Name: techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes
Uploaded: 2016-10-31T15:00:00.000+00:00
Duration: 9 min 11 s
Description: Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

We thank Christian Lehner for providing the CENP-C antibody and Eric Joyce for recommendations on FISH. Work in the McKim lab was funded by a grant from NIH (GM101955).

Nota: Los procedimientos se realizaron a temperatura ambiente a menos que se indique lo contrario. incubadoras de temperatura controlada se utilizan para mantener las temperaturas para la cría de mosca y cruces a menos que se indique lo contrario. 1. Preparativos <ol><li> Preparar moscas. <ol><li> Prometafase enriquecido con colecciones de ovocitos. <ol><li> Claro moscas adultas jóvenes a partir de valores o transversales cultivos sanos,. botellas de edad para los dos días a 25 ° C. NOTA: Por lo general dos botellas sanas serán suficientes, aunque más pueden ser necesarios para algunas culturas cruzadas. </li><li> Después de dos días, recoger ~ 100 a 300 mujeres (que son de 0 a 2 días de edad en este punto) de las botellas. Las hembras no tienen que ser vírgenes. Añadir una pequeña cantidad de pasta de levadura a un lado de un vial y colocar 30 hembras y 10 machos y 15 cada uno en los viales yeasted. viales de edad para los dos días a 25 ° C. </li></ol></li><li> Metafase-enriquecido ovocitos Colecciones. <ol><li> Recoger ~ 100 a 300 hembras de valores o cruz culturES. Añadir una pequeña cantidad de pasta de levadura a un lado de un vial y colocar cada 30 hembras (sin machos añadidos) en los viales yeasted. viales de edad para los tres a cinco días a 25 ° C. </li></ol></li></ol></li><li> Preparar soluciones. Nota: Las soluciones se pueden almacenar indefinidamente a temperatura ambiente, a menos que se indique lo contrario. <ol><li> Prepárese Modificado Buffer de Robb (5x): mM HEPES 500, sacarosa 500 mM, acetato de sodio 275 mM, acetato de potasio 200 mM, glucosa 50 mM, cloruro de magnesio 6 mM, y cloruro de calcio 5 mM. Utilice 10 N 11: 8 de hidróxido de sodio: hidróxido de potasio para llevar el pH a 7,4. Esterilizar por filtración; No esterilizar en autoclave. Almacenar a -20 ° C. Descongelar según sea necesario para preparar ~ 200 ml de 1x de Robb por oocito de preparación. </li><li> Soluciones de fijación. <ol><li> Opción # 1: Preparar la fijación de formaldehído / heptano. Preparar Fijación Buffer: solución salina tamponada con fosfato 1x (PBS) más sacarosa 150 mM. Para utilizar, hacer fresco con 687,5 l Fijación de amortiguamiento y 312,5 l 16% de formaldehídopor la preparación de los ovocitos. PRECAUCIÓN: Use guantes durante el uso de soluciones de formaldehído en una campana de humos. Eliminar los residuos de acuerdo con las directrices institucionales. </li><li> Opción # 2: Preparar la fijación de formaldehído / cacodilato. Preparar la mezcla Fix: sacarosa 250 mM, 100 mM de acetato de potasio (pH 7,5), acetato de sodio 25 mM (pH 7,0), y EGTA 25 mM (pH 8,0). Para utilizar, hacen fresco con 400 l Fix Mix, 100 l de cacodilato de potasio (1 M, pH 7,2), y 500 l 16% de formaldehído por la preparación de los ovocitos. PRECAUCIÓN: cacodilato de potasio contiene arsénico. </li></ol></li><li> Preparar PBS / Triton X-100: 1x PBS más 1% o 0,05% de Triton X-100. Almacenar a 4 ° C. </li><li> Preparar PBS-Tween 20-albúmina de suero bovino (BSA) (PTB): 1x PBS, 0,5% BSA (w / v), y 0,1% de Tween-20. Puede ser almacenado a 4 ° C durante una semana. </li><li> La hibridación in situ con fluorescencia (FISH) Soluciones. <ol><li> Preparar cloruro de sodio-20X citrato de sodio (SSC): cloruro de sodio 3 M y citrato de sodio 0,3 M. </li><li> Preparar 2x SSC-Tween-20 (SSCT): 2x SSC más 0,1% de Tween-20. Hacer frescas, ~ 20 ml por la preparación de los ovocitos. </li><li> Preparar soluciones de formamida: 2x SSC, 0,1% de Tween-20, además de formamida. Hacer fresca, 1 ml 20% de formamida, 0,5 ml 40% de formamida, y 2 ml 50% de formamida por prep ovocito. PRECAUCIÓN: Use guantes durante el uso de soluciones de formamida en una campana de humos. Eliminar los residuos de acuerdo con las directrices institucionales. </li><li> Preparar la solución de hibridación: 2 x SSC, formamida al 50%, y 10% de sulfato de dextrano (w / v). Almacenar a 4 ° C. </li></ol></li><li> Las sondas FISH. <ol><li> Oligonucleótidos orden (véase la Tabla 1 para las secuencias) con la purificación por HPLC y la deseada 5 &#39;modificación fluorescente (por ejemplo, Cy3 o Cy5). Resuspender en tampón Tris-EDTA (TE) a 50 ng / l. NOTA: Proteja oligos de exposición a la luz en todo momento. </li></ol></li></ol></li></ol> 2. Recolección de etapa tardía de Drosophila ovocitos <ol><li> Como <em&gt; ovocitos Drosophila con membranas intactas se pegue a plástico y vidrio, pre-recubrir el interior de un tubo de 5 ml y una pipeta Pasteur por prep ovocito con PTB. </li><li> Anestesiar a todos ~ 100 a 300 moscas yeasted con dióxido de carbono y añadir a un mezclador que contenía ~ 100 ml 1x Buffer de Robb. Pulso tres veces (~ 1 seg cada uno). Mantener en ovocitos de Robb para &lt;20 min para evitar la activación. NOTA: Como alternativa, los ovocitos pueden ser a mano disecados de las hembras. La ventaja de este método es que requiere menos hembras. Sin embargo, se debe tener cuidado para limitar la exposición a dióxido de carbono a unos pocos minutos para evitar artefactos asociados con la hipoxia 7. </li><li> Se filtra a través de malla grande (~ 1.500 m) en 250 ml vaso de precipitados para eliminar grandes partes del cuerpo. Si muchos abdómenes intactos permanecen en material de malla, re-molienda usando tampón adicional de Robb, y el filtro de nuevo. Dejar reposar ~ 2 min, luego aspirar fuera de la capa superior, la eliminación de la mayor cantidad de grandes partes del cuerpo como sea posible. </li><li> Fifiltro a través de malla pequeña (~ 300 micras) en un vaso de precipitados de 250 ml. Enjuague ovocitos restantes de cada primer vaso de precipitados utilizando adicional de Robb y recubiertos pipeta Pasteur. Dejar reposar ~ 3 min; ovocitos se asentarán. Aspirar todos, pero ~ 10 ml. </li><li> Verter la mayor cantidad de 10 ml como se ajusta a revestida tubo de 5 ml. Dejar reposar, remover el líquido, y repetir con residuo. Enjuague oocitos restantes de vaso de precipitados utilizando adicional pipeta Pasteur de Robb y revestido. Deje asentarse en 5 ml tubo por unos 3-5 minutos. </li></ol> 3. Tratamientos farmacológicos (Opcional) <ol><li> Escudo un segundo tubo de 5 ml con PTB para cada preparación de los ovocitos. Añadir disolvente apropiado (control) o el medicamento a 1 ml de Robb cada uno para cada preparación de ovocitos (Tabla 2). </li><li> ovocitos divididos en un segundo tubo recubierto de 5 ml. Dejar reposar, eliminar el líquido, y añadir 1 ml de Robb más disolvente en un tubo y 1 ml de Robb más fármaco en segundo tubo. Inclinar la cabeza para la cantidad de tiempo apropiado para el tratamiento de drogas (Tabla 2). Let asiente. </li></ol> 4. Fijación <ol><li> Aspirar todo el líquido e inmediatamente añadir 1 ml Fix. </li><li> Opción # 1: El formaldehído / heptano fijación (fijación de búfer más el 5% de formaldehído). <ol><li> Fijar durante 2,5 minutos en un nutator. Añadir 1 ml de heptano y agitar 1 min. Dejar reposar ~ 1 min. </li><li> Eliminar todo el líquido, y luego agregar 1 ml de PBS 1x. Vortex 30 seg. Dejar reposar ~ 1 min. </li><li> Eliminar todo el líquido, y luego llenar el tubo con PBS 1x. NOTA: Los ovocitos se pueden utilizar inmediatamente o mantenerse en el nutator durante varias horas a temperatura ambiente. </li></ol></li><li> Opción # 2: la fijación de formaldehído / cacodilato (Fix Mix Plus 8% de formaldehído y cacodilato 100 mM). <ol><li> Fijar durante 6 minutos en un nutator. Dejar reposar 2 min. Retire el líquido, y luego llenar el tubo con PBS 1x. NOTA: Los ovocitos se pueden utilizar inmediatamente o mantenerse en el nutator durante varias horas a temperatura ambiente. </li></ol></li></ol> 5. Extracción de Membranas ( &quot;Rolling&quot;) <ol><li> Usando recubierto pipeta Pasteur, añadir ~ 500 a 1000 ovocitos a la parte esmerilado (chorro de arena) de un portaobjetos de vidrio. Retirar todas las partes del cuerpo y materiales extraños con unas pinzas. No deje que se sequen los ovocitos; añadir 1x PBS como sea necesario. </li><li> Colocar un cubreobjetos en la parte superior de los ovocitos y suavemente ovocitos &quot;rollo&quot; hasta que todas las membranas se retiran (arrastrando el borde del cubreobjetos a través de los ovocitos que funciona mejor.) Controlar periódicamente el progreso bajo el microscopio, la adición de más 1x PBS como sea necesario. Tenga cuidado puesto que demasiada presión va a destruir los ovocitos. NOTA: Por inmunofluorescencia solamente, continúe con el paso 6. Para los peces (con o sin inmunofluorescencia), continúe con el paso 7. </li></ol> 6. Anticuerpo La tinción de Drosophila ovocitos <ol><li> Extracción y bloqueo <ol><li> Enjuague ovocitos enrollado en un tubo cónico de 15 ml que contiene 15 ~ ml de PBS / 1% de Triton X-100. ovocitos inclinar la cabeza en esta solución durante no menos de 1,5 horas y no más de 2 horas.Este paso permite la penetración de anticuerpos. </li><li> Deje que los ovocitos se asientan ~ 2 min. Retire el líquido junto con el mayor número de membranas como sea posible, a continuación, añadir PBS / 0,05% de Triton X-100. NOTA: Las membranas se asentarán más lento que los ovocitos laminados. </li><li> Deje que los ovocitos se asientan ~ 2 minutos, luego retire todos menos ~ 1 ml de líquido. ovocitos de transferencia a graduaron tubo de 1,5 ml y eliminar el líquido residual. Añadir 1 ml PTB para el bloqueo y inclinar la cabeza durante 1 hora. </li></ol></li><li> La tinción de anticuerpos <ol><li> Pre-absorción de anticuerpos secundarios contra embriones. NOTA: Este paso elimina la tinción de fondo de las interacciones de anticuerpos no específicos con proteínas de Drosophila. <ol><li> Recoger y fijar embriones de Drosophila (~ 25 l) por procedimiento típico 8. Almacenar en metanol a -20 ° C. </li><li> Eliminar el metanol a partir de embriones, añadir 800 l de metanol más 200 l de 1x PBS, y inclinar la cabeza durante 15 minutos. Retire 500 l de sobrenadante y reemplazar con 500 l de PBS 1x. Luego inclinar la cabeza durante 15 minutos. Repetir dos veces (para un total de ~ 1 hr de lavados), y luego terminar en el PTB. NOTA: Los embriones se puede usar inmediatamente o mantenerse en el nutator para varias horas a temperatura ambiente. </li><li> Retire el líquido, se llenan de PTB a 200 l por la preparación de los ovocitos, y añadir anticuerpos secundarios marcados con fluorescencia a las diluciones apropiadas (teniendo en cuenta que el volumen final será de 300 l;. Véase el paso 7.4) titubear a 4 ° C durante la noche (preferible) o a temperatura ambiente durante 3-4 h. NOTA: Los anticuerpos pre-absorción se utilizó en el paso 6.2.4. NOTA: Mantener las muestras en la oscuridad tanto como sea posible una vez que los anticuerpos fluorescentes se han añadido. </li></ol></li><li> Retire el líquido a partir de ovocitos, se llenan de PTB a 300 l, y añadir anticuerpos primarios en diluciones adecuadas. Inclinar la cabeza a 4 ° C durante la noche (preferible) o a temperatura ambiente durante 3-4 h. </li><li> Lavar los ovocitos cuatro veces durante 15 minutos cada uno con 1 ml PTB. </li><li> retirarlíquido de ovocitos, añadir 200 l de sobrenadante a partir de embriones (pre-absorción anticuerpos secundarios). Luego llene con PTB para 300 l. Inclinar la cabeza a temperatura ambiente durante 3-4 h (preferible) o a 4 ° C durante la noche. </li><li> Lavar los ovocitos de una vez por 15 min con 1 ml PTB, eliminar el líquido. A continuación, añadir 0,5 l Hoechst 33342 y 500 l PTB y inclinar la cabeza durante 7 minutos. </li><li> Lavar los ovocitos dos veces durante 15 minutos cada uno con 1 ml PTB. NOTA: Los ovocitos se pueden montar en un portaobjetos inmediatamente o se pueden almacenar en PTB a 4 ° C hasta el momento de formación de imágenes. </li></ol></li></ol> 7. FISH (Continúe desde el paso 5 anterior) <ol><li> Enjuague ovocitos enrollados en un tubo cónico de 15 ml que contiene 15 ml ~ 2x ECSS. Deje que los ovocitos se asientan ~ 2 min. Deje únicamente ~ 0,5 ml de líquido junto con el mayor número posible de las membranas. NOTA: Las membranas se asentarán más lento que los ovocitos laminados. </li><li> Transferencia de ovocitos a 0,5 ml tubo y remover el líquido remanente. Sucesivamente añadir y eliminar 500 l20%, 40%, y 50% de formamida soluciones, nutación para 10 min en cada solución. NOTA: Los ovocitos se asentarán más lento con porcentajes más altos de formamida. </li><li> Retire el líquido, a continuación, añadir la solución de formamida 500 l 50%, y de inclinar la cabeza a 37 ° C durante 1 a 5 horas. NOTA: El aumento de las incubaciones dan como resultado una mejor penetración de la sonda. </li><li> Retire el líquido, dejando tras de no más de ~ 100 ovocitos mu l, y añadir 36 l solución de hibridación más 2 l de sonda (50 ng / l) y 2 l de agua o 2 l de una sonda de 2 nd (Tabla 1). </li><li> Incubar a 91 ° C durante 3 min (FISH solamente) o 80 ° C durante 20 min (FISH además de inmunofluorescencia), seguido de incubación en un baño de agua a 37 ° durante la noche. NOTA: Estos pasos pueden llevarse a cabo en un termociclador. </li><li> No eliminar el líquido. Añadir 500 l 50% de solución de formamida y inclinar la cabeza a 37 ° C durante 1 hr. </li><li> Dejar reposar, eliminar el líquido, añadir solución de formamida 500 l 50%, unad inclinar la cabeza a 37 ° C durante 1 hora. </li><li> Dejar reposar, eliminar el líquido, añadir solución de formamida 500 l 20%, y de inclinar la cabeza a temperatura ambiente durante 10 min. </li><li> Realizar tres lavados rápidos en 500 l 2x ECSS (dejar reposar, desenchufar y añadir líquido, invertir varias veces, repetir.) Dejar reposar, eliminar el líquido, a continuación, añadir 500 l PTB y inclinar la cabeza durante 4 horas. </li></ol> 8. tinción de anticuerpos después de FISH <ol><li> Retire el líquido a partir de ovocitos, se llenan de PTB a 300 l, y añadir 10 l de anticuerpo anti-α-tubulina conjugado con FITC. Alternativamente, otros anticuerpos se pueden utilizar, siguiendo el protocolo anteriormente. Inclinar la cabeza a temperatura ambiente durante la noche. </li><li> Lavar los ovocitos una vez durante 15 minutos con 500 l PTB, eliminar el líquido, a continuación, añadir 0,5 l Hoechst 33342 y 500 l PTB y inclinar la cabeza durante 7 minutos. </li><li> Lavar los ovocitos dos veces durante 15 minutos cada uno con 500 l PTB. NOTA: Los ovocitos se pueden montar en un portaobjetos inmediatamente o se pueden almacenar en PTB a 4 ° C hasta el momento deformación de imágenes. Mantenga ovocitos en la oscuridad tanto como sea posible una vez que los anticuerpos fluorescentes se han añadido. </li></ol><table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="1in"> Repetir Nombre </td><td fo:width="1in"> Cromosoma </td><td> Oligo Secuencia * </td></tr><tr><td> 359 </td><td> x </td><td> GGGATCGTTAGCACTGGTAATTAGCTGC </td></tr><tr><td> AACAC </td><td> 2 </td><td> AACACAACACAACACAACACAACACAACACAACACAACAC </td></tr><tr><td> dodecaedro </td><td> 3 </td><td> CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT </td></tr><tr><td> 1,686 </td><td> 2 + 3 </td><td> AATAACATAGAATAACATAGAATAACATAG </td></tr><tr><td> AATAT </td><td> 4 (+ Y) </td><td> AATATAATATAATATAATATAATATAATAT </td></tr><tr><td colspan="3"> * 359 secuencia de Eric Joyce, comunicación personal, otras secuencias de Sullivan et al. 8 </td&gt; </tr></tbody></table> Tabla 1: sondas FISH para repeticiones centroméricas Drosophila. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Droga </td><td> Solvente </td><td> de la concentración </td><td> La concentración final </td><td> Tiempo de tratamiento </td><td> Efecto </td></tr><tr><td> colchicina </td><td> etanol </td><td> 125 mM </td><td> 150 M </td><td> 10 min o 30 min </td><td> desestabilizar no cinetocoro (10 min) 9 o todos los microtúbulos (30 min) </td></tr><tr><td> paclitaxel </td><td> DMSO </td><td> 10 mM </td><td> 10 micras </td><td> 10 minutos </td><td> estabilizar micrófonorotubules </td></tr><tr><td> Binucleine 2 </td><td> DMSO </td><td> 25 mM </td><td> 25 M </td><td> 20 minutos </td><td> inhibir la quinasa Aurora B 10 </td></tr></tbody></table> Tabla 2: El tratamiento con medicamentos.

<ol>
	<li>Bridges, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Non-disjunction+as+proof+of+the+chromosome+theory+of+heredity.">Non-disjunction as proof of the chromosome theory of heredity.</a> Genetics. 1 (1), 1-52 (1916).</li><li>Hassold, T., Hunt, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+err+(meiotically)+is+human:+the+genesis+of+human+aneuploidy.">To err (meiotically) is human: the genesis of human aneuploidy.</a> Nat Rev Genet. 2 (4), 280-291 (2001).</li><li>Theurkauf, W. E., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+spindle+assembly+in+Drosophila+females:+behavior+of+nonexchange+chromosomes+and+the+effects+of+mutations+in+the+nod+kinesin-like+protein.">Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein.</a> J Cell Biol. 116 (5), 1167-1180 (1992).</li><li>Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microtubule-destabilizing+kinesin+motor+regulates+spindle+length+and+anchoring+in+oocytes.">A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes.</a> J Cell Biol. 180 (3), 459-466 (2008).</li><li>Dernburg, A. F., Sedat, J. W., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+evidence+of+a+role+for+heterochromatin+in+meiotic+chromosome+segregation.">Direct evidence of a role for heterochromatin in meiotic chromosome segregation.</a> Cell. 86 (1), 135-146 (1996).</li><li>Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Congression+of+achiasmate+chromosomes+to+the+metaphase+plate+in+Drosophila+melanogaster+oocytes.">Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes.</a> Dev Biol. 325 (1), 122-128 (2009).</li><li>Gilliland, W. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia+transiently+sequesters+mps1+and+polo+to+collagenase-sensitive+filaments+in+Drosophila+prometaphase+oocytes.">Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes.</a> PLoS One. 4 (10), e7544 (2009).</li><li>Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , (2000).</li><li>Radford, S. J., Hoang, T. L., G&#322;uszek, A. A., Ohkura, H., McKim, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+and+End-On+Kinetochore+Attachments+Are+Coordinated+to+Achieve+Bi-orientation+in+Drosophila+Oocytes.">Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes.</a> PLoS Genet. 11 (10), e1005605 (2015).</li><li>Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binucleine+2,+an+isoform-specific+inhibitor+of+Drosophila+Aurora+B+kinase,+provides+insights+into+the+mechanism+of+cytokinesis.">Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis.</a> ACS Chem Biol. 5 (11), 1015-1020 (2010).</li><li>Mahowald, A. P., Goralski, T. J., Caulton, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+activation+of+Drosophila+eggs.">In vitro activation of Drosophila eggs.</a> Dev Biol. 98 (2), 437-445 (1983).</li><li>Page, A. W., Orr-Weaver, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+meiotic+divisions+in+Drosophila+oocytes.">Activation of the meiotic divisions in Drosophila oocytes.</a> Dev Biol. 183 (2), 195-207 (1997).</li><li>Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+role+for+gamma-tubulin+in+the+acentriolar+female+meiotic+spindle+of+Drosophila.">Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila.</a> EMBO J. 16 (8), 1809-1819 (1997).</li><li>Endow, S. A., Komma, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spindle+dynamics+during+meiosis+in+Drosophila+oocytes.">Spindle dynamics during meiosis in Drosophila oocytes.</a> J Cell Biol. 137 (6), 1321-1336 (1997).</li><li>Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S., Sullivan, W., Ashburner, M., Hawley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Drosophila Protocols. , 67-85 (2000).</li><li>Colombi&#233;, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+Incenp+crucial+to+the+assembly+of+the+acentrosomal+metaphase+spindle+in+female+meiosis.">Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis.</a> Development. 135 (19), 3239-3246 (2008).</li></ol>

The authors have nothing to disclose.

Puesta en escena de Drosophila ovocitos Aunque un cariosoma alargado se ve a menudo en los ovocitos prometaphase, utilizando cariosoma forma de distinguir a partir de ovocitos en metafase prometaphase puede ser problemático. Durante prometaphase, el cariosoma comienza como una forma redonda, se alarga, y se retira a una forma redonda como el ovocito se aproxima a la detención en metafase. Esto significa que muchos ovocitos prometaphase no tienen un cariosoma alarg...

The study of meiosis is sometimes described as the "genetics of genetics". This is because the fundamental properties of chromosome inheritance and independent assortment are carried out through the segregation of chromosomes during gamete production. An important demonstration of the chromosome theory of inheritance came in 1916 from the work of Calvin Bridges in Drosophila melanogaster1. This and other classical genetics studies in Drosophila contributed greatly to our understanding of genetics. Cytological examination of meiotic chromosomes in Drosophila oocytes, however, has been challenging. This is primarily because immunofluorescence of late-stage Drosophila oocytes, when the spindle assembles and chromosomes are oriented for segregation, is hampered by the presence of membranes that render the oocyte impenetrable to antibodies.
Despite this challenge, Drosophila oocytes remain an attractive model for the study of chromosome behavior and spindle assembly. This is because of the powerful genetic tools available in Drosophila, but also because the oocytes arrest at metaphase I, when the chromosomes are oriented and the spindle is fully formed. This facilitates the collection and examination of large numbers of oocytes at this important stage of cell division. In addition, a simple model organism that is amenable to genetic manipulation for the study of oocyte chromosome segregation can provide an important contribution to our understanding of human reproductive health. Errors in chromosome number are the leading genetic cause of miscarriage and birth defects in humans2. A majority of these errors can be traced to the oocyte and are correlated with increasing maternal age. The average age of mothers in the U.S. has been increasing, making this a major public health concern.
We describe here methods for the cytological examination of Drosophila oocytes, including a demonstration of how to remove the oocyte membranes. These methods are modifications of protocols first described by Theurkauf and Hawley3, Zou et al.4, and Dernburg et al.5. We also include methods for the enrichment of different stages of oocytes, based on a protocol first described by Gilliland et al.6. Finally, we add instructions for the drug treatment of Drosophila oocytes. Together, these methods allow the cytological investigation of oocyte chromosome segregation and spindle assembly in Drosophila.

<table><tbody><tr><td>15 ml conical tubes</td><td>Various</td><td></td><td></td></tr><tr><td>16% formaldehyde</td><td>Ted Pella, Inc.</td><td>18505</td><td>HAZARDOUS; once opened, discard after one month</td></tr><tr><td>250 ml beakers</td><td>Various</td><td></td><td></td></tr><tr><td>5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>active dry yeast</td><td>Various</td><td></td><td>mix with water to make a paste the consistency of peanut butter</td></tr><tr><td>anti-&amp;alpha;-tubulin antibody conjugated to FITC</td><td>Sigma</td><td>F2168</td><td>clone DM1A</td></tr><tr><td>Binucleine 2</td><td>Sigma</td><td>B1186</td><td>HAZARDOUS</td></tr><tr><td>blender</td><td>Various</td><td></td><td></td></tr><tr><td>bovine serum albumin</td><td>Sigma</td><td>A4161</td><td></td></tr><tr><td>calcium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>colchicine</td><td>Sigma</td><td>C-9754</td><td>HAZARDOUS</td></tr><tr><td>coverslips</td><td>VWR</td><td>48366-227</td><td>No. 1 1/2</td></tr><tr><td>dextran sulfate</td><td>Various</td><td></td><td></td></tr><tr><td>DMSO</td><td>Various</td><td></td><td></td></tr><tr><td>EGTA</td><td>Various</td><td></td><td></td></tr><tr><td>ethanol</td><td>Various</td><td></td><td></td></tr><tr><td>forceps</td><td>Ted Pella, Inc.</td><td>5622</td><td>Dumont tweezers high precision grade style 5</td></tr><tr><td>formamide</td><td>Sigma</td><td>47670-250ML-F</td><td></td></tr><tr><td>glass slides</td><td>VWR</td><td>48312-003</td><td></td></tr><tr><td>glucose</td><td>Various</td><td></td><td></td></tr><tr><td>graduated 1.5 ml tubes</td><td>Various</td><td></td><td></td></tr><tr><td>HEPES</td><td>VWR</td><td>EM-5330</td><td>available from several venders</td></tr><tr><td>Hoechst 33342</td><td>Various</td><td></td><td></td></tr><tr><td>magnesium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>methanol</td><td>Various</td><td></td><td></td></tr><tr><td>large mesh (~1,500 &amp;micro;m)</td><td>VWR</td><td>AA43657-NK</td><td>variety of formats and other suppliers, 12 or 14 mesh</td></tr><tr><td>small mesh (~300 &amp;micro;m)</td><td>Spectrum labs</td><td>146 424</td><td>variety of formats, &lt;em&gt;e.g.&lt;/em&gt;, 146 422 or 146 486</td></tr><tr><td>nutator</td><td>Various</td><td></td><td></td></tr><tr><td>Pasteur pipets</td><td>Various</td><td></td><td></td></tr><tr><td>potassium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>Cacodylic acid</td><td>Sigma</td><td>C0125</td><td>HAZARDOUS; alternatively, sodium cacodylate may be substituted</td></tr><tr><td>potassium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sodium acetate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium chloride</td><td>Various</td><td></td><td></td></tr><tr><td>sodium citrate</td><td>Various</td><td></td><td></td></tr><tr><td>sodium hydroxide</td><td>Various</td><td></td><td></td></tr><tr><td>sucrose</td><td>Various</td><td></td><td></td></tr><tr><td>taxol (paclitaxel)</td><td>Sigma</td><td>T1912</td><td>HAZARDOUS</td></tr><tr><td>Triton X-100</td><td>Fisher</td><td>PI-28314</td><td></td></tr><tr><td>Tween 20</td><td>Fisher</td><td>PI-28320</td><td></td></tr><tr><td>vortex</td><td>Various</td><td></td><td></td></tr></tbody></table>

techniques for imaging prometaphase and metaphase of meiosis i in fixed drosophila oocytes

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The study of chromosome behavior in oocytes from model organisms holds much promise to uncover the molecular basis of the susceptibility of human oocytes to aneuploidy. Drosophila melanogaster is amenable to genetic manipulation, with over 100 years of research, community, and technique development. Visualizing chromosome behavior and spindle assembly in Drosophila oocytes has particular challenges, however, due primarily to the presence of membranes surrounding the oocyte that are impenetrable to antibodies. We describe here protocols for the collection, preparation, and imaging of meiosis I spindle assembly and chromosome behavior in Drosophila oocytes, which allow the molecular dissection of chromosome segregation in this important model organism.

Los métodos que hemos descrito aquí, dará lugar a la colección de la última etapa de ovocitos Drosophila representan tres etapas de la meiosis (Figura 1). Los ovocitos en profase se distinguen por la presencia de la envoltura nuclear, que es visible por la falta de señal de la tubulina en la región que rodea el cariosoma (Figura 1A). Prometafase es el período posterior rotura de la envuelta nuclear durante el cual los ensambles de cabeza...

Watch this Scientific Journal Video about Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes at JoVE.com

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Técnicas de Imagen y Prometafase metafase de la meiosis I en fijo<em&gt; Drosophila</emLos ovocitos&gt;

Chromosome segregation in human oocytes is error prone, resulting in aneuploidy, which is the leading genetic cause of miscarriage and birth defects. The ...

techniques-for-imaging-prometaphase-metaphase-meiosis-i-fixed

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Unit 2

Meiosis

SCIENTISTS IN ACTION

9.0K vistas.  Rutgers University. We present protocols for the collection, preparation, and imaging of mature Drosophila oocytes. These methods allow the visualization of chromosome behavior and spindle assembly and function during meiosis.

Video: Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Uso de ovocitos de ratón para evaluar la función humana del Gene durante la Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

Investigación

Genética

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Con fluorescencia In Situ hibridación (pescado) para supervisar el estado de la cohesión de brazo en Prometafase y metafase I ovocitos de Drosophila

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Biología del Desarrollo

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Técnicas de microinyección para el estudio de la mitosis en el Drosophila melanogaster Embrión sincitial

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Biología

Nuclear Migration in the Drosophila Oocyte

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton rearrangements, or polarity patterning within the cells. When studying oocyte nucleus positioning, live-imaging techniques are essential to capture the dynamic events of this process. The Drosophila egg chamber is a multicellular structure and an excellent model system to study this phenomenon because of its large size and availability of numerous genetic tools. During Drosophila mid-oogenesis, the nucleus migrates from a central position within the oocyte to adopt an asymmetric position mediated by microtubule-generated forces. This migration and positioning of the nucleus are necessary to determine the polarity axes of the embryo and the subsequent adult fly. One characteristic of this migration is that it occurs in three dimensions (3D), creating a necessity for live imaging. Thus, to study the mechanisms that regulate nuclear migration, we have developed a protocol to culture the dissected egg chambers and perform live imaging for 12 h by time-lapse acquisitions using spinning-disk confocal microscopy. Overall, our conditions allow us to preserve Drosophila egg chambers alive for a long period of time, thereby enabling the completion of nuclear migration to be visualized in a large number of samples in 3D.

Nuclear Migration in the Drosophila Oocyte

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

Migración nuclear en el ovocito Drosophila

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton ...

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment and maintenance of epithelial tissue morphology and organ morphogenesis. Moreover, the BM is essential for tissue modeling, serving as a signaling platform, and providing external forces to shape tissues and organs. Despite the many important roles that the BM plays during normal development and pathological conditions, the biological pathways controlling the intracellular trafficking of BM-containing vesicles and how basal secretion leads to the polarized deposition of BM proteins are poorly understood. The follicular epithelium of the Drosophila ovary is an excellent model system to study the basal deposition of BM membrane proteins, as it produces and secretes all major components of the BM. Confocal and super-resolution imaging combined with image processing in fixed tissues allows for the identification and characterization of cellular factors specifically involved in the intracellular trafficking and deposition of BM proteins. This article presents a detailed protocol for staining and imaging BM-containing vesicles and deposited BM using endogenously tagged proteins in the follicular epithelium of the Drosophila ovary. This protocol can be applied to address both qualitative and quantitative questions and it was developed to accommodate high-throughput screening, allowing for the rapid and efficient identification of factors involved in the polarized intracellular trafficking and secretion of vesicles during epithelial tissue development.

Confocal and Super-Resolution Imaging of Polarized Intracellular Trafficking and Secretion of Basement Membrane Proteins During Drosophila Oogenesis

The basement membrane is essential for tissue and organ morphogenesis during development. To better understand the mechanisms leading to proper placement of this structure, the protocol presented describes methods to visualize and characterize the intracellular trafficking and secretion of basement membrane proteins in epithelial cells using confocal and super-resolution microscopy.

Imágenes confocales y de superresolución del tráfico intracelular polarizado y la secreción de proteínas de la membrana basal durante la oogénesis de Drosophila

The basement membrane (BM) - a specialized sheet of extracellular matrix present at the basal side of epithelial cells - is critical for the establishment ...

Mouse Oocyte Microinjection, Maturation and Ploidy Assessment

Mistakes in chromosome segregation lead to aneuploid cells. In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to infertility, miscarriages or developmental disorders like Down syndrome. Haploid gametes form through species-specific developmental programs that are coupled to meiosis. The first meiotic division (MI) is unique to meiosis because sister chromatids remain attached while homologous chromosomes are segregated. For reasons not fully understood, this reductional division is prone to errors and is more commonly the source of aneuploidy than errors in meiosis II (MII) or than errors in male meiosis 1,2. 
In mammals, oocytes arrest at prophase of MI with a large, intact germinal vesicle (GV; nucleus) and only resume meiosis when they receive ovulatory cues. Once meiosis resumes, oocytes complete MI and undergo an asymmetric cell division, arresting again at metaphase of MII. Eggs will not complete MII until they are fertilized by sperm. Oocytes also can undergo meiotic maturation using established in vitro culture conditions 3. Because generation of transgenic and gene-targeted mouse mutants is costly and can take long periods of time, manipulation of female gametes in vitro is a more economical and time-saving strategy. 
Here, we describe methods to isolate prophase-arrested oocytes from mice and for microinjection. Any material of choice may be introduced into the oocyte, but because meiotically-competent oocytes are transcriptionally silent 4,5 cRNA, and not DNA, must be injected for ectopic expression studies. To assess ploidy, we describe our conditions for in vitro maturation of oocytes to MII eggs. Historically, chromosome-spreading techniques are used for counting chromosome number 6. This method is technically challenging and is limited to only identifying hyperploidies. Here, we describe a method to determine hypo-and hyperploidies using intact eggs 7-8. This method uses monastrol, a kinesin-5 inhibitor, that collapses the bipolar spindle into a monopolar spindle 9 thus separating chromosomes such that individual kinetochores can readily be detected and counted by using an anti-CREST autoimmune serum. Because this method is performed in intact eggs, chromosomes are not lost due to operator error.

Oocytes are prone to aneuploidy due to errors in chromosome segregation during meiotic maturation. Aneuploid eggs can cause infertility, miscarriages or developmental disorders like Down syndrome. Here, we describe methods to introduce materials of choice into oocytes and methods to study meiotic maturation and assess ploidy.

La microinyección de ovocitos de ratón, Maduración y Evaluación de ploidía

Mistakes in chromosome segregation lead to aneuploid cells.  In somatic cells, aneuploidy is associated with cancer but in gametes, aneuploidy leads to ...

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle microtubules to prevent anaphase onset until the chromosomes are properly connected. Cells use this mechanism to prevent aneuploidy or genomic instability, and hence cancers and other human diseases like birth defects and Alzheimer's1. A number of the SAC components such as Mad1, Mad2, Bub1, BubR1, Bub3, Mps1, Zw10, Rod and Aurora B kinase have been identified and they are all kinetochore dynamic proteins2. Evidence suggests that the kinetochore is where the SAC signal is initiated. The SAC prime regulatory target is Cdc20. Cdc20 is one of the essential APC/C (Anaphase Promoting Complex or Cyclosome) activators3 and is also a kinetochore dynamic protein4-6. When activated, the SAC inhibits the activity of the APC/C to prevent the destruction of two key substrates, cyclin B and securin, thereby preventing the metaphase to anaphase transition7,8. Exactly how the SAC signal is initiated and assembled on the kinetochores and relayed onto the APC/C to inhibit its function still remains elusive.
Drosophila is an extremely tractable experimental system; a much simpler and better-understood organism compared to the human but one that shares fundamental processes in common. It is, perhaps, one of the best organisms to use for bio-imaging studies in living cells, especially for visualization of the mitotic events in space and time, as the early embryo goes through 13 rapid nuclear division cycles synchronously (8-10 minutes for each cycle at 25 &deg;C) and gradually organizes the nuclei in a single monolayer just underneath the cortex9.
Here, I present a bio-imaging method using transgenic Drosophila expressing GFP (Green Fluorescent Protein) or its variant-targeted proteins of interest and a Leica TCS SP2 confocal laser scanning microscope system to study the SAC function in flies, by showing images of GFP fusion proteins of some of the SAC components, Cdc20 and Mad2, as the example.

Studying Mitotic Checkpoint by Illustrating Dynamic Kinetochore Protein Behavior and Chromosome Motion in Living Drosophila Syncytial Embryos

The kinetochore is where the SAC initiates its signal monitoring the mitotic segregation of the sister chromatids. A method is described to visualize the recruitment and turnover of one of the kinetochore proteins and its coordination with the chromosome motion in Drosophila embryos using a Leica laser scanning confocal system.

El estudio de puesto de control mitótico, ilustrando comportamiento dinámico de proteínas cinetocoro y el movimiento de cromosomas en vivo<em&gt; Drosophila</em&gt; Los embriones Sincitial

The spindle assembly checkpoint (SAC) mechanism is an active signal, which monitors the interaction between chromosome kinetochores and spindle ...

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

The Drosophila oocyte has been established as a versatile system for investigating fundamental questions such as cytoskeletal function, cell organization, and organelle structure and function. The availability of various GFP-tagged proteins means that many cellular processes can be monitored in living cells over the course of minutes or hours, and using this technique, processes such as RNP transport, epithelial morphogenesis, and tissue remodeling have been described in great detail in Drosophila oocytes1,2.
The ability to perform video imaging combined with a rich repertoire of mutants allows an enormous variety of genes and processes to be examined in incredible detail. One such example is the process of ooplasmic streaming, which initiates at mid-oogenesis3,4. This vigorous movement of cytoplasmic vesicles is microtubule and kinesin-dependent5 and provides a useful system for investigating cytoskeleton function at these stages.
Here I present a protocol for time lapse imaging of living oocytes using virtually any confocal microscopy setup.

Live Imaging of GFP-labeled Proteins in Drosophila Oocytes

A protocol for live imaging of GFP-tagged proteins or autofluorescent structures in individual Drosophila oocytes is described.

Imágenes en directo de las proteínas GFP-etiquetados en<em&gt; Drosophila</em&gt; Los ovocitos

The  Drosophila oocyte has been established as a versatile system for investigating  fundamental questions such as cytoskeletal function, cell ...

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both the female and male germ lines of Drosophila have contributed greatly to the current understanding of meiosis as well as stem cell biology. Excellent protocols are available in the literature for the isolation and imaging of Drosophila ovaries&#160;and testes3-12. Herein, methods for the dissection and preparation of Drosophila testes for microscopic analysis are described with an accompanying video demonstration. A protocol for isolating testes from the abdomen of adult males and preparing slides of live tissue for analysis by phase-contrast microscopy as well as a protocol for fixing and immunostaining testes for analysis by fluorescence microscopy are presented. These techniques can be applied in the characterization of Drosophila mutants that exhibit defects in spermatogenesis as well as in the visualization of subcellular localizations of proteins.

Cytological Analysis of Spermatogenesis: Live and Fixed Preparations of Drosophila Testes

Methods for isolating and preparing Drosophila testes samples (live and fixed) for imaging by phase-contrast and fluorescence microscopy are described herein.&#160;

Análisis citológico de espermatogénesis: Los preparativos en directo y fijas de<em&gt; Drosophila</em&gt; Testículos

Drosophila melanogaster is a powerful model system that has been widely used to elucidate a variety of biological processes. For example, studies of both ...

Preparation of Fixed Drosophila Oocytes for Immunostaining: A High-Throughput Method to Fix and Remove the Outer Membrane

Source: Radford, S. J., McKim, K. S. <a href="https://www.jove.com/video/54666/" target="_blank">Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes</a>. J. Vis. Exp. (2016).
Immunostaining of Drosophila late-stage oocytes can prove challenging due to the oocytes&#39; surrounding membranes. This video describes a high-throughput method for obtaining oocytes, their fixation, and membranes&#39; removal for immunostaining. The featured protocol demonstrates these techniques with late-stage oocytes used to visualize different stages of meiosis.

Preparación de ovocitos fijos de Drosophila para inmunotinción: un método de alto rendimiento para fijar y eliminar la membrana externa

Source: Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (2016).
...

Técnicas de Imagen y Prometafase metafase de la meiosis I en fijo

Resumen

Explorar más videos

Capítulos en este video