de fluidos (debido a el volumen de muestra bajo y el número de Reynolds), efectos físicos y químicos (incluyendo las fuerzas capilares, rugosidad de la superficie, las interacciones químicas entre los materiales de construcción y analitos), bajo señalización relación a ruido (producido por el área reducida de la superficie y volumen) 20-23, y la interferencia potencial de analitos electro-activas en muestras biológicas complejas (por ejemplo, de sangre y de saliva). Investigaciones posteriores de estos efectos se traducirá en las directrices para una fabricación precisa y manejo de estos dispositivos de una manera reproducible que mejoren en su desempeño general. Detección de la hibridación de ADN se utiliza ampliamente para diagnosticar trastornos genéticos 24,25 y diversas formas de Cancer 26. Cada año, varias cepas de la gripe se identifican en los pacientes que utilizan los resultados de las técnicas de hibridación de ADN 27. El virus de la gripe por sí sola representa 36.000 muertes cada año en los Estados Unidos 28. Tales ejemplos podrían beneficiarse de un dispositivo de sobremesa de microfluidos que puede realizar las mismas técnicas de ensayo como un ensayo de desplazamiento en gel de lector de placas o con bajo volumen de muestra y en una fracción del costo sin sacrificar la sensibilidad o especificidad. Debido a las muchas ventajas de detección electroquímica libre de etiquetas, se ha utilizado ampliamente para la detección de eventos de hibridación de ADN 29,30. Una configuración donde los electrodos escala macro (en el rango de milímetros) se sumergen en vasos de precipitados con la solución de interés puede ser utilizado para proporcionar datos muy sensibles con respecto a la cinética de unión de secuencias de ADN de cadena sencilla a sus emparejan secuencias complementarias. Recientemente, ha habido algunos avances en la incorporación de la detección electroquímica en microfluidics para la hibridación de ADN. Se han realizado estudios en relación con la cinética de hibridación 31 y la integración de sensores para la detección de 15 en los canales de microfluidos. Sin embargo, todavía existe una necesidad de un dispositivo de microfluidos rápida de alto rendimiento que puede analizar los eventos de hibridación de ADN en paralelo sin complicados pasos de preparación de muestras. El dispositivo se presenta en este trabajo proporciona una plataforma que permite múltiples interacciones que se proyectarán en paralelo y sin complicados pasos de preparación de muestras. Nuestro protocolo presenta la forma de microfluidos basada en biochips electroquímicos se microfabricados con la tecnología de sistemas micro-electromecánicos (MEMS) 32,33. Se describe el proceso de fabricación tanto del chip de microfluidos, hecho de polidimetilsiloxano (PDMS), y el chip electroquímica, compuesto por una matriz de electrodos. La funcionalización química del biochip con ssDNA sondas también se aborda. Finalmente, el Abildad del biosensor para detectar específicamente y analizar los objetivos de ssDNA se demuestra. En general, el biochip electroquímico basado en microfluidos es una técnica rápida y el análisis de alto rendimiento. Se puede utilizar para investigar las interacciones entre moléculas biológicas y transductores de conductores, y se puede utilizar en una variedad de aplicaciones de laboratorio en un chip.

<table border="0" cellpadding="0" cellspacing="0" width="765">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:155px;">Company</td>
			<td style="width:227px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Material</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">4&#39;&#39; Silicon wafer</td>
			<td style="width:155px;">Ultrasil</td>
			<td style="width:227px;">4-5664</td>
			<td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm*cm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Shipley 1813 photoresist (&#34;PR1&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">AZ5214 photoresist (&#34;PR2&#34;)</td>
			<td style="width:155px;">Hoechst Celanse</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">positive photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SU-8 50 photoresist (&#34;PR3&#34;)</td>
			<td style="width:155px;">Microchem</td>
			<td style="width:227px;"></td>
			<td style="width:167px;">negative photoresist</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">TFA</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chromium etchant</td>
			<td style="width:155px;">Transene</td>
			<td style="width:227px;">1020AC</td>
			<td style="width:167px;">No dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS elastomer</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097366 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PDMS curing agent</td>
			<td style="width:155px;">Dow Corning</td>
			<td style="width:227px;">3097358 1004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Biopsy punching tool</td>
			<td style="width:155px;">Healthlink</td>
			<td style="width:227px;">BP20</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible tubing</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">R 3603</td>
			<td>.015&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tygon flexible adapter</td>
			<td style="width:155px;">Cole Parmer&#160;</td>
			<td style="width:227px;">06417-41</td>
			<td>.0625&#34;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">1 mL syringe</td>
			<td style="width:155px;">Beckton-Dickenson</td>
			<td align="right" style="width:227px;">301025</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monobasic potassium phosphate</td>
			<td style="width:155px;">Fluka</td>
			<td align="right" style="width:227px;">1551139</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium phosphate dibasic anhydrous</td>
			<td style="width:155px;">Sigma</td>
			<td style="width:227px;">RES20765-A7</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium chloride</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:227px;">S7653</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">tris(2-carboxyethyl)phosphine</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">C4706</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">6-mercapto-1-hexanol</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">451088</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">20x concentrated saline-sodium citrate buffer</td>
			<td style="width:155px;">Sigma</td>
			<td align="right" style="width:227px;">93017</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Potassium hexacyanoferrate(III)</td>
			<td style="width:155px;">Aldrich</td>
			<td align="right" style="width:227px;">455946</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium ferrocyanide</td>
			<td style="width:155px;">Aldrich</td>
			<td style="width:227px;">CDS001589</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/AAAGCTCCGATAGCGCTCCG 
			TGGACGTCCC-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #1</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-GGGACGTCCACGGAGCGCTA 
			TCGGAGCTTT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA 
			ATCGATGAGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #2</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-ACTCATCGATTCGTCAATGA 
			CCTGACCCGT-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Target ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA 
			CCCATGATGA-3&#8217;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Complementary ssDNA #3</td>
			<td style="width:155px;">Integrated DNA Technologies (IDT)</td>
			<td style="width:227px;">100 nmole DNA oligo</td>
			<td>5&#8217;-TCATCATGGGTCTAACTACT 
			GGATCTAGGT-3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;"></td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Instrument</td>
			<td style="width:155px;"></td>
			<td style="width:227px;"></td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Plasma Enhanced Chemical Vapor Deposition (PECVD)</td>
			<td style="width:155px;">Oxford Instruments</td>
			<td style="width:227px;">PlasmaLab System 100</td>
			<td>Chamber pressure 1000 mTorr, Tempreture 200 celsius degrees, RF power 20 W, Gasses: a) N2O flow rate 710 sccm; b) a composition of 5% SiH4 and 95% N2 gasses flow rate 170 sccm, SiO2 growth rate 690 Angstrom/minute.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DC sputtering unit</td>
			<td style="width:155px;">AJA International</td>
			<td style="width:227px;">ATC 1800-V</td>
			<td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">E-beam evaporation system</td>
			<td style="width:155px;">Denton</td>
			<td style="width:227px;">Custom-built</td>
			<td>For Titanium: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 6-10 Angstrom/second. For Platinum: Chamber pressure &#60;2E-6 Torr, Supplied power to the e-gun 7.5k W, Filament current 150-200 mA, Evaporation rate 2-3 Angstrom/second.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Potentiostat</td>
			<td style="width:155px;">CH Instruments</td>
			<td style="width:227px;">660D</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Syringe pump</td>
			<td style="width:155px;">KD Scientific</td>
			<td style="width:227px;">KDS230</td>
			<td></td>
		</tr>
	</tbody>
</table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

La miniaturización de los procedimientos analíticos de sobremesa en la escala micro proporciona ventajas significativas en cuanto a tiempo de reacción, el coste, y la integración de las etapas de pre-procesamiento. La utilización de estos dispositivos hacia el análisis de los eventos de hibridación de ADN es importante porque ofrece una tecnología para la evaluación en tiempo real de los biomarcadores en el punto de atención para diversas enfermedades. Sin embargo, cuando la huella dispositivo disminuye el dominio de diversas ampliaciones de los fenómenos físicos. Estos fenómenos influyen en la precisión de fabricación y fiabilidad de funcionamiento del dispositivo. Por lo tanto, hay una gran necesidad de fabricar con precisión y operar estos dispositivos en una manera reproducible con el fin de mejorar el rendimiento global. A continuación, describimos los protocolos y los métodos utilizados para la fabricación y el funcionamiento de un biochip electroquímico basado en microfluidos para el análisis preciso de los eventos de hibridación de ADN. El biochip se compone de dos partes: un chip de microfluidos contres micro-canales paralelos hechos de polidimetilsiloxano (PDMS), y un Arrayed electroquímica micro-chip de 3 x 3. Los eventos de hibridación de ADN se detectan usando un análisis de espectroscopia de impedancia electroquímica (EIS). El análisis EIS permite monitoreo de las variaciones de las propiedades del sistema electroquímico que son dominantes en estas escalas de longitud. Con la capacidad para monitorizar los cambios tanto de transferencia de carga y la resistencia difusional con el biosensor, se demuestra la selectividad a los objetivos de ADNss complementarios, un límite de detección calculado de 3,8 nM, y una reactividad cruzada del 13% con otros ssDNA no complementaria siguiente 20 min de incubación. Esta metodología puede mejorar el rendimiento de dispositivos miniaturizados por elucidar sobre el comportamiento de la difusión en el régimen de micro-escala y al permitir el estudio de los acontecimientos de hibridación de ADN.

Un proceso de fabricación controlable y precisa para el dispositivo experimental es esencial en la investigación. Se permite a los investigadores obtener rendimiento experimentos reproducibles y altas. Aquí hemos demostrado un alto rendimiento, el proceso de microfabricación alta reproducibilidad de un biochip electroquímico basado en microfluídico (Figura 1). Con una baja tasa de fracaso, pocos dispositivos han mostrado problemas de unión que llevan a la solución de las fugas. Con el fin de val...

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Se presenta un biochip electroquímico basado en microfluídico para la detección de la hibridación de ADN. Tras ssDNA sonda funcionalización, la especificidad, sensibilidad y límite de detección se estudian con objetivos ssDNA complementarias y no complementarias. Resultados ilustran la influencia de los eventos de hibridación de ADN en el sistema electroquímico, con un límite de detección de 3,8 nM.

Un biochip electroquímico basado en microfluidos para el análisis de hibridación ADN-Label libre

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Research

JoVE Journal

Bioengineering

17.0K vistas.  University of Maryland.  Se presenta un biochip electroquímico basado en microfluídico para la detección de la hibridación de ADN. Tras ssDNA sonda funcionalización, la especificidad, sensibilidad y límite de detección se estudian con objetivos ssDNA complementarias y no complementarias. Resultados ilustran la influencia de los eventos de hibridación de ADN en el sistema electroquímico, con un límite de detección de 3,8 nM. 

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

Una de microfluidos basada en hidrodinámica trampa para las partículas individuales

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Investigación

Bioingeniería

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

Fabricación de ADN electroquímico biosensores para la detección Reagentless de ácidos nucleicos, proteínas y moléculas pequeñas

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Non-contact, Label-free Monitoring of Cells and Extracellular Matrix using Raman Spectroscopy

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, currently available routine methods require processing steps and alter sample integrity. Raman spectroscopy is a fast method that enables the measurement of biological samples without the need for further processing steps. This laser-based technology detects the inelastic scattering of monochromatic light.6 As every chemical vibration is assigned to a specific Raman band (wavenumber in cm-1), each biological sample features a typical spectral pattern due to their inherent biochemical composition.7-9 Within Raman spectra, the peak intensities correlate with the amount of the present molecular bonds.1 Similarities and differences of the spectral data sets can be detected by employing a multivariate analysis (e.g. principal component analysis (PCA)).10
Here, we perform Raman spectroscopy of living cells and native tissues. Cells are either seeded on glass bottom dishes or kept in suspension under normal cell culture conditions (37 &deg;C, 5% CO2) before measurement. Native tissues are dissected and stored in phosphate buffered saline (PBS) at 4 &deg;C prior measurements. Depending on our experimental set up, we then either focused on the cell nucleus or extracellular matrix (ECM) proteins such as elastin and collagen. For all studies, a minimum of 30 cells or 30 random points of interest within the ECM are measured. Data processing steps included background subtraction and normalization.

Raman spectroscopy is a suitable technique for the non-contact, label-free analysis of living cells, tissue-engineered constructs and native tissues. Source-specific spectral fingerprints can be generated and analyzed using multivariate analysis.

Sin contacto, libre de marca Seguimiento de células y matriz extracelular utilizando espectroscopia Raman

Non-destructive, non-contact and label-free technologies to monitor cell and tissue cultures are needed in the field of biomedical research.1-5 However, ...

Hollow Microneedle-based Sensor for Multiplexed Transdermal Electrochemical Sensing

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals suffering from chronic medical conditions facile assessment of their immediate physiological state. Furthermore, it could serve as a research tool for analysis of complex, multifactorial medical conditions. In order for such a multianalyte sensor to be realized, it must be minimally invasive, sampling of interstitial fluid must occur without pain or harm to the user, and analysis must be rapid as well as selective.
Initially developed for pain-free drug delivery, microneedles have been used to deliver vaccines and pharmacologic agents (e.g., insulin) through the skin.1-2 Since these devices access the interstitial space, microneedles that are integrated with microelectrodes can be used as transdermal electrochemical sensors. Selective detection of glucose, glutamate, lactate, hydrogen peroxide, and ascorbic acid has been demonstrated using integrated microneedle-electrode devices with carbon fibers, modified carbon pastes, and platinum-coated polymer microneedles serving as transducing elements.3-7,8
This microneedle sensor technology has enabled a novel and sophisticated analytical approach for in situ and simultaneous detection of multiple analytes. Multiplexing offers the possibility of monitoring complex microenvironments, which are otherwise difficult to characterize in a rapid and minimally invasive manner. For example, this technology could be utilized for simultaneous monitoring of extracellular levels of, glucose, lactate and pH,9 which are important metabolic indicators of disease states7,10-14 (e.g., cancer proliferation) and exercise-induced acidosis.15

This article details the construction of a multiplexed microneedle-based sensor. The device is being developed for in situ sampling and electrochemical analysis of multiple analytes in a rapid and selective manner. We envision clinical medicine and biomedical research uses for these microneedle-based sensors.

Hollow Microneedle basado en sensores para la detección electroquímica multiplexado transdérmica

The development of a minimally invasive multiplexed monitoring system for rapid analysis of biologically-relevant molecules could offer individuals ...

Bacterial Detection &amp; Identification Using Electrochemical Sensors

Electrochemical sensors are widely used for rapid and accurate measurement of blood glucose and can be adapted for detection of a wide variety of analytes. Electrochemical sensors operate by transducing a biological recognition event into a useful electrical signal. Signal transduction occurs by coupling the activity of a redox enzyme to an amperometric electrode. Sensor specificity is either an inherent characteristic of the enzyme, glucose oxidase in the case of a glucose sensor, or a product of linkage between the enzyme and an antibody or probe.
Here, we describe an electrochemical sensor assay method to directly detect and identify bacteria. In every case, the probes described here are DNA oligonucleotides. This method is based on sandwich hybridization of capture and detector probes with target ribosomal RNA (rRNA). The capture probe is anchored to the sensor surface, while the detector probe is linked to horseradish peroxidase (HRP). When a substrate such as 3,3',5,5'-tetramethylbenzidine (TMB) is added to an electrode with capture-target-detector complexes bound to its surface, the substrate is oxidized by HRP and reduced by the working electrode. This redox cycle results in shuttling of electrons by the substrate from the electrode to HRP, producing current flow in the electrode.

We describe an electrochemical sensor assay method for rapid bacterial detection and identification. The assay involves a sensor array functionalized with DNA oligonucleotide capture probes for ribosomal RNA (rRNA) species-specific sequences. Sandwich hybridization of target rRNA with the capture probe and a horseradish peroxidase-linked DNA oligonucleotide detector probe produces a measurable amperometric current.

Bacterial Detección e Identificación Usando sensores electroquímicos

Electrochemical  sensors are widely used for rapid and accurate measurement of blood glucose and  can be adapted for detection of a wide variety of ...

Multi-analyte Biochip (MAB) Based on All-solid-state Ion-selective Electrodes (ASSISE) for Physiological Research

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) that can withstand prolonged storage in complex biological media 1-4. An all-solid-state ion-selective-electrode (ASSISE) is especially attractive for the aforementioned applications. The electrode should have the following favorable characteristics: easy construction, low maintenance, and (potential for) miniaturization, allowing for batch processing. A microfabricated ASSISE intended for quantifying H+, Ca2+, and CO32- ions was constructed. It consists of a noble-metal electrode layer (i.e. Pt), a transduction layer, and an ion-selective membrane (ISM) layer. The transduction layer functions to transduce the concentration-dependent chemical potential of the ion-selective membrane into a measurable electrical signal.
The lifetime of an ASSISE is found to depend on maintaining the potential at the conductive layer/membrane interface 5-7. To extend the ASSISE working lifetime and thereby maintain stable potentials at the interfacial layers, we utilized the conductive polymer (CP) poly(3,4-ethylenedioxythiophene) (PEDOT) 7-9 in place of silver/silver chloride (Ag/AgCl) as the transducer layer. We constructed the ASSISE in a lab-on-a-chip format, which we called the multi-analyte biochip (MAB) (Figure 1).
Calibrations in test solutions demonstrated that the MAB can monitor pH (operational range pH 4-9), CO32- (measured range 0.01 mM - 1 mM), and Ca2+ (log-linear range 0.01 mM to 1 mM). The MAB for pH provides a near-Nernstian slope response after almost one month storage in algal medium. The carbonate biochips show a potentiometric profile similar to that of a conventional ion-selective electrode. Physiological measurements were employed to monitor biological activity of the model system, the microalga Chlorella vulgaris.
The MAB conveys an advantage in size, versatility, and multiplexed analyte sensing capability, making it applicable to many confined monitoring situations, on Earth or in space.
Biochip Design and Experimental Methods
The biochip is 10 x 11 mm in dimension and has 9 ASSISEs designated as working electrodes (WEs) and 5 Ag/AgCl reference electrodes (REs). Each working electrode (WE) is 240 &mu;m in diameter and is equally spaced at 1.4 mm from the REs, which are 480 &mu;m in diameter. These electrodes are connected to electrical contact pads with a dimension of 0.5 mm x 0.5 mm. The schematic is shown in Figure 2.
Cyclic voltammetry (CV) and galvanostatic deposition methods are used to electropolymerize the PEDOT films using a Bioanalytical Systems Inc. (BASI) C3 cell stand (Figure 3). The counter-ion for the PEDOT film is tailored to suit the analyte ion of interest. A PEDOT with poly(styrenesulfonate) counter ion (PEDOT/PSS) is utilized for H+ and CO32-, while one with sulphate (added to the solution as CaSO4) is utilized for Ca2+. The electrochemical properties of the PEDOT-coated WE is analyzed using CVs in redox-active solution (i.e. 2 mM potassium ferricyanide (K3Fe(CN)6)). Based on the CV profile, Randles-Sevcik analysis was used to determine the effective surface area 10. Spin-coating at 1,500 rpm is used to cast ~2 &mu;m thick ion-selective membranes (ISMs) on the MAB working electrodes (WEs).
The MAB is contained in a microfluidic flow-cell chamber filled with a 150 &mu;l volume of algal medium; the contact pads are electrically connected to the BASI system (Figure 4). The photosynthetic activity of Chlorella vulgaris is monitored in ambient light and dark conditions.

Multi-analyte Biochip MAB Based on All-solid-state Ion-selective Electrodes ASSISE for Physiological Research

All-solid-state ion-selective electrodes (ASSISEs) constructed from a conductive polymer (CP) transducer provide several months of functional lifetime in liquid media. Here, we describe the fabrication and calibration process of ASSISEs in a lab-on-a-chip format. The ASSISE is demonstrated to have maintained a near-Nernstian slope profile after prolonged storage in complex biological media.

Biochip Multi-analito (MAB) Basado en electrodos selectivos de iones todo de estado sólido (ASSISE) para la investigación fisiológica

Lab-on-a-chip (LOC) applications in environmental, biomedical, agricultural, biological, and spaceflight research require an ion-selective electrode (ISE) ...

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans' Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and pathways as well as its ease of cultivation. Several C. elegans disease models have been reported, including neurodegenerative disorders such as Parkinson's disease (PD), which involves the degeneration of dopaminergic (DA) neurons 1. Both transgenes and neurotoxic chemicals have been used to induce DA neurodegeneration and consequent movement defects in worms, allowing for investigations into the basis of neurodegeneration and screens for neuroprotective genes and compounds 2,3.
Screens in lower eukaryotes like C. elegans provide an efficient and economical means to identify compounds and genes affecting neuronal signaling. Conventional screens are typically performed manually and scored by visual inspection; consequently, they are time-consuming and prone to human errors. Additionally, most focus on cellular level analysis while ignoring locomotion, which is an especially important parameter for movement disorders.
We have developed a novel microfluidic screening system (Figure 1) that controls and quantifies C. elegans' locomotion using electric field stimuli inside microchannels. We have shown that a Direct Current (DC) field can robustly induce on-demand locomotion towards the cathode ("electrotaxis") 4. Reversing the field's polarity causes the worm to quickly reverse its direction as well. We have also shown that defects in dopaminergic and other sensory neurons alter the swimming response 5. Therefore, abnormalities in neuronal signaling can be determined using locomotion as a read-out. The movement response can be accurately quantified using a range of parameters such as swimming speed, body bending frequency and reversal time.
Our work has revealed that the electrotactic response varies with age. Specifically, young adults respond to a lower range of electric fields and move faster compared to larvae 4. These findings led us to design a new microfluidic device to passively sort worms by age and phenotype 6.
We have also tested the response of worms to pulsed DC and Alternating Current (AC) electric fields. Pulsed DC fields of various duty cycles effectively generated electrotaxis in both C. elegans and its cousin C. briggsae 7. In another experiment, symmetrical AC fields with frequencies ranging from 1 Hz to 3 KHz immobilized worms inside the channel 8.
Implementation of the electric field in a microfluidic environment enables rapid and automated execution of the electrotaxis assay. This approach promises to facilitate high-throughput genetic and chemical screens for factors affecting neuronal function and viability.

Microfluidic-based Electrotaxis for On-demand Quantitative Analysis of Caenorhabditis elegans&#039; Locomotion

A semi-automated micro-electro-fluidic method to induce on-demand locomotion in Caenorhabditis elegans is described. This method is based on the neurophysiologic phenomenon of worms responding to mild electric fields (&#x201C;electrotaxis&#x201D;) inside microfluidic channels. Microfluidic electrotaxis serves as a rapid, sensitive, low-cost, and scalable technique to screen for factors affecting neuronal health.

Electrotaxis microfluidos basados ​​en On-Demand Análisis cuantitativo de<em&gt; Caenorhabditis elegans</em&gt; &#39;Locomotion

The nematode Caenorhabditis elegans is a versatile model organism for biomedical research because of its conservation of disease-related genes and ...

Use of Label-free Optical Biosensors to Detect Modulation of Potassium Channels by G-protein Coupled Receptors

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma membrane1. To regulate neuronal excitability, the biophysical properties of ion channels are modified by signaling proteins and molecules, which often bind to the channels themselves to form a heteromeric channel complex2,3. Traditional assays examining the interaction between channels and regulatory proteins require exogenous labels that can potentially alter the protein&#39;s behavior and decrease the physiological relevance of the target, while providing little information on the time course of interactions in living cells. Optical biosensors, such as the X-BODY Biosciences BIND Scanner system, use a novel label-free technology, resonance wavelength grating (RWG) optical biosensors, to detect changes in resonant reflected light near the biosensor. This assay allows the detection of the relative change in mass within the bottom portion of living cells adherent to the biosensor surface resulting from ligand induced changes in cell adhesion and spreading, toxicity, proliferation, and changes in protein-protein interactions near the plasma membrane. RWG optical biosensors have been used to detect changes in mass near the plasma membrane of cells following activation of G protein-coupled receptors (GPCRs), receptor tyrosine kinases, and other cell surface receptors. Ligand-induced changes in ion channel-protein interactions can also be studied using this assay. In this paper, we will describe the experimental procedure used to detect the modulation of Slack-B sodium-activated potassium (KNa) channels by GPCRs.

Optical biosensor techniques can detect changes in mass near the plasma membrane in living cells and allow one to follow cellular responses in both individual cells and populations of cells. This protocol will describe detection of the modulation of potassium channels by G-protein coupled receptors in intact cells using this approach.

El uso de biosensores ópticos sin etiqueta para Detectar la modulación de los canales de potasio por la proteína G-receptores acoplados

Ion channels control the electrical properties of neurons and other excitable cell types by selectively allowing ions to flow through the plasma ...

A Label-free Technique for the Spatio-temporal Imaging of Single Cell Secretions

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning of such signaling can lead to many disorders. To understand cell-to-cell signaling, it is essential to study the spatial and temporal nature of the secreted molecules from the cell without disturbing the local environment. Various assays have been developed to study protein secretion, however, these methods are typically based on fluorescent probes which disrupt the relevant signaling pathways. To overcome this limitation, a label-free technique is required.
In this paper, we describe the fabrication and application of a label-free localized surface plasmon resonance imaging (LSPRi) technology capable of detecting protein secretions from a single cell. The plasmonic nanostructures are lithographically patterned onto a standard glass coverslip and can be excited using visible light on commercially available light microscopes. Only a small fraction of the coverslip is covered by the nanostructures and hence this technique is well suited for combining common techniques such as fluorescence and bright-field imaging.
A multidisciplinary approach is used in this protocol which incorporates sensor nanofabrication and subsequent biofunctionalization, binding kinetics characterization of ligand and analyte, the integration of the chip and live cells, and the analysis of the measured signal. As a whole, this technology enables a general label-free approach towards mapping cellular secretions and correlating them with the responses of nearby cells.

Inter-cellular communication is critical for controlling various physiological activities within and outside the cell. This paper describes a protocol for measuring the spatio-temporal nature of single cell secretions. To achieve this, a multidisciplinary approach is used which integrates label-free nanoplasmonic sensing with live cell imaging.

Una técnica-Label libre para el Imaging espacio-temporal de las secreciones sola célula

Inter-cellular communication is an integral part of a complex system that helps in maintaining basic cellular activities. As a result, the malfunctioning ...

Label-free Single Molecule Detection Using Microtoroid Optical Resonators

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental studies on the behavior of molecules. Single molecule detection techniques commonly utilize labels such as fluorescent tags or quantum dots, however, labels are not always available, increase cost and complexity, and can perturb the events being studied. Optical resonators have emerged as a promising means to detect single molecules without the use of labels. Currently the smallest particle detected by a non-plasmonically-enhanced bare optical resonator system in solution is a 25 nm polystyrene sphere1. We have developed a technique known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that can surpass this limit and achieve label-free single molecule detection in aqueous solution2. As signal strength scales with particle volume, our work represents a &#62; 100x improvement in the signal to noise ratio (SNR) over the current state of the art. Here the procedures behind FLOWER are presented in an effort to increase its usage in the field.

We have developed a label-free biosensing system based on optical resonator technology known as Frequency Locking Optical Whispering Evanescent Resonator (FLOWER) that is capable of detecting single molecules in solution. Here the procedures behind this work are described and presented.

Individual Detección Molecule-Label gratis con Microtoroid ópticos Resonadores

Detecting small concentrations of molecules down to the single molecule limit has impact on areas such as early detection of disease, and fundamental ...