We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Nota: Los procedimientos se realizaron a temperatura ambiente a menos que se indique lo contrario. incubadoras de temperatura controlada se utilizan para mantener las temperaturas para la cría de mosca y cruces a menos que se indique lo contrario. 1. Preparativos <ol><li> Preparar moscas. <ol><li> Prometafase enriquecido con colecciones de ovocitos. <ol><li> Claro moscas adultas jóvenes a partir de valores o transversales cultivos sanos,. botellas de edad para los dos días a 25 ° C. NOTA: Por lo general dos botellas sanas serán suficientes, aunque más pueden ser necesarios para algunas culturas cruzadas. </li><li> Después de dos días, recoger ~ 100 a 300 mujeres (que son de 0 a 2 días de edad en este punto) de las botellas. Las hembras no tienen que ser vírgenes. Añadir una pequeña cantidad de pasta de levadura a un lado de un vial y colocar 30 hembras y 10 machos y 15 cada uno en los viales yeasted. viales de edad para los dos días a 25 ° C. </li></ol></li><li> Metafase-enriquecido ovocitos Colecciones. <ol><li> Recoger ~ 100 a 300 hembras de valores o cruz culturES. Añadir una pequeña cantidad de pasta de levadura a un lado de un vial y colocar cada 30 hembras (sin machos añadidos) en los viales yeasted. viales de edad para los tres a cinco días a 25 ° C. </li></ol></li></ol></li><li> Preparar soluciones. Nota: Las soluciones se pueden almacenar indefinidamente a temperatura ambiente, a menos que se indique lo contrario. <ol><li> Prepárese Modificado Buffer de Robb (5x): mM HEPES 500, sacarosa 500 mM, acetato de sodio 275 mM, acetato de potasio 200 mM, glucosa 50 mM, cloruro de magnesio 6 mM, y cloruro de calcio 5 mM. Utilice 10 N 11: 8 de hidróxido de sodio: hidróxido de potasio para llevar el pH a 7,4. Esterilizar por filtración; No esterilizar en autoclave. Almacenar a -20 ° C. Descongelar según sea necesario para preparar ~ 200 ml de 1x de Robb por oocito de preparación. </li><li> Soluciones de fijación. <ol><li> Opción # 1: Preparar la fijación de formaldehído / heptano. Preparar Fijación Buffer: solución salina tamponada con fosfato 1x (PBS) más sacarosa 150 mM. Para utilizar, hacer fresco con 687,5 l Fijación de amortiguamiento y 312,5 l 16% de formaldehídopor la preparación de los ovocitos. PRECAUCIÓN: Use guantes durante el uso de soluciones de formaldehído en una campana de humos. Eliminar los residuos de acuerdo con las directrices institucionales. </li><li> Opción # 2: Preparar la fijación de formaldehído / cacodilato. Preparar la mezcla Fix: sacarosa 250 mM, 100 mM de acetato de potasio (pH 7,5), acetato de sodio 25 mM (pH 7,0), y EGTA 25 mM (pH 8,0). Para utilizar, hacen fresco con 400 l Fix Mix, 100 l de cacodilato de potasio (1 M, pH 7,2), y 500 l 16% de formaldehído por la preparación de los ovocitos. PRECAUCIÓN: cacodilato de potasio contiene arsénico. </li></ol></li><li> Preparar PBS / Triton X-100: 1x PBS más 1% o 0,05% de Triton X-100. Almacenar a 4 ° C. </li><li> Preparar PBS-Tween 20-albúmina de suero bovino (BSA) (PTB): 1x PBS, 0,5% BSA (w / v), y 0,1% de Tween-20. Puede ser almacenado a 4 ° C durante una semana. </li><li> La hibridación in situ con fluorescencia (FISH) Soluciones. <ol><li> Preparar cloruro de sodio-20X citrato de sodio (SSC): cloruro de sodio 3 M y citrato de sodio 0,3 M. </li><li> Preparar 2x SSC-Tween-20 (SSCT): 2x SSC más 0,1% de Tween-20. Hacer frescas, ~ 20 ml por la preparación de los ovocitos. </li><li> Preparar soluciones de formamida: 2x SSC, 0,1% de Tween-20, además de formamida. Hacer fresca, 1 ml 20% de formamida, 0,5 ml 40% de formamida, y 2 ml 50% de formamida por prep ovocito. PRECAUCIÓN: Use guantes durante el uso de soluciones de formamida en una campana de humos. Eliminar los residuos de acuerdo con las directrices institucionales. </li><li> Preparar la solución de hibridación: 2 x SSC, formamida al 50%, y 10% de sulfato de dextrano (w / v). Almacenar a 4 ° C. </li></ol></li><li> Las sondas FISH. <ol><li> Oligonucleótidos orden (véase la Tabla 1 para las secuencias) con la purificación por HPLC y la deseada 5 &#39;modificación fluorescente (por ejemplo, Cy3 o Cy5). Resuspender en tampón Tris-EDTA (TE) a 50 ng / l. NOTA: Proteja oligos de exposición a la luz en todo momento. </li></ol></li></ol></li></ol> 2. Recolección de etapa tardía de Drosophila ovocitos <ol><li> Como <em&gt; ovocitos Drosophila con membranas intactas se pegue a plástico y vidrio, pre-recubrir el interior de un tubo de 5 ml y una pipeta Pasteur por prep ovocito con PTB. </li><li> Anestesiar a todos ~ 100 a 300 moscas yeasted con dióxido de carbono y añadir a un mezclador que contenía ~ 100 ml 1x Buffer de Robb. Pulso tres veces (~ 1 seg cada uno). Mantener en ovocitos de Robb para &lt;20 min para evitar la activación. NOTA: Como alternativa, los ovocitos pueden ser a mano disecados de las hembras. La ventaja de este método es que requiere menos hembras. Sin embargo, se debe tener cuidado para limitar la exposición a dióxido de carbono a unos pocos minutos para evitar artefactos asociados con la hipoxia 7. </li><li> Se filtra a través de malla grande (~ 1.500 m) en 250 ml vaso de precipitados para eliminar grandes partes del cuerpo. Si muchos abdómenes intactos permanecen en material de malla, re-molienda usando tampón adicional de Robb, y el filtro de nuevo. Dejar reposar ~ 2 min, luego aspirar fuera de la capa superior, la eliminación de la mayor cantidad de grandes partes del cuerpo como sea posible. </li><li> Fifiltro a través de malla pequeña (~ 300 micras) en un vaso de precipitados de 250 ml. Enjuague ovocitos restantes de cada primer vaso de precipitados utilizando adicional de Robb y recubiertos pipeta Pasteur. Dejar reposar ~ 3 min; ovocitos se asentarán. Aspirar todos, pero ~ 10 ml. </li><li> Verter la mayor cantidad de 10 ml como se ajusta a revestida tubo de 5 ml. Dejar reposar, remover el líquido, y repetir con residuo. Enjuague oocitos restantes de vaso de precipitados utilizando adicional pipeta Pasteur de Robb y revestido. Deje asentarse en 5 ml tubo por unos 3-5 minutos. </li></ol> 3. Tratamientos farmacológicos (Opcional) <ol><li> Escudo un segundo tubo de 5 ml con PTB para cada preparación de los ovocitos. Añadir disolvente apropiado (control) o el medicamento a 1 ml de Robb cada uno para cada preparación de ovocitos (Tabla 2). </li><li> ovocitos divididos en un segundo tubo recubierto de 5 ml. Dejar reposar, eliminar el líquido, y añadir 1 ml de Robb más disolvente en un tubo y 1 ml de Robb más fármaco en segundo tubo. Inclinar la cabeza para la cantidad de tiempo apropiado para el tratamiento de drogas (Tabla 2). Let asiente. </li></ol> 4. Fijación <ol><li> Aspirar todo el líquido e inmediatamente añadir 1 ml Fix. </li><li> Opción # 1: El formaldehído / heptano fijación (fijación de búfer más el 5% de formaldehído). <ol><li> Fijar durante 2,5 minutos en un nutator. Añadir 1 ml de heptano y agitar 1 min. Dejar reposar ~ 1 min. </li><li> Eliminar todo el líquido, y luego agregar 1 ml de PBS 1x. Vortex 30 seg. Dejar reposar ~ 1 min. </li><li> Eliminar todo el líquido, y luego llenar el tubo con PBS 1x. NOTA: Los ovocitos se pueden utilizar inmediatamente o mantenerse en el nutator durante varias horas a temperatura ambiente. </li></ol></li><li> Opción # 2: la fijación de formaldehído / cacodilato (Fix Mix Plus 8% de formaldehído y cacodilato 100 mM). <ol><li> Fijar durante 6 minutos en un nutator. Dejar reposar 2 min. Retire el líquido, y luego llenar el tubo con PBS 1x. NOTA: Los ovocitos se pueden utilizar inmediatamente o mantenerse en el nutator durante varias horas a temperatura ambiente. </li></ol></li></ol> 5. Extracción de Membranas ( &quot;Rolling&quot;) <ol><li> Usando recubierto pipeta Pasteur, añadir ~ 500 a 1000 ovocitos a la parte esmerilado (chorro de arena) de un portaobjetos de vidrio. Retirar todas las partes del cuerpo y materiales extraños con unas pinzas. No deje que se sequen los ovocitos; añadir 1x PBS como sea necesario. </li><li> Colocar un cubreobjetos en la parte superior de los ovocitos y suavemente ovocitos &quot;rollo&quot; hasta que todas las membranas se retiran (arrastrando el borde del cubreobjetos a través de los ovocitos que funciona mejor.) Controlar periódicamente el progreso bajo el microscopio, la adición de más 1x PBS como sea necesario. Tenga cuidado puesto que demasiada presión va a destruir los ovocitos. NOTA: Por inmunofluorescencia solamente, continúe con el paso 6. Para los peces (con o sin inmunofluorescencia), continúe con el paso 7. </li></ol> 6. Anticuerpo La tinción de Drosophila ovocitos <ol><li> Extracción y bloqueo <ol><li> Enjuague ovocitos enrollado en un tubo cónico de 15 ml que contiene 15 ~ ml de PBS / 1% de Triton X-100. ovocitos inclinar la cabeza en esta solución durante no menos de 1,5 horas y no más de 2 horas.Este paso permite la penetración de anticuerpos. </li><li> Deje que los ovocitos se asientan ~ 2 min. Retire el líquido junto con el mayor número de membranas como sea posible, a continuación, añadir PBS / 0,05% de Triton X-100. NOTA: Las membranas se asentarán más lento que los ovocitos laminados. </li><li> Deje que los ovocitos se asientan ~ 2 minutos, luego retire todos menos ~ 1 ml de líquido. ovocitos de transferencia a graduaron tubo de 1,5 ml y eliminar el líquido residual. Añadir 1 ml PTB para el bloqueo y inclinar la cabeza durante 1 hora. </li></ol></li><li> La tinción de anticuerpos <ol><li> Pre-absorción de anticuerpos secundarios contra embriones. NOTA: Este paso elimina la tinción de fondo de las interacciones de anticuerpos no específicos con proteínas de Drosophila. <ol><li> Recoger y fijar embriones de Drosophila (~ 25 l) por procedimiento típico 8. Almacenar en metanol a -20 ° C. </li><li> Eliminar el metanol a partir de embriones, añadir 800 l de metanol más 200 l de 1x PBS, y inclinar la cabeza durante 15 minutos. Retire 500 l de sobrenadante y reemplazar con 500 l de PBS 1x. Luego inclinar la cabeza durante 15 minutos. Repetir dos veces (para un total de ~ 1 hr de lavados), y luego terminar en el PTB. NOTA: Los embriones se puede usar inmediatamente o mantenerse en el nutator para varias horas a temperatura ambiente. </li><li> Retire el líquido, se llenan de PTB a 200 l por la preparación de los ovocitos, y añadir anticuerpos secundarios marcados con fluorescencia a las diluciones apropiadas (teniendo en cuenta que el volumen final será de 300 l;. Véase el paso 7.4) titubear a 4 ° C durante la noche (preferible) o a temperatura ambiente durante 3-4 h. NOTA: Los anticuerpos pre-absorción se utilizó en el paso 6.2.4. NOTA: Mantener las muestras en la oscuridad tanto como sea posible una vez que los anticuerpos fluorescentes se han añadido. </li></ol></li><li> Retire el líquido a partir de ovocitos, se llenan de PTB a 300 l, y añadir anticuerpos primarios en diluciones adecuadas. Inclinar la cabeza a 4 ° C durante la noche (preferible) o a temperatura ambiente durante 3-4 h. </li><li> Lavar los ovocitos cuatro veces durante 15 minutos cada uno con 1 ml PTB. </li><li> retirarlíquido de ovocitos, añadir 200 l de sobrenadante a partir de embriones (pre-absorción anticuerpos secundarios). Luego llene con PTB para 300 l. Inclinar la cabeza a temperatura ambiente durante 3-4 h (preferible) o a 4 ° C durante la noche. </li><li> Lavar los ovocitos de una vez por 15 min con 1 ml PTB, eliminar el líquido. A continuación, añadir 0,5 l Hoechst 33342 y 500 l PTB y inclinar la cabeza durante 7 minutos. </li><li> Lavar los ovocitos dos veces durante 15 minutos cada uno con 1 ml PTB. NOTA: Los ovocitos se pueden montar en un portaobjetos inmediatamente o se pueden almacenar en PTB a 4 ° C hasta el momento de formación de imágenes. </li></ol></li></ol> 7. FISH (Continúe desde el paso 5 anterior) <ol><li> Enjuague ovocitos enrollados en un tubo cónico de 15 ml que contiene 15 ml ~ 2x ECSS. Deje que los ovocitos se asientan ~ 2 min. Deje únicamente ~ 0,5 ml de líquido junto con el mayor número posible de las membranas. NOTA: Las membranas se asentarán más lento que los ovocitos laminados. </li><li> Transferencia de ovocitos a 0,5 ml tubo y remover el líquido remanente. Sucesivamente añadir y eliminar 500 l20%, 40%, y 50% de formamida soluciones, nutación para 10 min en cada solución. NOTA: Los ovocitos se asentarán más lento con porcentajes más altos de formamida. </li><li> Retire el líquido, a continuación, añadir la solución de formamida 500 l 50%, y de inclinar la cabeza a 37 ° C durante 1 a 5 horas. NOTA: El aumento de las incubaciones dan como resultado una mejor penetración de la sonda. </li><li> Retire el líquido, dejando tras de no más de ~ 100 ovocitos mu l, y añadir 36 l solución de hibridación más 2 l de sonda (50 ng / l) y 2 l de agua o 2 l de una sonda de 2 nd (Tabla 1). </li><li> Incubar a 91 ° C durante 3 min (FISH solamente) o 80 ° C durante 20 min (FISH además de inmunofluorescencia), seguido de incubación en un baño de agua a 37 ° durante la noche. NOTA: Estos pasos pueden llevarse a cabo en un termociclador. </li><li> No eliminar el líquido. Añadir 500 l 50% de solución de formamida y inclinar la cabeza a 37 ° C durante 1 hr. </li><li> Dejar reposar, eliminar el líquido, añadir solución de formamida 500 l 50%, unad inclinar la cabeza a 37 ° C durante 1 hora. </li><li> Dejar reposar, eliminar el líquido, añadir solución de formamida 500 l 20%, y de inclinar la cabeza a temperatura ambiente durante 10 min. </li><li> Realizar tres lavados rápidos en 500 l 2x ECSS (dejar reposar, desenchufar y añadir líquido, invertir varias veces, repetir.) Dejar reposar, eliminar el líquido, a continuación, añadir 500 l PTB y inclinar la cabeza durante 4 horas. </li></ol> 8. tinción de anticuerpos después de FISH <ol><li> Retire el líquido a partir de ovocitos, se llenan de PTB a 300 l, y añadir 10 l de anticuerpo anti-α-tubulina conjugado con FITC. Alternativamente, otros anticuerpos se pueden utilizar, siguiendo el protocolo anteriormente. Inclinar la cabeza a temperatura ambiente durante la noche. </li><li> Lavar los ovocitos una vez durante 15 minutos con 500 l PTB, eliminar el líquido, a continuación, añadir 0,5 l Hoechst 33342 y 500 l PTB y inclinar la cabeza durante 7 minutos. </li><li> Lavar los ovocitos dos veces durante 15 minutos cada uno con 500 l PTB. NOTA: Los ovocitos se pueden montar en un portaobjetos inmediatamente o se pueden almacenar en PTB a 4 ° C hasta el momento deformación de imágenes. Mantenga ovocitos en la oscuridad tanto como sea posible una vez que los anticuerpos fluorescentes se han añadido. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Repetir Nombre </td><td fo:width="1in"> Cromosoma </td><td> Oligo Secuencia * </td></tr><tr><td> 359 </td><td> x </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodecaedro </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1,686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * 359 secuencia de Eric Joyce, comunicación personal, otras secuencias de Sullivan et al. 8 </td&gt; </tr></tbody></table> Tabla 1: sondas FISH para repeticiones centroméricas Drosophila. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Droga </td><td> Solvente </td><td> de la concentración </td><td> La concentración final </td><td> Tiempo de tratamiento </td><td> Efecto </td></tr><tr><td> colchicina </td><td> etanol </td><td> 125 mM </td><td> 150 M </td><td> 10 min o 30 min </td><td> desestabilizar no cinetocoro (10 min) 9 o todos los microtúbulos (30 min) </td></tr><tr><td> paclitaxel </td><td> DMSO </td><td> 10 mM </td><td> 10 micras </td><td> 10 minutos </td><td> estabilizar micrófonorotubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 M </td><td> 20 minutos </td><td> inhibir la quinasa Aurora B 10 </td></tr></tbody></table> Tabla 2: El tratamiento con medicamentos.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Puesta en escena de Drosophila ovocitos Aunque un cariosoma alargado se ve a menudo en los ovocitos prometaphase, utilizando cariosoma forma de distinguir a partir de ovocitos en metafase prometaphase puede ser problemático. Durante prometaphase, el cariosoma comienza como una forma redonda, se alarga, y se retira a una forma redonda como el ovocito se aproxima a la detención en metafase. Esto significa que muchos ovocitos prometaphase no tienen un cariosoma alargada. Además, si se examinan ovocitos mutantes o tratados con fármaco, cariosoma forma puede verse afectada, lo que impide el uso de este método a la etapa ovocitos. Debido a que otros marcadores para distinguir estas etapas no están actualmente disponibles, utilizamos el método descrito anteriormente para manipular la velocidad de la puesta de huevos de las hembras de Drosophila para enriquecer en ovocitos ya sea en prometaphase o metafase. La razón es que si los ovocitos pasan una cantidad específica de tiempo en prometaphase, y un período indefinido de tiempo arrEsted en la metafase, que dura hasta la puesta de huevos, a continuación, más rápida será la puesta de huevos sesgar hacia un mayor porcentaje de ovocitos prometaphase, mientras más lenta puesta de huevos enriquecerá de metafase. La cantidad de esfuerzo requerido para recoger las hembras vírgenes o recoger las hembras durante un período de tiempo más corto de 2 días, según lo descrito por Gilliland et al. 6, no es recompensado por un aumento apreciable de los ovocitos prometaphase. También es posible utilizar los apéndices dorsales a la etapa ovocitos preparados con este protocolo como apéndices dorsales se eliminan junto con las membranas. Aunque no es posible a la etapa ovocitos individuales con 100% de certeza con este método, los datos de prometaphase-enriquecido o colecciones metafase enriquecido se pueden tomar juntos para sacar conclusiones acerca de estas diferentes etapas 9. Ovocitos Drosophila no son fertilizados hasta que pasan a través del oviducto; Por lo tanto, debido a que los ovocitos recogidos para el thprotocolos e descritos aquí examinan ovocitos tomadas antes de la puesta de huevos, estos ovocitos no han sido fertilizados. El paso a través del oviducto también hace que el ovocito para activar y reanudar la progresión del ciclo celular. Métodos para examinar las fases del ciclo celular después de la metafase 11,12 existo, pero están fuera del alcance de este protocolo. Consideraciones de fijación Método Se describen dos métodos diferentes para la fijación de la fase tardía de los ovocitos de Drosophila. El método de fijación de formaldehído / cacodilato fue descrita por primera vez por Theurkauf y Hawley 3 y el método de fijación de formaldehído / heptano fue descrito por primera vez por Zou et al. 4. Además, un tercer método (fijación metanol) es utilizado por algunos 13, pero no se describe aquí. La eliminación de las membranas de ovocitos es algo más difícil después de la fijación de formaldehído / heptano comparación con formaldehído / cacodilato. Esto se debe a &quot;rodar&quot; dependes en la fricción entre el cubreobjetos y ovocito, y formaldehído fijación / heptano hace que los ovocitos más resbaladizo. A pesar de esta dificultad añadida, nuestra primera elección del método de fijación al probar nuevos anticuerpos es el formaldehído / heptano, ya que funciona mejor para la mayoría de los anticuerpos que hemos tratado. Por otra parte, preferimos formaldehído fijación / cacodilato para peces, principalmente para la facilidad de eliminación de la membrana, aunque la fijación de formaldehído / heptano también ha tenido éxito. Ambos métodos preservar la morfología de los ovocitos mejor que la fijación de metanol, y por lo que recomendamos fijación con metanol sólo en los casos de anticuerpos que son refractarios a los métodos de fijación a base de formaldehído. Los protocolos descritos aquí se centran en la formación de imágenes fijas, con el fin de demostrar los métodos eficaces para la prestación de ovocitos maduros de Drosophila susceptibles a la penetración de anticuerpos, es decir, a través de la eliminación de las membranas de ovocitos. Los métodos alternativos para remo membranaval (utilizando pinzas 14 o sonicación 13) son posibles; Sin embargo, nos encontramos con &quot;rodar&quot; para ser el método más eficiente y confiable. Las técnicas para la formación de imágenes en vivo también se han descrito en otra parte 14-16 y están fuera del alcance de este protocolo. Recomendaciones de FISH FISH en oocitos de Drosophila fue descrito originalmente por Dernburg et al. 5. Este protocolo fue diseñado para proporcionar las condiciones óptimas para la sonda de hibridación a los cromosomas condensados ​​de ovocitos, pero el protocolo original no era óptima para inmunofluorescencia. El método descrito anteriormente incluye adaptaciones que hemos hecho para mejorar la tinción de anticuerpos de α-tubulina, que es principalmente lo que usamos al realizar FISH. Para otros anticuerpos, bajando la temperatura de la etapa de desnaturalización (Paso 7.5) a partir de 80 ° C puede ser necesario. Las sondas se enumeran aquí son para elsecuencias repetitivas en la heterocromatina cerca de los centrómeros. Debido a que estas secuencias son altamente repetitivas, las sondas se hibridan a múltiples lugares y las señales colectivas son bastante fuertes. Hemos tenido poco éxito con sondas para las secuencias en la eucromatina, posiblemente debido a la estructura única de los cromosomas, mientras que figura en el cariosoma condensada. Imaging Ovocitos maduros de Drosophila, al igual que los oocitos de la mayoría de los organismos, son células grandes, individuales. Eso significa que hay un gran volumen de citoplasma que contiene un solo núcleo. Afortunadamente, este núcleo, también conocido como un cariosoma en Drosophila, se puede identificar fácilmente ya que normalmente se encuentra justo debajo de los apéndices dorsales cerca de la corteza. Los apéndices dorsales se eliminan junto con las membranas de ovocitos, pero el cariosoma todavía se pueden localizar mediante la búsqueda de la pequeña agujero en la corteza de los ovocitos en los apéndices ona vez que eran. Las mejores imágenes se obtienen a partir de oocitos que han sido montados con este divot frente al cubreobjetos ya que esto coloca el cariosoma más cercano al objetivo. Aunque puede ser posible disponer los ovocitos en esta orientación antes del montaje, preferimos montar muchos ovocitos al azar y después buscar la corredera para aquellos en la orientación preferida. Las aplicaciones futuras En el futuro será importante para identificar marcadores que distinguen de manera fiable prometaphase I ejes I y metafase. Ser capaz de organizar de forma más fiable los ovocitos se reducirá la dependencia de las alternativas más mano de obra, como las imágenes un gran número de ovocitos etapa enriquecida o imágenes en vivo, que también tiene sus problemas de puesta en escena. Este método es un método básico que se puede utilizar para tomar ventaja de los avances en la genética de Drosophila como nuevas herramientas estén disponibles para modificar o eliminar productos génicos. Esto incluye métodospara apuntar directamente la actividad de la proteína con los nuevos medicamentos o estrategias de degradación específicos. Además, estos métodos no se limitan a la formación de imágenes husos meióticos. Cualquier estructura dentro del ovocito, tales como el citoesqueleto de actina, se podría analizar el uso de estos métodos.

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>16% formaldehyde</td>
			<td>Ted Pella, Inc.</td>
			<td>18505</td>
			<td>HAZARDOUS; once opened, discard after one month</td>
		</tr>
		<tr>
			<td>250 mL beakers</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>active dry yeast</td>
			<td>Various</td>
			<td></td>
			<td>mix with water to make a paste the consistency of peanut butter</td>
		</tr>
		<tr>
			<td>anti-&#945;-tubulin antibody conjugated to FITC</td>
			<td>Sigma</td>
			<td>F2168</td>
			<td>clone DM1A</td>
		</tr>
		<tr>
			<td>Binucleine 2</td>
			<td>Sigma</td>
			<td>B1186</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>blender</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A4161</td>
			<td></td>
		</tr>
		<tr>
			<td>calcium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>colchicine</td>
			<td>Sigma</td>
			<td>C-9754</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>coverslips</td>
			<td>VWR</td>
			<td>48366-227</td>
			<td>No. 1 1/2</td>
		</tr>
		<tr>
			<td>dextran sulfate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ethanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forceps</td>
			<td>Ted Pella, Inc.</td>
			<td>5622</td>
			<td>Dumont tweezers high precision grade style 5</td>
		</tr>
		<tr>
			<td>formamide</td>
			<td>Sigma</td>
			<td>47670-250ML-F</td>
			<td></td>
		</tr>
		<tr>
			<td>glass slides</td>
			<td>VWR</td>
			<td>48312-003</td>
			<td></td>
		</tr>
		<tr>
			<td>glucose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>graduated 1.5 mL tubes</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>VWR</td>
			<td>EM-5330</td>
			<td>available from several venders</td>
		</tr>
		<tr>
			<td>Hoechst 33342</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>magnesium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>methanol</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>large mesh (~1500 &#181;m)</td>
			<td>VWR</td>
			<td>AA43657-NK</td>
			<td>variety of formats and other suppliers, 12 or 14 mesh</td>
		</tr>
		<tr>
			<td>small mesh (~300 &#181;m)</td>
			<td>Spectrum labs</td>
			<td>146 424</td>
			<td>variety of formats, eg 146 422 or 146 486</td>
		</tr>
		<tr>
			<td>nutator</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pasteur pipets</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>potassium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Cacodylic acid</td>
			<td>Sigma</td>
			<td>C0125</td>
			<td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td>
		</tr>
		<tr>
			<td>potassium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium acetate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium chloride</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium citrate</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sodium hydroxide</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>sucrose</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>taxol (paclitaxel)</td>
			<td>Sigma</td>
			<td>T1912</td>
			<td>HAZARDOUS</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Fisher</td>
			<td>PI-28314</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Fisher</td>
			<td>PI-28320</td>
			<td></td>
		</tr>
		<tr>
			<td>vortex</td>
			<td>Various</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

Los métodos que hemos descrito aquí, dará lugar a la colección de la última etapa de ovocitos Drosophila representan tres etapas de la meiosis (Figura 1). Los ovocitos en profase se distinguen por la presencia de la envoltura nuclear, que es visible por la falta de señal de la tubulina en la región que rodea el cariosoma (Figura 1A). Prometafase es el período posterior rotura de la envuelta nuclear durante el cual los ensambles de cabezal. Durante prometaphase, el cariosoma asume una forma distintiva, llegando a ser alargada a menudo con la 4ª cromosomas, aparte de la masa principal cariosoma (Figura 1B). Prometafase concluye con la metafase, en la que los ovocitos Drosophila natural detienen hasta la ovulación. En ovocitos en metafase, la cariosoma ha retraído en una forma redonda (Figura 1C). Se describe aquí métodos para manipular la velocidad de la puesta de huevos de las hembras de Drosophila para enriquecer en ovocitos ya sea en prometaphase o metafase. Los ovocitos procedentes de colecciones enriquecidas prometaphase-muestran con frecuencia la cariosoma alargada (figura 2A), mientras que las colecciones-metafase enriquecido o colecciones de hembras vírgenes de Drosophila, que eliminan casi por completo la puesta de huevos, muestran principalmente la ronda cariosoma (Figura 2B). Curiosamente, las colecciones enriquecidas prometaphase-también muestran típicamente mucho más robusto husillos, lo que sugiere que tanto la cariosoma y el husillo de cambio entre prometaphase y metafase en Drosophila ovocitos 9. La Figura 3 muestra imágenes representativas de los dos protocolos descritos aquí. Los anticuerpos contra la α-tubulina (para mostrar el husillo), se utilizaron (para mostrar centrómeros) CENP-C, y INCENP (para mostrar el eje central) en ovocitos fijaron con formaldehyde / heptano (Figura 3A). Las sondas para las secuencias centroméricas repetitivas en el cromosoma 2 nd (AACAC) y 3 rd cromosoma (dodeca) fueron utilizados en los ovocitos fijadas con formaldehído / cacodilato y co-tiñeron con un anticuerpo α-tubulina de acuerdo con el protocolo FISH (Figura 3B). La sonda AACAC aparece como varios focos agrupado mientras que la sonda dodeca aparece como un solo foco por cromosoma. Los ovocitos tratados con 150 colchicina mu M durante 10 min se fijaron con formaldehído / heptano (Figura 3C). Este tratamiento elimina la mayoría de los no kinetochore-microtúbulos, lo que resulta en todos los microtúbulos en contacto con el ADN en focos centrómero marcado. Los ovocitos tratados con paclitaxel 10 M durante 10 min Mostrar microtúbulos excesivos en el citoplasma, pero poco efecto sobre los microtúbulos del huso (Figura 3D). Los ovocitos tratados con 25 mM Binucleine 2 durante 20 min para inhibir la pérdida de Aurora B quinasa espectáculo completo demicrotúbulos del huso (Figura 3E). <img alt="Figura 1" src="/files/ftp_upload/54666/54666fig1.jpg" /> Figura 1: Tres etapas de ovocitos maduros de Drosophila:. Profase, Prometafase, y Metafase Confocal imágenes de ovocitos Drosophila en la profase (A), prometaphase (B) y metafase (C) de la meiosis I. ADN se muestra en azul y tubulina es se muestra en verde en las imágenes fusionadas. Inserciones en (B) y (C) muestran DNA en blanco. Las barras de escala = 10 micras. <a href="http://ecsource.jove.com/files/ftp_upload/54666/54666fig1large.jpg" target="_blank">Por favor, haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/54666/54666fig2.jpg" /> Figura 2:Prometaphase- vs. colecciones-metafase enriquecida de ovocitos Drosophila. Confocal de imágenes de ovocitos Drosophila enriquecido de prometaphase-(A) o colecciones metafase enriquecida (B). ADN se muestra en azul y tubulina se muestra en verde. Las barras de escala = 10 micras. <a href="http://ecsource.jove.com/files/ftp_upload/54666/54666fig2large.jpg" target="_blank">Por favor, haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="figura 3" src="/files/ftp_upload/54666/54666fig3.jpg" /> Figura 3: La tinción de anticuerpos, el pescado y los tratamientos de drogas de ovocitos Drosophila Confocal imágenes de ovocitos Drosophila con ADN en azul y verde. Tubulina en. Barras de escala = 10 m. (A) La inmunofluorescencia en Formaldehyd/ Heptano fijación e con INCENP (husillo central) en rojo y CENP-C (centrómeros) en blanco. (B) los peces en la fijación de formaldehído / cacodilato con AACAC dodecaedro se muestra en rojo y muestra en blanco. (C) El tratamiento con colchicina 150 M durante 10 min con CENP-C se muestra en rojo. El tratamiento con paclitaxel 10 M durante 10 min (D) o 25 mM Binucleine 2 durante 20 minutos (E). <a href="http://ecsource.jove.com/files/ftp_upload/54666/54666fig3large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Técnicas de Imagen y Prometafase metafase de la meiosis I en fijo<em&gt; Drosophila</emLos ovocitos&gt;

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Universidad San Sebastian

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K vistas.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Video: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Técnicas de microinyección para el estudio de la mitosis en el Drosophila melanogaster Embrión sincitial

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Investigación

Biología

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Visualizing developing organ formation as well as progession and treatment of disease often heavily relies on the ability to optically interrogate molecular and functional changes in intact living organisms. Most existing optical imaging methods are inadequate for imaging at dimensions that lie between the penetration limits of modern optical microscopy (0.5-1mm) and the diffusion-imposed limits of optical macroscopy (&gt;1cm) [1]. Thus, many important model organisms, e.g. insects, animal embryos or small animal extremities, remain inaccessible for in-vivo optical imaging. 
Although there is increasing interest towards the development of nanometer-resolution optical imaging methods, there have not been many successful efforts in improving the imaging penetration depth. The ability to perform in-vivo imaging beyond microscopy limits is in fact met with the difficulties associated with photon scattering present in tissues. Recent efforts to image entire embryos for example [2,3] require special chemical treatment of the specimen, to clear them from scattering, a procedure that makes them suitable only for post-mortem imaging. These methods however evidence the need for imaging larger specimens than the ones usually allowed by two-photon or confocal microscopy, especially in developmental biology and in drug discovery.
We have developed a new optical imaging technique named Mesoscopic Fluorescence Tomography [4], which appropriate for non-invasive in-vivo imaging at dimensions of 1mm-5mm. The method exchanges resolution for penetration depth, but offers unprecedented tomographic imaging performance and it has been developed to add time as a new dimension in developmental biology observations (and possibly other areas of biological research) by imparting the ability to image the evolution of fluorescence-tagged responses over time. As such it can accelerate studies of morphological or functional dependencies on gene mutations or external stimuli, and can importantly, capture the complete picture of development or tissue function by allowing longitudinal time-lapse visualization of the same, developing organism.
The technique utilizes a modified laboratory microscope and multi-projection illumination to collect data at 360-degree projections. It applies the Fermi simplification to Fokker-Plank solution of the photon transport equation, combined with geometrical optics principles in order to build a realistic inversion scheme suitable for mesoscopic range. This allows in-vivo whole-body visualization of non-transparent three-dimensional structures in samples up to several millimeters in size.
We have demonstrated the in-vivo performance of the technique by imaging three-dimensional structures of developing Drosophila tissues in-vivo and by following the morphogenesis of the wings in the opaque Drosophila pupae in real time over six consecutive hours.

Mesoscopic Fluorescence Tomography for In-vivo Imaging of Developing Drosophila

Mesoscopic fluorescence tomography operates beyond the penetration limits of tissue-sectioning fluorescence microscopy. The technique is based on multi-projection illumination and a photon transport description. We demonstrate in-vivo whole-body 3D visualization of the morphogenesis of GFP-expressing wing imaginal discs in Drosophila melanogaster.

Mesoscópica fluorescencia Tomografía por En vivo Imágenes de desarrollo Drosophila</em

Visualizing  developing organ formation as well as progession and treatment of disease often  heavily relies on the ability to optically interrogate ...

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three preparations of the brain and visual system that cover the range from the developing eye disc-brain complex in the developing pupae to individual eye and brain dissection from adult flies. All protocols are optimized for the live culture of the preparations. However, we also present the conditions for fixed tissue immunohistochemistry where applicable. Finally, we show live imaging conditions for these preparations using conventional and resonant 4D confocal live imaging in a perfusion chamber. Together, these protocols provide a basis for live imaging on different time scales ranging from functional intracellular assays on the scale of minutes to developmental or degenerative processes on the scale of many hours.

Preparation of Developing and Adult Drosophila Brains and Retinae for Live Imaging

This protocol describes three Drosophila preparations: 1) adult brain dissection, 2) adult retina dissection and 3) developing eye disc- brain complexes dissection. Emphasis is laid on special preparation techniques and conditions for live imaging, although all preparations can be used for fixed tissue immunohistochemistry.

Preparación de desarrollo y de adultos Drosophila Los cerebros y retinas de imágenes en vivo

The Drosophila brain and visual system are widely utilized model systems to study neuronal development, function and degeneration. Here we show three ...

Techniques for Imaging Ca2+ Signaling in Human Sperm

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in live cells. Here we describe the method used in our laboratories for loading suspensions of human sperm with Ca2+-reporting dyes and measuring the fluorescence signal during physiological stimulation. Motile cells are isolated by direct swim-up and incubated under capacitating conditions for 0-24 h, depending upon the experiment. The cell-permeant AM (acetoxy methyl ester) ester form of the Ca2+-reporting dye is then added to a cell aliquot and a period of 1 h is allowed for loading of the dye into the cytoplasm. We use visible wavelength dyes to minimize photo-damage to the cells, but this means that ratiometric recording is not possible. Advantages and disadvantages of this approach are discussed. During the loading period cells are introduced into an imaging chamber and allowed to adhere to a poly-D-lysine coated coverslip. At the end of the loading period excess dye and loose cells are removed by connection of the chamber to the perfusion apparatus. The chamber is perfused continuously, stimuli and modified salines are then added to the perfusion header. Experiments are recorded by time-lapse acquisition of fluorescence images and analyzed in detail offline, by manually drawing regions of interest. Data are normalized to pre-stimulus levels such that, for each cell (or part of a cell), a graph showing the Ca2+ response as % change in fluorescence is obtained.

Techniques for Imaging Ca2+ Signaling in Human Sperm

Stimulus-evoked [Ca2+]i signals of individual human sperm are assessed. Motile cells are loaded with Ca2+-sensitive fluorescent dye (AM-ester method) and immobilised in a perfusable chamber. Cells are imaged by time-lapse fluorescence microscopy and stimulated via the perfusing medium. Responses of single cells (or regions) are analysed offline using Excel.

Técnicas de Imagen Ca 2 + Señalización en el esperma humano

Fluorescence microscopy of cells loaded with fluorescent, Ca2+-sensitive dyes is used for measurement of spatial and temporal aspects of Ca2+ signaling in ...

Upright Imaging of Drosophila Embryos

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current techniques used to view such processes are somewhat limited. The following protocol describes a new technique for mounting fixed and labeled Drosophila embryos for coronal viewing with confocal imaging. This method consists of embedding embryos between two layers of glycerin jelly mounting media, and imaging jelly strips positioned upright. The first step for sandwiching the embryos is to make a thin bedding of glycerin jelly on a slide. Next, embryos are carefully aligned on this surface and covered with a second layer of jelly. After the second layer is solidified, strips of jelly are cut and flipped upright for imaging. Alternatives are described for visualizing the embryos depending upon the type of microscope stand to be used. Since all cells along the dorsal-ventral axis are imaged within a single confocal Z-plane, our method allows precise measurement and comparison of fluorescent signals without photobleaching or light scattering common to 3D reconstructions of longitudinally mounted embryos.

Upright Imaging of Drosophila Embryos

Here we present a mounting protocol for stained Drosophila embryos in an upright position that allows imaging of cross-sections using Confocal microscopy.

Imagen de la posición vertical Drosophila Los embriones

Several well-known morphogenetic gradients and cellular movements occur along the dorsal/ventral axis of the Drosophila embryo. However, the current ...

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal lines have enabled biological processes to be studied in the context of a living, and in some instances even behaving, organism. In this protocol we will describe how to anesthetize intact Drosophila larvae, using the volatile anesthetic desflurane, to follow the development and plasticity of synaptic populations at sub-cellular resolution1-3. While other useful methods to anesthetize Drosophila melanogaster larvae have been previously described4,5,6,7,8, the protocol presented herein demonstrates significant improvements due to the following combined key features: (1) A very high degree of anesthetization; even the heart beat is arrested allowing for lateral resolution of up to 150 nm1, (2) a high survival rate of &gt; 90% per anesthetization cycle, permitting the recording of more than five time-points over a period of hours to days2 and (3) a high sensitivity enabling us in 2 instances to study the dynamics of proteins expressed at physiological levels. In detail, we were able to visualize the postsynaptic glutamate receptor subunit GluR-IIA expressed via the endogenous promoter1 in stable transgenic lines and the exon trap line FasII-GFP1. (4) In contrast to other methods4,7 the larvae can be imaged not only alive, but also intact (i.e. non-dissected) allowing observation to occur over a number of days1. The accompanying video details the function of individual parts of the in vivo imaging chamber2,3, the correct mounting of the larvae, the anesthetization procedure, how to re-identify specific positions within a larva and the safe removal of the larvae from the imaging chamber.

In vivo Imaging of Intact Drosophila Larvae at Sub-cellular Resolution

This protocol describes a reliable method for anesthetization and imaging of intact Drosophila melanogaster larvae. We have utilized the volatile anesthetic desflurane to allow for repetitive imaging at sub-cellular resolution and re-identification of structures for up to a few days1.

Imágenes in vivo de larvas de Drosophila intactos a nivel sub-celular Resolución

Recent improvements in optical imaging, genetically encoded fluorophores and genetic tools allowing efficient establishment of desired transgenic animal ...

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may also be used to study the structure-function relationship for other ion channels and neurotransmitter receptors1. BK channels are widely expressed in different tissues and have been implicated in many physiological functions, including regulation of smooth muscle contraction, frequency tuning of inner hair cells and regulation of neurotransmitter release2-6. BK channels are activated by membrane depolarization and by intracellular Ca2+ and Mg2+ 6-9. Therefore, the protocol is designed to control both the membrane voltage and the intracellular solution. In this protocol, messenger RNA of BK channels is injected into Xenopus laevis oocytes (stage V-VI) followed by 2-5 days of incubation at 18&deg;C10-13. Membrane patches that contain single or multiple BK channels are excised with the inside-out configuration using patch clamp techniques10-13. The intracellular side of the patch is perfused with desired solutions during recording so that the channel activation under different conditions can be examined. To summarize, the mRNA of BK channels is injected into Xenopus laevis oocytes to express channel proteins on the oocyte membrane; patch clamp techniques are used to record currents flowing through the channels under controlled voltage and intracellular solutions.

Patch Clamp and Perfusion Techniques for Studying Ion Channels Expressed in Xenopus oocytes

Ionic current of BK channels is recorded using patch clamp techniques. BK channels are expressed in Xenopus oocytes by injecting messenger RNA. The intracellular solution during patch clamp recordings is controlled by a perfusion system.

Patch clamp y técnicas de perfusión para el estudio de los canales iónicos expresados ​​en Xenopus Ovocitos

The protocol presented here is designed to study the activation of the large conductance, voltage- and Ca2+-activated K+ (BK) channels. The protocol may ...

Imaging Cell Shape Change in Living Drosophila Embryos

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging. Cell shape changes in the fly are analogous to those in higher organisms, and they drive tissue morphogenesis. So, in many cases, their study has direct implications for understanding human disease (Table 1)1-5. On the sub-cellular scale, these cell shape changes are the product of activities ranging from gene expression to signal transduction, cell polarity, cytoskeletal remodeling and membrane trafficking. Thus, the Drosophila embryo provides not only the context to evaluate cell shape changes as they relate to tissue morphogenesis, but also offers a completely physiological environment to study the sub-cellular activities that shape cells.
The protocol described here is designed to image a specific cell shape change called cellularization. Cellularization is a process of dramatic plasma membrane growth, and it ultimately converts the syncytial embryo into the cellular blastoderm. That is, at interphase of mitotic cycle 14, the plasma membrane simultaneously invaginates around each of ~6000 cortically anchored nuclei to generate a sheet of primary epithelial cells. Counter to previous suggestions, cellularization is not driven by Myosin-2 contractility6, but is instead fueled largely by exocytosis of membrane from internal stores7. Thus, cellularization is an excellent system for studying membrane trafficking during cell shape changes that require plasma membrane invagination or expansion, such as cytokinesis or transverse-tubule (T-tubule) morphogenesis in muscle.
Note that this protocol is easily applied to the imaging of other cell shape changes in the fly embryo, and only requires slight adaptations such as changing the stage of embryo collection, or using "embryo glue" to mount the embryo in a specific orientation (Table 1)8-19. In all cases, the workflow is basically the same (Figure 1). Standard methods for cloning and Drosophila transgenesis are used to prepare stable fly stocks that express a protein of interest, fused to Green Fluorescent Protein (GFP) or its variants, and these flies provide a renewable source of embryos. Alternatively, fluorescent proteins/probes are directly introduced into fly embryos via straightforward micro-injection techniques9-10. Then, depending on the developmental event and cell shape change to be imaged, embryos are collected and staged by morphology on a dissecting microscope, and finally positioned and mounted for time-lapse imaging on a confocal microscope.

Imaging Cell Shape Change in Living Drosophila Embryos

Early development of the fruit fly, Drosophila melanogaster, is characterized by a number of cell shape changes that are well suited for imaging approaches. This article will describe basic tools and methods required for live confocal imaging of Drosophila embryos, and will focus on a cell shape change called cellularization.

Celular imagen Cambiar forma de vida Drosophila Los embriones

The developing Drosophila melanogaster embryo undergoes a number of cell shape changes that are highly amenable to live confocal imaging.  Cell shape ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

Imágenes en directo de las proteínas GFP-etiquetados en<em&gt; Drosophila</em&gt; Los ovocitos

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

The proper elimination of unwanted or aberrant cells through apoptosis and subsequent phagocytosis (apoptotic cell clearance) is crucial for normal development in all metazoan organisms. Apoptotic cell clearance is a highly dynamic process intimately associated with cell death; unengulfed apoptotic cells are barely seen in vivo under normal conditions. In order to understand the different steps of apoptotic cell clearance and to compare 'professional' phagocytes - macrophages and dendritic cells to 'non-professional' - tissue-resident neighboring cells, in vivo live imaging of the process is extremely valuable. Here we describe a protocol for studying apoptotic cell clearance in live Drosophila embryos. To follow the dynamics of different steps in phagocytosis we use specific markers for apoptotic cells and phagocytes. In addition, we can monitor two phagocyte systems in parallel: 'professional' macrophages and 'semi-professional' glia in the developing central nervous system (CNS). The method described here employs the Drosophila embryo as an excellent model for real time studies of apoptotic cell clearance.

Live Imaging of Apoptotic Cell Clearance during Drosophila Embryogenesis

Here we describe an effective method for studying dynamics of apoptotic cell clearance in vivo. This method employs live Drosophila embryos as a powerful model for monitoring phagocytosis of apoptotic cells using specific labeling of apoptotic cells and phagocytes.

Imágenes de Apoptotic Liquidación de células vivas durante<em&gt; Drosophila</em&gt; Embriogénesis

The  proper elimination of unwanted or aberrant cells through apoptosis and  subsequent phagocytosis (apoptotic cell clearance) is crucial for normal  ...